Nucleotide sequence analysis of the structural gene coding region of the pestivirus border disease virus

Virus Research

Virus Research 33 (1994) 219-228

Nucleotide sequence analysis of the structural gene coding region of the pestivirus border disease virus Daniel G. Sullivan a,b, Gwong-Jen Chang ‘, Dennis W. Trent ‘, Ramesh K. Akkina a,* Lkpartmentsof a Pathology and b ~~crobjol~,

Coiorudo State Uni~ersi~, Fort Co&q CO 80523, USA ’ Div~io~ of Vector Borne lnfe~t~o~ Diseases? Notional Center for D&e&se Control and Prevention Public Health Service, Departmenf of Health and Human Services, Fort Collins, CO, USA

Received 15 February 1994; accepted 8 April 1994

Abstract disease virus (BDV) of sheep, an important ovine pathogen, is serologically to the two other well characterized members of the P&virus genus of the FZuviuiri~~e famiIy, namely bovine viral diarrhea virus (BVDV) and hog cholera virus (HoCV). To determine its genetic relationship to BVDV and HoCV, the genome of BDV strain, BD-78 encompassing the 5’ untranslated region (UTR) and structural gene coding region was molecularly cloned and the nucleotide sequence determined. The sequenced region of 3,567 nucleotides contained one open reading frame encoding 1063 amino acids. The nucleotide and amino acid sequences of BD-78 were compared with those of two BVDV strains NADL and SD-l, and the Alfort and Brescia strains of HoCV. The overall nucleotide sequence homologies of the region sequenced of BD-78 are 68.3% with BVDVNADL, 67.8% with BVDV-SD-l, 69.0% with HoCV-Brescia, and 65.8% with HoCV-Alfort. The overall amino acid sequence homologies of BD-78 are 76.1% with NADL, 76.5% with SD-l, 74.2% with Brescia, and 72.9% with Alfort. The most conserved nucleotide and amino acid sequences between BD-78 and the other pestivirueses are in the 5’ UTR and the capsid protein coding region (~141, where as the most divergent sequences are in the E2 coding region, These findings suggest that BDV is a unique virus in the Pestivincs genus. Border

related

Key words:

Border

* Corresponding

disease

virus; Pestivirus;

Ovine pestivirus

genome

author.

0168-1702/94/$07.00 0 1994 Elsevier Science B.V. All rights reserved SSDZ 0168-1702(94)00038-E

220

LXG. Sul~~~a~et al. / F?rus Research 33 (1994) 219-228

1. Introduction Border disease (BD) is an economically important congenital infection of sheep and goats characterized by a variety of disease syndromes, Pathological manifestations of BD include abortions, mummification, birth of weak lambs with neurological symptoms, congenital malformations and persistent infections (Terpstra, 1985). The causative agent, border disease virus (BDV), is an RNA virus classified under the ~~~~~u~~ genus of the Flaviviridae family, together with two other important livestock pathogens bovine viral diarrhea virus (BVDV) and hog cholera virus (HoCV) (Francki et al., 1991). Serological analysis utilizing polyclonal and monoclonal antibodies revealed the antigenic cross-reactivity of BDV with that of BVDV and HoCV (Collett et al., 1989; Akkina and Raisch, 1990; Edwards et al., 1991). Molecular characterization of the genomes of BVDV and HoCV established that pestiviruses are composed of positive sense single-stranded RNA of about 12.5 kb in length (Collett et al., 1988b; Meyers et al., 1989; Moormann et al., 1990). Replication involves translation of a single large protein which is subsequently processed by both host and virus-encoded proteases (Akkina, 1991; Wiskerchen and Collett, 1991; Rumenapf, 1993). Viral glycoproteins EO, El and E2 are derived by post-translational proteolytic processing and EO and E2 are involved in virus neutralization (Rumenapf et al., 1991; Weiland et al., 1992). Results from nudeotide and direct amino acid sequencing are beginning to provide data on the cleavage sites on the putative polyprotein (Collett et al., 1988b; M~rmann et al., 1990: Rumenapf, 1993; Stark et al., 1993). The sequence data also provided insights into the molecular relationships between BVDV and HoCV (Meyers et al., 1989; Deng and Brock, 1992; De Moerlooze et al., 1993). However, molecular analysis of the third member of the Pestivirus genus, BDV has been limited and it has not been possible to compare the genome of BDV with those of BVDV and HoCV. We previously characterized the intra~llular viral pol~eptides of BDV and determined that many of the viral polypeptides cross-react with BVDV proteins (Akkina and Raisch, 1990). In this report, to determine the genetic relatedness of BDV with BVDV and HoCV we cloned and sequenced the 5’ UTR and the structural gene coding region of viral strain BD-78. The nucleotide sequence and the deduced amino acid sequence are compared with those of two BVDV strains NADL and SD-l, and two HoCV strains AIfort and Brescia to elucidate the evolutionary relationships between these three important animal pathogens.

2. Materials and methods 2.1. Cell culture and virus

The BD-78 strain of BDV used in this study was originally isolated from an infected lamb (Evermann et al., 1981). The virus is non-~opathic in bovine fetal

D.G.~~van~~al./~~Resea~~

33 (1994) 219-228

221

spleen (BFS) cells and was previosly characterized with regards to its intracellular virus-induced polypeptides (Akkina and Raisch, 1990). BFS cells were grown in Eagles’ minimal essential medium (MEM) containing 10% lamb serum (Colorado Serum Company, Denver, CO). Cells were infected at a mutliplici~ of infection of 1.0 with cloned viral stocks in maintenance medium containing 2% horse serum.

2.2. virus purification and RNA extraction Confluent BFS cell cultures were infected with BD-78 virus and incubated at 37°C for 36 h. Virus ~ntaining supernatant from infected cells was clarified at 10 000 x g for 15 min at 4°C and the virus pelleted by centrifugation at 110 000 x g for 3 h at 4°C. The viral pellet was resuspended in 300 ~1 in lysis buffer (4 M guanidinium isothiocyanate; 25 mM sodium citrate [pH 7.01: 0.5% sarkosyl; 100 mM 2-mercaptoethanol), and 30 ~1 2 M sodium acetate (pH 4.0) 300 ~1 phenol, and 60 ,ul chlorofo~-isoamyl alcohol (241) were added. The mixture was vortexed, placed on ice for 20 min, and centrifuged at 10 000 X g for 30 min at 4OC (MacDonald et al., 1987). The RNA in the aqueous phase was precipitated with an equal volume of isopropanol and washed in 70% ethanol. The RNA was resuspended in 50 ~1 diethyl pyrocarbonate (DEPC) treated water. 2.3. &DNA ~nt~s~

and PCR ampli~cation

Reverse transcription and polymerase chain reactions CRT-PCR) were carried out in the same reaction tube. Primers used to amplify the first two BD-78 fragments were designed using genomic regions sharing significant sequence homolgy (85% or more) between the two BVDV strains NADL and Osloss. After dete~ination of the nucleotide sequence of the first two BD-78 cDNA clones, primers were desinged based on the BD-78 sequence. RT-PCR primer sequences were as follows; pl-5’ACGAGAATTAGAAAAGACACTCGTATAC3’, p2-5’AAGTTCATTTGAAAACAACTCCATGTGCJ, p3-5’CCTGATAGGGTGCTGC AGAGGCCCAO’, p4-5’CACCAACCATGCTTGTTCCACT3’, p5-SAAGACCAACACACGTG’ITGCAGGTTGC3’, and p6-STCACACACTGTGCATACATTGCAGTGCITG3’. Primers and viral RNA were incubated at 75°C for 10 min and quickly cooled on ice for 10 min to allow annealing of the downstream primer to the genomic RNA. The RT-PCR reaction contained 1 X PCR buffer (10 X buffer contains 500 mM KCI; 100 mM Tris-HCl [pH 8.31; 15 mM MgCl,), 0.25 mM dithiothreitol 1.0 FM of each primer, 1 mM of each deoxynucleotide (dATP, dCTP, dGTP, dTTP), 40 units of RNasin (Promega Corp., Madison, WI.), 2.7 units of RAV reverse transcriptase (Amersham Corp., Arlinton Heights, IL), and 2.5 units of Amplitaq (Perk&Elmer Cetus Corp., Norwalk, CT) in a reaction volume of 100 ,ul. The RT reaction was carried out at 55°C for 60 min followed by an initial denaturation at 94°C for 2 min. The PCR reaction was 30 cycles with the following reaction parameters: template denaturation 94°C for 1 min, primer annealing 55°C for 1 min, and extension at 72°C for 3 min. A single final extension step was done at

222

D.C. S~~I~v~net al. / vinrs Resewch 33 (1994) 219-228

72°C for 30 min to complete the amplification reaction. Amplified products were analyzed on 1.0% agarose gels. (Sambrook et al., 1989). 2-4. Cloning and sequencing PCR fragments were purified by adsorption/elution onto glass beads (Geneclean, Bio 101, La Jolla, CA) and ligated with pCR II vector (Invitrogen Corp., San Diego, CA) according to manufacturer’s directions. Alkaline lysis and PEG precipitation were used to extract and purify plasmid DNA (Sambrook et al., 1989) for double-stranded DNA sequencing (Chen and Seeburg, 1985). The nucleotide sequence of the inserts was determined by the progressive oligonucleotide primer method (Sambrook et al., 1989) using the dideoxy chain termination method @anger et al., 1977) and Sequenase Vet-. 2.0 sequencing kit (United States Bi~hemicals, Cleveland, OH). To generate fragment 3, a lo-fold increase in target RNA was required (1 pg) and the extension time was increased to 5 min in the RT-PCR reaction. To detect errors created by Taq polymerase, repeat cDNA cloning of three independent RT-PCR clones for each region was perfomed. 2.5. Computer analysis Nucleotide and amino acid sequence compa~son and analysis were made with HIBIO DNASIS/PROSIS (Hitachi Software Engineering Co., San Bruno, CA) and with MacVector (IBI-A Kodak Co., New Haven, CT). Phylogenetic analysis were performed using the Phylogenetic Analysis Using Parsimony, version 3.0 (Illinois Natural History Survey, 1991).

3. Results 3.1. Nucleotide and amino acid sequence of BD-78

The 5’ one-third of BDV genome, was cloned in three overlapping cDNA fragments generated by RT-PCR (Fig. 1). Fragment 1, 390 base pairs in length containing most of the 5’ untranslated region, was generated using the upstream primer derived from the 5’ seqeunce of the prototype BVDV strain NADL. Fragment 2 was 1200 base pairs in length and fragment 3 was 3300 base pairs in length. The nucleotide sequence of the structural gene coding region of BDV was determined by sequencing both strands of three clones from independent RT-PCR reactions. Comparison of the duplicate clones revealed 10 nucleotide differences. A consensus sequence was obtained from two of the three clones which were identical for each position where one of the sequences was different. A total of 3,567 nucleotides of the BDV genome was sequenced (Fig. 2). Base composition of the sequenced region is 31.2% A, 20.5% C, 26.7% G, and 21.7% U and is similiar to both NADL and SD-1 RNA (Collett et al., 1988b, Deng and Brock, 1992). Analysis of the BDV sequence revealed a single open reading frame

223

D.G. Sullivan et al. / iGus Research 33 (1994) 219-228

B. Okb

2kb

3kb

4.8k.b 1

5’

Ps

-> <-

-> <-

fl -> <-

-> <-

P6

-> <-

Fig. 1. (A) BVDV genomic map showing relative positions of protein coding regions. (B) Positioning of cDNA clones of BD-78 generated by RT-PCR. PCR primers are designated Pl-P6. Clones used to determine the nucleotide sequence are shown as lines and sequencing primers are shown as arrows.

(ORF) in the second phase of one strand. The large ORF starts with the AUG at position 378 to 380 and continued through base 3567. The predicted amino acid sequence of the large open reading frame is presented in Fig. 2. The 5’ UTR preceeding the large ORF is 377 nucleotides in length and includes ten AUG start codons with three small ORFs which can code for a minimum of 25 amino acids each. Sixteen potential N-linked glycoslylation sequences (Asn-X-Ser or Asn-XThr) were located in the glycoprotein coding region between residues 271 and 1067. The potential glycosylation sites in the predicted coding region of the glycoproteins are eight for EO, two for El and six for E2. 3.2. Comparison of nucleotide and amino acid sequences The overall nucleotide sequence homologies of the region sequenced of BD-78 are 68.3% with NADL, 67.8% with SD-l, 69.0% with HoCV Brescia, and 65.8% with HOW Alfort. The most conserved regions between BD-78 and the other pestiviruses are the 5’ UTR with nucleotide homologies ranging from 72-78% and the capsid protein coding region (~14) with nucleotide homologies ranging from 75-81% and the most divergent sequences are in the E2 coding region with nucleotide homologies between 60-66% (Fig. 4). The predicted amino acid sequence of BDV is more conserved than the nucleotide sequence among the pestiviruses. The overall amino acid sequence homologies of BD-78 are 71.6% with NADL, 71.2% with SD-l, 66.1% with Brescia, and 67.0% with Alfort. As with the nucleotide homologies, the most conserved protein was the capsid protein with

Fig. 2. Nucleotide sequence of the 5’ one-third genome of BDV strain BD-78. The deduced amino acid sequence of the large ORF is shown above the nucleotide sequence in one letter code. The putative glycosylation sites in the viral glycoprotein region are denoted by asterisks above the asparagine residues. The 5’ UTR and protein coding regions are denoted according to (Rumenapf et al., 1993; Stark et at., 1993). The signal sequence is denoted by a solid bar over the amino acid sequence. Nucleotides are numbered consecutively and the amino acid residues are numbered for each protein coding region.

amino acid homologies between 75-81% and the most divergent structural glycoprotein was E2 with homologies ranging from 54-63% (Fig. 4).

4. Discussion

To understand the genetic relationships between the structural genes of BDV and other pestiviruses, the structural protein coding region of a BDV isolate (BD-78) has been cloned by RT-PCR and sequenced. AnaIysis of the nucleotide and amino acid sequences of the N-te~inal one-third of BDV genome revealed

D.G. Sullivan et al. /l&us

Research 33 (1994) 219-228

Fig. 3. Alignment of amino acid residues l-1063 of the ORF of Pestiviruses. Single letter symbols for amino acids are used. The sequence shown in the top line is for BD-78. Periods indicate the identity with BD-78 sequence. Hyphens indicate the deletions compared with each other. The putative glycosylation sites in the viral glycoprotein region are denoted by stars over the asparagine residues. The signal sequence is noted by a solid bar over the amino acid sequence. The amino acids are numbered for each protein coding region.

that the overall genomic structure of pestiviruses is conserved. Similarity in the hydrophilicity plots between the different pestiviruses suggests a conserved protein structure and function. Recently, cleavage sites within the HoCV glycoproteins have been identifed (Rumenapf et al., 1993). Homology of BD-78 amino acid sequences flanking glycoprotein cleavage sites to that of HoCV (Alfort) suggests that cleavage of BDV glycoproteins occurs at homologous sites. The amino acid sequence alignment of the structural gene coding region of six pestiviruses (Fig. 3) revealed deletions that are present in the HoCV amino acid

DC.

226

qVDV

BVDV

HoCV

H&V

&&van

et al. /t&us

Research

33 (1994)

219-228

NADL 77

68

73

73

66

7.2

71

72

67 (69)

72 (78)

,::,

SD-1

Alfart

Btwcla

(741

5&&i2%

Fig. 4. Comparison of nucleotide and amino acid sequences of BD-78 with those of other pestiviruses. Sequences were compared on basis of the genomic organizations of BVDV (Collett et al., 1988a) and HoCV (Rumenapf et al., 1993; Stark et al., 1993). The percent nudeotide homologies are given in the upper line and the percent amino acid homologies are given below in parentheses.

sequence of ~14 at postions 7-9 are not found in either BD-78 or BVDV. BD-78 genome contains three amino acid deletions in the E2 protein at postions 33, 34 and 239 that are not found in other pestiviruses. All the pestiviruses except for BD-78 contain deletions at positions 246 and 247 of the E2 protein. EO of BDV contains 8 potential glycosylation sites that are also conserved in BVDV. However, sites 3 and 8 of EO are not conserved between BD-78 and HoCV. Both of the potential glycosylation sites within El are conserved among all the pestiviruses. E2 of BDV contains six potential glycosylation sites. Site 3 is unique to BD-78, whereas site 5 is not conserved between BDV and BVDV. Site 6 is conserved with all pestiviral strains except HoCV Brescia. The additional two potential glycosylation sites in the coding region of E2 in BD-78 may account for the size difference between E2 of NADL and E2 of BD-78 (Akkina and Raisch, 1990). A small region of the genome encompassing p20 has recently become availible for two BD-like, British isolates, strains 87/6 and 137/4 (Roehe et al., 1992). A comparison of these sequences with BD-78 revealed homologies slightly lower than those between BD-78 and other pestiviruses. The nucleotide sequence homologies of BD-78 in this region are 63.9% with 87/6 and 64.5% with 137/4, whereas the amino acid sequence homologies are 65.2% with 87/6 and 67.0% with 137/4. Alignment of the deduced amino acids in this region revealed that similiar to BVDV, BD-78 does not contain any deletions between residues 7-9 of ~14, like that of both the British BDV isolates and HoCV. The BD-78 sequence is equally divergent from the sequences of other BD-Iike, British isolates. Homology comparisons between pestiviruses sequenced so far indicate that the sequence of BD-78 is divergent from those of other pestiviruses, BVDV and HoCV. Additionally, the phylogentic analysis of the amino acid sequences of the structural gene coding region (Fig. 5) suggests that sequences of the three BVDV strains have a closer relationship to each other than to the HoCV and BD-78.

D.G.

S~~vun

et al. ,/ kfrus Research

33 fl994)

+

SVDV NAOL

1

BVDV SD1

r---

219-228

227

53

ice

a?8

78

157

EVDV OSLO.33

BDV 8078

Fig. 5. Phylogenetic analysis of the amino acid sequence of the structural gene coding region (amino acids l-1063) of BVDV, BDV and HoCV based on maximum parsimony. The numbers indicate the distance from the end of a branch to the node. The tree is non-rooted with HoCV Brescia designated as an outgroup.

These data also show that BD-78 is almost as divergent from BVDV as it is from HoCV, indicating that it is a unique virus in the Pestivim genus. Additional significant sequence differences found in the p20 coding region between strain BD-78 and the two BD-like british isolates suggest heterogenei~ among BDV strains. Whether this is due to geographic differences needs to be determined by analysis of additional isolates.

Acknowledgements The authors would like to thank Richard Kinney for helpful discussion and Jill Miyamoto for technical assistance. Work reported here is supported by grants from United States Department of Agriculture and the College Research Council, College of Veterinary Medicine, Colorado State University.

References Akkina, R.K. (1991) Pestivirus bovine viral diarrhea virus polypeptides: identi~cation of new precursor proteins and alternative cleavage pathways. Virus Res. 19, 67-82. Akkina, R.K. and Raisch, K.P. (1990) intracellular virus-induced polypeptides of pestivirus border disease virus. Virus Res. 16, 95-106. Chen, E.Y. and Seeburg, P.H. (1985) Supercoil sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4, 165-170. Collett, MS., Larson, R., Belzer, S.K. and Retzel, E. (1988a). Proteins encoded by bovine viral diarrhea virus: the genomic organization of a pestivirus. Virology 165, 200-208. Collett, M.S., Larson, R., Gold, C., Strick, D., Anderson, D.K. and Purchio, A.F. (1988b). Molecular cloning and nucleotide sequence of the pestivirus bovine viral diarrhea virus. Virology 165, 191-199.

228

D.G. Sullivan et al. / I&us Research 33 (1994) 219-228

Collett, M.S., Moennig, V. and Horzinek, M.C. (1989) Recent advances in pestivirus research J. Gen. Viral. 70, 253-266. De Moedooze, L., Lecomte, C., Brown-Shimmer, S., Schmetz, D., Guiot, C., Vanden~r8h, D., Allaer, D., Rossius, M., Chappuis, G., Dina, D., Renard, A. and Martial, J.A. (1993) Nucleotide sequence of the bovine viral diarrhea virus Osloss strain: comparison with related viruses and identification of specific DNA probes in the 5’ untranslated region. J. Gen. Virol. 74, 1433-1438.. Deng, R. and Brock, K.V. (1992) Molecular cloning and nucleotide sequencing of a pestivirus genome, noncytopathic bovine viral diarrhea virus strain SD-l. Virology 191, 867-879. Edwards, S., Moennig, V. and Wensvoort, G. (1991) The development of an international reference panel of mon~lonal antibodies for the differentiation of hog cholera virus from other pestiviruses. Vet. Microbial. 29, 101-108. Evermann, J.F., Faris, M.A., Niemi, SM. and W., W.R. (1981) Pestivirus persistence and pathogenesis: comparitive diagnostic aspects of border disease virus of sheep and bovine viral diarrhea virus. Proc. Am. Ass. Vet. Lab. Diagn. 24, 407-426. Francki, RIB., Fauquet, CM., Knudson, D.L. and Brown, F. (1991) Classification and nomenclature of viruses. Arch. Viral. S2, 228. MacDonald, R.J., Swift, G.H., Przybla, A.E. and Chirgwin, J.M. (1987) Isolation of RNA using guanidinium salts. Methods Enzymol. 152,219-227. Meyers, G., Rumenapf, T. and Theil, H.-J. (1989) Molecular cloning and nucleotide sequence of the genome of hog cholera virus. Virology 171, 555-567. Moormann, R.J.M., Warmerdam, P.A.M., Van der Meer, B., Schaaper, W.M.M., Wensvoort, G. and Hulst, M.M. (1990) Molecular cloning and nucleotide sequence of hog cholera virus strain Brescia and mapping of the genomic region encoding envelope glycoprotein El. Virology 177, 184-198. Roehe, P.M., Woodward, M.J. and Edwards, S. (19921 Characterization of p20 gene sequences from a border disease-like pestivirus isolated from pigs. Veterin~ Microbial. 33, 231-238. Rumenapf, T., Stark, R., Meyers, G. and Tbiel, H.-J. (1991) Structural proteins of hog cholera virus expressed by vaccinia virus: further characterization and induction of protective immunity. J. Viral. 65, 589-597. Rumenapf, T., Unger, G., Strauss, J.H. and Thiel, H.-J. (1993) Processing of the envelope glycoproteins of pestiviruses. J. Virol. 67, 3288-3294. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning A Laboratory Manual, 2nd. Cold Spring Harbor Press. Cold Spring Harbor, New York. Sanger, F., Nicklen, S. and Cot&on, A.R. (1977) DNA sequencing with chain-te~nating inhibitor. Proc. Natl. Acad. Sci. USA 74,5463-5467. Stark, R., Meyers, G., Rumenapf, T. and Thiel, H.-J. (1993) Processing of pestivirus polyprotein: cleavage site between autoprotease and nucleocapsid protein of classical swine fever virus. J. Virol. 67, 7088-7095. Terpstra, C. (1985) Border disease: a congenital infection of small ruminants. Prog. Vet. Microbial. Immun. 1,175-198. Weiland, E., A&l, R., Stark, R., Weiland, F. and Thiel, H.-J. (1992) A second envelope glycoprotein mediates neutralization of a pestivirus, hog cholera virus. J. Virol. 66, 3677-3682. Wiskerchen, M. and Collett, M.S. (19911 Pestivirus gene expression: protein p80 of bovine viral diarrhea virus is a proteinase involved in polyprotein processing. Virology 184, l-10.