Nucleotide Sequence of Alkyl-dihydroxyacetonephosphate Synthase cDNA fromDictyostelium discoideum

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.

252, 629 – 633 (1998)

RC989670

Nucleotide Sequence of Alkyl-dihydroxyacetonephosphate Synthase cDNA from Dictyostelium discoideum Edwin C. J. M. de Vet and Henk van den Bosch1 Centre for Biomembranes and Lipid Enzymology, Institute for Biomembranes, Utrecht University, Utrecht, The Netherlands

Received October 14, 1998

The nucleotide sequence is reported of alkyldihydroxyacetonephosphate synthase cDNA from the cellular slime mold Dictyostelium discoideum. The open reading frame encodes a protein of 611 amino acids which shows a 33% amino acid identity to the human enzyme. This D. discoideum homolog carries a variant of the peroxisomal targeting signal type 1 at its C-terminus (PKL). Expression of the cDNA in Escherichia coli yielded an enzymatically active protein. © 1998 Academic Press

Most ether lipids carry either an alkyl or an alkenyl linkage at the sn-1 position of the glycerol backbone. The biosynthesis of these ether lipids starts with the acylation of dihydroxyacetonephosphate (DHAP) to yield acyl-DHAP, a step catalyzed by DHAP acyltransferase. Then the acyl chain in acylDHAP is replaced by a long chain fatty alcohol catalyzed by the enzyme alkyl-DHAP synthase [1]. In mammals it is clearly established that these two enzymes are located in peroxisomes [2, 3]. This is also emphasized by the discovery that ether lipids are deficient in human genetic diseases in which peroxisome biogenesis is disturbed [4]. The cDNAs encoding alkyl-DHAP synthase have been cloned from guinea pig [5], man [6] and Caenorhabditis elegans [7]. Both mammalian enzymes carry a peroxisomal targeting signal (PTS) type 2 in a N-terminal cleavable presequence, whereas the C. elegans homolog carries a PTS1 at its C-terminus. Cloning of the human cDNA enabled the resolution of an 1

To whom correspondence should be addressed at Department Biochemistry of Lipids, Centre for Biomembranes and Lipid Enzymology, Padualaan 8, 3584 CH Utrecht, The Netherlands. Fax: 13130-2537990. The nucleotide sequence reported in this paper has been submitted to the Genbank/EMBL Data Bank with Accession No. AJ010740. Abbreviations used: DHAP, dihydroxyacetonephosphate; EST, expressed sequence tag; PTS, peroxisomal targeting signal.

isolated human alkyl-DHAP synthase deficiency at the molecular level [8]. The reaction mechanism of alkyl-DHAP synthase has received considerable attention in the past [2, 9 –11]. The oxygen for the ether linkage to be formed is donated by the fatty alcohol, indicating a unique cleavage mechanism in which both oxygens from the ester bond leave with the fatty acid during the exchange reaction. Recent kinetic experiments using the recombinant guinea pig enzyme support a ping-pong rather than a sequential mechanism for this bisubstrate reaction [12]. Regardless of these studies, the reaction mechanism remains to be resolved at the molecular level. Cloning of alkyl-DHAP synthase cDNAs from other organisms would be extremely helpful to get insight into conserved residues and domains, especially if these sequences are derived from organisms that are evolutionary more distinct from mammals than C. elegans. By searching the Expressed Sequence Tags database (dbEST) we identified a clone encoding the C-terminal part of a possible alkyl-DHAP synthase homolog from the cellular slime mold Dictyostelium discoideum (Accession No. C22925). This organism contains considerable amounts of ether lipids [13] and is evolutionary more distinct from mammals than C. elegans [14, 15]. We used the DNA sequence of this clone as a starting point to obtain the complete open reading frame from this putative D. discoideum homolog of alkyl-DHAP synthase. By heterologous expression of this protein in an enzymatically active form we show that the cloned cDNA truly represents the alkyl-DHAP synthase homolog from this organism. MATERIALS AND METHODS Materials A D. discoideum cDNA library (in Lambda ZapII) was kindly donated by R. Firtel (San Diego, CA). D. discoideum genomic DNA was kindly provided by P. J. M. van Haastert, Groningen, The Netherlands. Oligonucleotides were manufactured by Eurogentec,

629

0006-291X/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.

Vol. 252, No. 3, 1998

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Seraing, Belgium. The pET-15b expression vector was obtained from Novagen (Madison, WI).

Methods PCR amplification and expression of cDNA. To easily obtain a large part of the open reading frame, a PCR was performed directly on the D. discoideum cDNA library essentially as described in [5]. A degenerate sense primer 1 was used directed against the conserved amino acid motif KWNGWG located in the N-terminal region of the protein (see [6, 7]). This primer sequence (TATGCTCGAGAT(A/ T)AA(A/G)TGGAA(C/T)GG(A/T)TGGGG) introduces a XhoI site (underlined). The antisense primer 2 was directed against the C-terminus based on the sequence of EST clone C22925 (CACGCTCAGCTTAGAGTTTTGGATATTTAAC) introducing a BlpI site (underlined). After completion of the PCR, the fragment obtained was cloned into the XhoI–BlpI site of the pET-15b expression vector using standard techniques [16]. This procedure allows direct expression of the protein fused to a N-terminal His-tag in E. coli. Expression in E. coli strain BL21(DE3) was performed essentially as described before [5], except that the cells were grown at room temperature instead of 37°C for 4 h after IPTG induction. Pilot experiments showed that this modification of the protocol resulted in higher alkyl-DHAP synthase activities per mg E. coli protein. Expression of the recombinant protein was monitored with SDS–PAGE according to Laemmli [17]. Cells were lysed in 10 mM Tris/HCl (pH 7.4), 1 mM EDTA, 0.2% Triton X-100, 0.1 mg/ml lysozyme and 10 U/ml DNAseI for half an hour on ice. Alkyl-DHAP synthase activity was measured as described previously [18]. To investigate the solubility of the recombinant protein, the lysate was centrifuged at 22,000g for 10 min and pellet and supernatant were both analyzed by SDS–PAGE. DNA sequencing was performed on an Applied Biosystems 310 Genetic Analyzer by Baseclear, Leiden, The Netherlands. Cloning of 59 end of D. discoideum DNA. The 59 end of the cDNA was amplified by PCR from the cDNA library in Lambda ZapII using antisense primer 3 (GTTTTGGTGGGTCTACATG) corresponding to nt 259 –277 (compare Fig. 2) as specific primer for alkyl-DHAP synthase. This primer was used in combination with either a T7 promotor primer or a T3 promotor primer, which both are able to anneal to the vector. Both combinations of primers yielded PCR products of about 400 bp which were cloned into the pGEM-T vector (Stratagene) using standard techniques [16]. In addition to this approach, inverse PCR was performed on D. discoideum genomic DNA. This technique allows specific amplification of DNA outside known boundaries [19, 20]. Genomic DNA is digested with a restriction enzyme that has no cleavage sites within the target sequence. These fragments are subsequently ligated under conditions that favor the formation of monomeric circles and can then be used as template for PCR amplification. From the restriction enzymes tested only the use of NdeI yielded a PCR product. PCR was performed on this template (10 ng of DNA per reaction) using antisense primer 3 and sense primer 4 (CTCATCATCATGGTGTTGG) corresponding to nt 1628 –1646 (compare Fig. 2). The obtained fragment was cloned into the pGEM-T vector.

RESULTS AND DISCUSSION PCR was performed on D. discoideum cDNA using a sense primer against a conserved N-terminally located amino acid motif and an antisense primer directed against the extreme C-terminus as described under Methods. A single DNA fragment of 1800 bp was obtained (results not shown). This fragment was cloned into a pET-15b expression vector and transformed into the E. coli expression strain BL21(DE3). Induction of these cells with IPTG resulted in the formation of a

FIG. 1. Expression of D. discoideum alkyl-DHAP synthase in E. coli as analyzed by SDS–PAGE. The gel was stained with Coomassie brilliant blue. Lane 1, molecular weight markers; lane 2, homogenate of E. coli cells transformed with an empty pET-15b vector. AlkylDHAP synthase activity measured in this homogenate is 0.00 nmol/ min/mg; lane 3, homogenate of E. coli cells transformed with the pET-15b-alkyl-DHAP synthase (D. discoideum) construct. AlkylDHAP synthase activity measured in this homogenate is 1.13 nmol/ min/mg; lane 4, pellet of lysed E. coli cells expressing D. discoideum alkyl-DHAP synthase; lane 5, supernatant of lysed E. coli cells expressing D. discoideum alkyl-DHAP synthase.

protein of 67 kDa (Fig. 1, lane 3), a size comparable with mammalian and C. elegans alkyl-DHAP synthase [5, 7]. Importantly, alkyl-DHAP synthase activity was clearly detectable in homogenates of E. coli cells expressing this protein whereas no activity was detected in cells transformed with an empty pET-15b vector (see legend Fig. 1). These results clearly prove that the cloned cDNA represents the alkyl-DHAP synthase homolog from D. discoideum. The recombinant protein appeared to be poorly soluble in E. coli. Only a small portion of the recombinant protein was recovered in the supernatant whereas most of the protein precipitated as insoluble inclusion bodies (compare lanes 4 and 5, Fig. 1). Several independent clones were sequenced. The obtained DNA sequence coded for a protein homologous to mammalian and C. elegans alkyl-DHAP synthase and included the sequence from EST clone C22925 (no differences with this sequence were observed). With this sequence information, we were able to directly amplify the 59-end of the cDNA from the library, using a primer directed toward alkylDHAP synthase and a primer directed against the vector (see Methods). Sequencing of the obtained PCR fragments confirmed the previously obtained sequence and included the codes for the conserved amino acid residue stretch KWNGWG as well as an upstream in frame ATG, representing a possible start codon. This ATG codon was preceded by a 62-nt AT-rich sequence.

630

Vol. 252, No. 3, 1998

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 2. Composite nucleotide sequence of Dictyostelium discoideum alkyl-DHAP synthase cDNA and the predicted amino acid sequence of the protein.

In addition inverse PCR was employed to amplify genomic DNA in order to confirm the 59- and the 39- end of the open reading frame. With the use of NdeI, a fragment of about 1400 bp was obtained including 900 bp of the 59-region and 500 bp of the 39-region. Nucleotide sequencing confirmed the previously obtained 59cDNA sequence and no intronic sequences were present in this part. Strikingly, directly upstream of the 62-nt leader sequence shown in Fig. 2, a poly-dT stretch (dT29) was found (data not shown), which is characteristic of a D. discoideum promotor region [21]. Therefore, we conclude that this particular upstream ATG codon represents the start codon. Sequencing of the 39-end present in the inverse PCR fragment con-

firmed the previously obtained sequences encoding the extreme C-terminus of the protein. In Fig. 2 the composite nucleotide sequence of D. discoideum alkyl-DHAP synthase cDNA and the predicted amino acid sequence are depicted. The protein exhibits a 33% amino acid identity compared to human alkyl-DHAP synthase, which shows that it is more distantly related to the human enzyme than the C. elegans homolog (52% amino acid identity [7]). Downstream of the stop codon, three putative polyadenylations signals (AATAAA) are present. The D. discoideum enzyme carries a variant of the PTS1 at its C-terminus (PKL). This sequence is present in EST clone C22925 and was confirmed independently

631

Vol. 252, No. 3, 1998

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

FIG. 3. Alignment of human, guinea pig, C. elegans and D. discoideum alkyl-DHAP synthase. The GenBank/EMBL Data Bank accession numbers are: Y09443 (human), Y08826 (guinea pig), AJ002686 (C. elegans) and AJ010740 (D. discoideum). The alignment was made with the ClustalW program via the Internet (http://www2.ebi.ac.uk/clustalw/). *, identical residues; :, very similar residues; ., less similar residues.

in this study by inverse PCR on genomic DNA. This uncommon variant of the PTS1 has been observed before in the yeast Candida tropicalis [22] and mutagenesis studies have indicated that this variant is

functional in Trypanosoma brucei [23]. Therefore, we assume that alkyl-DHAP synthase is targeted to the peroxisome in D. discoideum via the PTS1 import machinery.

632

Vol. 252, No. 3, 1998

BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS

Figure 3 shows an alignment of human, guinea pig, C. elegans and D. discoideum alkyl-DHAP synthase. Alkyl-DHAP synthase is a rare example of a peroxisomal protein that has switched in the use of the two well characterized peroxisomal targeting signals during evolution. The two mammalian enzymes carry PTS2 sequences in N-terminal cleavable presequences (RLRVLSGHL), whereas the C. elegans and D. discoideum enzymes carry both PTS1 motifs in C-terminal extensions (CKL and PKL, respectively). Previously, we have shown that a single case of human alkyl-DHAP synthase deficiency was due to a point mutation leading to an inactivating R419H amino acid substitution [8]. In line with this finding is the observation that this arginine (R348 in C. elegans and R352 in D. discoideum) is conserved (Fig. 3). The cloning of alkyl-DHAP synthase from Dictyostelium discoideum as reported in this paper increases our insight into conserved residues and domains. This should facilitate the identification of essential residues for catalysis and may aid in the molecular resolution of the catalytic mechanism. ACKNOWLEDGMENTS We thank Dr. R. A. Firtel (San Diego, CA), Dr. P. J. M. van Haastert (Groningen, The Netherlands), and Dr. H. Urushihara (Tsukuba, Japan) for supplying us with D. discoideum DNA samples. These investigations were carried out under the auspices of The Netherlands Foundation for Chemical Research (SON), with financial aid from The Netherlands Organization for Scientific Research (NWO).

REFERENCES 1. Hajra, A. K. (1995) Prog. Lipid Res. 34, 343–364. 2. Hajra, A. K., and Bishop, J. E. (1982) Ann. N.Y. Acad. Sci. 386, 170 –182.

3. Van den Bosch, H., Schutgens, R. B. H., Wanders, R. J. A., and Tager, J. M. (1992) Annu. Rev. Biochem. 61, 157–197. 4. Heymans, H. S. A., Schutgens, R. B., Tan, R., Van den Bosch, H., and Borst, P. (1983) Nature 306, 69 –70. 5. De Vet, E. C. J. M., Zomer, A. W. M., Lahaut, G. J. H. T. J., and van den Bosch, H. (1997) J. Biol. Chem. 272, 798 – 803. 6. De Vet, E. C. J. M., van den Broek, B. T. E., and van den Bosch, H. (1997) Biochim. Biophys. Acta 1346, 25–29. 7. De Vet, E. C. J. M., Prinsen, H. C. M. T., and van den Bosch, H. (1998) Biochem. Biophys. Res. Commun. 242, 277–281. 8. De Vet, E. C. J. M., Ijlst, L., Oostheim, W., Wanders, R. J. A., and van den Bosch, H. (1998) J. Biol. Chem. 273, 10296 –10301. 9. Brown, A. J., and Snyder, F. (1982) J. Biol. Chem. 257, 8835– 8839. 10. Brown, A. J., and Snyder, F. (1983) J. Biol. Chem. 258, 4184 – 4189. 11. Friedberg, S. J., Weintraub, S. T., Peterson, D., and Satsangi, N. (1987) Biochem. Biophys. Res. Commun. 145, 1177–1184. 12. De Vet, E. C. J. M., and van den Bosch, H. (1998) Biochim. Biophys. Acta, in press. 13. Weeks, G., and Herring, F. G. (1980) J. Lipid Res. 21, 681– 686. 14. Loomis, W. F., and Smith, D. W. (1995) Experientia 51, 1110 – 1115. 15. Baldauf, S. L., and Doolittle, W. F. (1997) Proc. Natl. Acad. Sci. USA 94, 12007–12012. 16. Sambrook, J., Fritsch, J., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 17. Laemmli, U. K. (1970) Nature 227, 680 – 685. 18. Zomer, A. W. M., de Weerd, W. F. C., Langeveld, J., and van den Bosch, H. (1993) Biochim. Biophys. Acta 1170, 189 –193. 19. Ochman, H., Gerber, A. S., and Hartl, D. L. (1988) Genetics 120, 621– 623. 20. Triglia, T., Peterson, M. J., and Kemp, D. J. (1988) Nucleic Acids Res. 16, 81– 86. 21. Kimmel, A. R., and Firtel, R. A. (1983) Nucleic Acids Res. 11, 541–552. 22. Tan, H., Okasaki, K., Kubota, I., Kamiryo, T., and Utiyama, H. (1990) Eur. J. Biochem. 190, 107–112. 23. Sommer, J. M., Cheng, Q.-L., Keller, G.-A., and Wang, C. C. (1993) Mol. Biol. Cell 3, 749 –759.

633