- Email: [email protected]
Nucleotide sequence of mouse Sry gene is different between Y chromosomes originating from Mus musculus musculus and Mus musculus domesticus
236
BRIEF
REPORTS
Human Services under Contract NOl-CO-74102 with Program Resources, Inc DynCorp. The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government. REFERENCES 1.
Chaum, E., Ellsworth, R. M., Abramson, D. H., Haik, B. G., Kitchin, F. D. and Chaganti, R. S. K. (1984). Cytogenetic analysis of retinoblastoma: Evidence for multifocal origin and in vivo amplification. Cytogenet. Cell Genet. 38: 82-91.
2. Dean, M., and Gerrard,
B. (1991). conformation
of single-stranded
Helpful hints polymorphisms.
for the detection Biotechniques
10:332-333. 3. Dean,
M., White, M. B., Amos, J., Gerrard, B., Stewart, C., K.-T., and Leppert, M. (1990). Multiple mutations in conserved residues are found in mildly affected cystic fipatients. Cell 61: 863-870.
Khaw, highly brosis
4. Hernanz-Schulman,
M., Teele, R. L., Perez-Atayde, L., Levine, J., Black, P., and Kuligowska, E. (1986). cystosis in cystic fibrosis. Radiology 158: 629-631.
A., Zollars, Pancreatic
5. Iannuzzi,
M. C., Stern, R. C., Collins, F. S., Tom Hon, C., Hidaka, N., Strong, T., Decker, L., Drumm, M. L., White, M. B., Gerrard, B., and Dean, M. (1991). Two frameshift mutations in the cystic fibrosis gene. Am. J. Hum. Genet. 48: 227-231.
6. Orita,
7.
M., Suzuki, Y., Sekig, T., and Hayaski, K. (1989). Rapid and sensitive deletion of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5: 874879. White, M., Leppert, M., Nielsen, D., Zielenski, J., Gerrard, B., Stewart, C., and Dean, M. (1991). A de nouo cystic fibrosis mutation: CGA (Arg) to TGA (stop) at codon 851 of the CFTR gene. 11:778-779. Genomics
8. Worton,
R. G., Duff, C., Sylvester, J. E., Schmickel, R. D., and Willard, H. F. (1991). Duchenne muscular dystrophy involving translocation of the dmd gene next to ribosomal RNA genes. Science 224: 1447-1449.
sex determination. SrylSR Y is a gene located in the sex-determining region of the mouse or human Y chromosome and shares many of the properties expected for the Tdy/TDF gene (4,5,10). The open reading frame in this sequence is predicted to encode a sequence with an 80-residue stretch that is characteristic of a DNA-binding motif known as the HMG box (10). Based on Y-chromosomal RFLPs, Y chromosomes of Mus musculus subspecies and laboratory inbred mice are classified into two types, Mus musculus musculus type and Mus muscuthat, unlike M. m. lus domesticus type (8). It has been reported musculus type Y chromosomes, M. m. domesticus type Y chroin inducing testis differentiamosomes appear to be inactive tion on genetic background of C57BL/6 mouse strain (2, 7),
and it has been postulated that the Tdy gene from M. m. domesticus cannot properly interact with autosomal genes from the C57BL/6 mouse (3). Therefore, it is predicted that there differences between the products of the are some functional Sry gene of M. m. musculus and M. m. domesticus. mouse, Genomic DNAs from C57BL/6N mouse and SJL/J which respectively have M. m. musculus and M. m. domesticus type Y chromosomes, were amplified by PCR using primers flanking the HMG box of the Sry gene. The amplified fragment was directly sequenced by the dideoxy chain terminating method (6). The nucleotide sequence of C57BL/6N mouse was shown to be identical with the published sequence of the M. m. musculus type Y chromosome (4). Comparison of the sequences obtained from the C57BL/6N mouse and SJL/J mouse revealed a single base substitution of a C-T transition at nucleotide 285 of the Sty gene (Fig. 1). This nucleotide substitution results in the substitution of isoleusine for threonine at amino acid 71 within the HMG box of putative Sry gene products. This residue is conserved among the human and rabbit SRY genes and mouse Sry-related genes, but not in the Sry gene (4,lO). The HMG box of the human SRY gene is known to be invariant
at residues
in normal
conserved
C57BLI6N (M. m. musculustype)
Nucleotide Sequence of Mouse Sry Gene Is Different between Y Chromosomes Originating from Mus musculus musculus and Mus musculus domesticus
26, 1991;
revised
December
3, 1991
His
C A C A
3
lies
Testis-determining on Y chromosome
Sequence EMBL/GenBank
data
from Data
gene (2%~ in mice and is responsible
or TDF for
in humans) initiating male
this article have been deposited with Libraries under Accession No. X60687.
GENOMICS 13, 236-237 (1992) 08W7543/92 $3.00 Copyright 0 1992 by Academic Press, All rights of reproduction in any form
Inc.
reserved
amino
acid
substitution
SJL/J (M. m. domeshs
f
lmamichi Institute for Animal Reproduction, Dejima-mura, lbaraki 300-O 1; and *Department of Animal Pathology, Institute of Medical Science, University of Tokyo, Minato-ku, Tokyo 108, Japan August
and
the Sry,ISRY and Sry-related
type)
5
Tetsuo Kunieda and Yutaka Toyoda*
Received
males,
among
the
A A G A c’ c c T A C A C A
Lys
Thr
Leu
His
3'
FIG. 1. Part of the nucleotide sequence and deduced amino acid sequence of the Sry gene, obtained by PCR amplification and the direct sequencing method. Amplification and sequencing were performed using the Sry-specific primers: 5’ TCTTAAACTCTGAAGAAGAGAC 3’ and 5’ GTCTTGCCTGTATGTGATGG 3’. The nucleotide difference between Al. m. musculus type Y chromosome and M. m. domesticus type Y chromosome is indicated by arrows.
BRIEF
genes have been reported in human XY females (1). Although the position of the amino acid substitution in the Sry gene is different from that of the SRY gene, the substitution could result in some functional differences of the Sry gene. The nucleotide substitution causes disruption of the Sau3AI site (GATC) present in the Sry gene of the C57BL/6N mouse. Digestion of the Sry fragments amplified from 10 inbred mouse strains with Sau3AI revealed that the Sau3AI site is absent in AKR/J, SJL/J, SWR/J, RFM/J, and NOD/shi strains, while it is present in C57BL/6N, C3H/HeN, BALB/ CA, DBA/N, and NZB strains. Based on Y-chromosomal RFLPs, the five strains not having the Sau3AI site are known to possess the M. m. domesticus-type Y chromosome, while the remaining strains having the SauSAI site possess the M. m. musculus-type
Y chromosome
((8);
our unpublished
data),
Although fying
from
detailed
the relation
the
different
functional
between
the
origins.
analysis functional
is necessary difference
for clariof the
Tdy
and the nucleotide sequence difference of the Sry gene, the present findings reveal that the products of the Sry gene are different between the two types of mouse Y chromosomes. It has been suggested that later acting of the Tdy allele of the M. m. domesticus-type Y chromosome is responsible for the aberrant testicular differentiation, and it has been predicted that
this
may
be due to the difference
in expression
of the Sry
gene or structural difference of the Sry gene product (9). The latter prediction could be in agreement with the present findings. ACKNOWLEDGMENTS We thank Drs. H. Katoh and S. Wakana for providing samples. This work was supported by the Bio-oriented Research Advancement Institution (BRAIN) of Japan.
mouse DNA Technology
REFERENCES 1.
2.
3.
4.
5.
6.
7.
Nagamine,
C. M., Taketo, XY sex
genetics of tda-I
T., and Koo,
G. (1987).
Studies
on the
reversal in the mouse. Differentiation
33: 223-231. 8. 9.
10.
Nishioka, Y. (1987). Y-chromosomal DNA polymorphism in mouse inbred strains. Genet. Res. 50: 69-72. Palmer, S. J., and Bourgoyne, P. S. (1991). The Mus musculus domesticus Tdy allele acts later than the Mus musculus musculus Tdy allele: A basis for XY sex-reversal in C57BL/6-YPoS mice. Development 113: 709-714. Sinclair, A. H., Berta, P., Palmer, M. S., Hawkins, J. R., Griffiths, B. L., Smith, M. J., Foster, J. W., Frischauf, A-M., LovellBadge, R., and Goodfellow, P. N. (1990). A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346: 240-244.
and
at least the Y chromosomes of AKR/J and SJL/J are known to cause aberrant testicular differentiation on the C57BL/6 genetic background (7). Therefore, the present findings indicate that the difference in nucleotide 285 corresponds to the type of Y chromosome
237
REPORTS
Berta, P., Hawkins, J. R., Sinclair, A. H., Taylor, A., Griffiths, B. L., Goodfellow, P. N., and Fellous, M. (1990). Genetic evidence equating SRY and the testis-determining factor. Nature 348: 448-450. Either, E. M., Washburn, L. L., Whitney, J. B., III, and Morrow, K. E. (1982). Musposchiavinus Y chromosome in the C57BL/6J murine genome causes sex reversal. Science 217: 535-537. Either, E. M., and Washburn, L. L. (1986). Genetic control of primary sex determination in mice. Annu. Rev. Genet. 20: 327360. Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A., Miinsterberg, A., Vivian, N., Goodfellow, P., and Lovell-Badge, R. (1990). A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346: 245-250. Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P., and LovellBadge, R. (1991). Male development of chromosomally female mice transgenic for Sry. Nature 351: 117-121. Kusukawa, N., Uemori, T., Asada, K., and Kate, I. (1990). Rapid and reliable protocol for direct sequencing of material amplified by the polymerase chain reaction. BioTechniques 9: 66-72.
Solid-Phase Minisequencing Test Reveals Asp187 + Asn (Gsss --) A) Mutation of Gelsolin in All Affected Individuals with Finnish Type of Familial Amyloidosis Tiina Paunio,*+’ Sari Kiuru,* Vera Hongell,S Eila Mustonen,§ Ann-Christine Syv;inen,t Marina Bengtstr6m,l’ Jorma Palo,* and Leena Peltonent *Department of Neurology, University of Helsinki, Haartmaninkatu 2, 00280 Helsinki; tLaboratory of Molecular Genetics, National Public Health Institute, Mannerheimintie 166, 00300 Helsinki; *Department of Ophthalmology, Kymenlaakso Central Hospital, 48210 Kotka; SDepartment of Ophthalmology, University of Oulu, Kajaanintie 50 90220 0th; and liOrion Corp., Orion Pharmaceutics, Biotechnology, Valimotie 7, 00380 Helsinki, Finland Received
August
29, 1991
Familial amyloidosis of the Finnish type (FAF)2 is a systemic hereditary amyloidosis with cornea1 lattice dystrophy and progressive cranial and peripheral neuropathy. Usually the first clinical signs of the disorder appear in the third decade of life (9). The amyloid fibrils in FAF consist of peptides of gelsolin, an actin-modulating protein (7). A single gene on chromosome 9 encodes both the secreted and the cytoplasmic forms of gelsolin, which are generated through alternative transcription and splicing mechanisms (5). In the accumulating gelsolin fragments of FAF tissues, asparagine replaces aspartic acid at position 187 (numbering based on the sequence of the secretory form) (1). A corresponding G-A transition at nucleotide position 654, the first nucleotide of codon 187, has been demonstrated in several FAF individuals from two families (6,8). We have recently shown the cosegregation of this mutation in three extended pedigrees (3). 1 To whom correspondence should Public Health Institute, Mannerheimintie land. ’ Abbreviations used: FAF, familial nucleotide.
All
be addressed at the National 166, 00300 Helsinki, Finamyloidosis,
Finnish
GENOMICS
13, 237-239
Copyright 0 1992 rights of reproduction
type;
nt,
(19%)
0888-7543/92 $3.00 by Academic Press, Inc. in any form reserved.
BRIEF
REPORTS
Human Services under Contract NOl-CO-74102 with Program Resources, Inc DynCorp. The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government. REFERENCES 1.
Chaum, E., Ellsworth, R. M., Abramson, D. H., Haik, B. G., Kitchin, F. D. and Chaganti, R. S. K. (1984). Cytogenetic analysis of retinoblastoma: Evidence for multifocal origin and in vivo amplification. Cytogenet. Cell Genet. 38: 82-91.
2. Dean, M., and Gerrard,
B. (1991). conformation
of single-stranded
Helpful hints polymorphisms.
for the detection Biotechniques
10:332-333. 3. Dean,
M., White, M. B., Amos, J., Gerrard, B., Stewart, C., K.-T., and Leppert, M. (1990). Multiple mutations in conserved residues are found in mildly affected cystic fipatients. Cell 61: 863-870.
Khaw, highly brosis
4. Hernanz-Schulman,
M., Teele, R. L., Perez-Atayde, L., Levine, J., Black, P., and Kuligowska, E. (1986). cystosis in cystic fibrosis. Radiology 158: 629-631.
A., Zollars, Pancreatic
5. Iannuzzi,
M. C., Stern, R. C., Collins, F. S., Tom Hon, C., Hidaka, N., Strong, T., Decker, L., Drumm, M. L., White, M. B., Gerrard, B., and Dean, M. (1991). Two frameshift mutations in the cystic fibrosis gene. Am. J. Hum. Genet. 48: 227-231.
6. Orita,
7.
M., Suzuki, Y., Sekig, T., and Hayaski, K. (1989). Rapid and sensitive deletion of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5: 874879. White, M., Leppert, M., Nielsen, D., Zielenski, J., Gerrard, B., Stewart, C., and Dean, M. (1991). A de nouo cystic fibrosis mutation: CGA (Arg) to TGA (stop) at codon 851 of the CFTR gene. 11:778-779. Genomics
8. Worton,
R. G., Duff, C., Sylvester, J. E., Schmickel, R. D., and Willard, H. F. (1991). Duchenne muscular dystrophy involving translocation of the dmd gene next to ribosomal RNA genes. Science 224: 1447-1449.
sex determination. SrylSR Y is a gene located in the sex-determining region of the mouse or human Y chromosome and shares many of the properties expected for the Tdy/TDF gene (4,5,10). The open reading frame in this sequence is predicted to encode a sequence with an 80-residue stretch that is characteristic of a DNA-binding motif known as the HMG box (10). Based on Y-chromosomal RFLPs, Y chromosomes of Mus musculus subspecies and laboratory inbred mice are classified into two types, Mus musculus musculus type and Mus muscuthat, unlike M. m. lus domesticus type (8). It has been reported musculus type Y chromosomes, M. m. domesticus type Y chroin inducing testis differentiamosomes appear to be inactive tion on genetic background of C57BL/6 mouse strain (2, 7),
and it has been postulated that the Tdy gene from M. m. domesticus cannot properly interact with autosomal genes from the C57BL/6 mouse (3). Therefore, it is predicted that there differences between the products of the are some functional Sry gene of M. m. musculus and M. m. domesticus. mouse, Genomic DNAs from C57BL/6N mouse and SJL/J which respectively have M. m. musculus and M. m. domesticus type Y chromosomes, were amplified by PCR using primers flanking the HMG box of the Sry gene. The amplified fragment was directly sequenced by the dideoxy chain terminating method (6). The nucleotide sequence of C57BL/6N mouse was shown to be identical with the published sequence of the M. m. musculus type Y chromosome (4). Comparison of the sequences obtained from the C57BL/6N mouse and SJL/J mouse revealed a single base substitution of a C-T transition at nucleotide 285 of the Sty gene (Fig. 1). This nucleotide substitution results in the substitution of isoleusine for threonine at amino acid 71 within the HMG box of putative Sry gene products. This residue is conserved among the human and rabbit SRY genes and mouse Sry-related genes, but not in the Sry gene (4,lO). The HMG box of the human SRY gene is known to be invariant
at residues
in normal
conserved
C57BLI6N (M. m. musculustype)
Nucleotide Sequence of Mouse Sry Gene Is Different between Y Chromosomes Originating from Mus musculus musculus and Mus musculus domesticus
26, 1991;
revised
December
3, 1991
His
C A C A
3
lies
Testis-determining on Y chromosome
Sequence EMBL/GenBank
data
from Data
gene (2%~ in mice and is responsible
or TDF for
in humans) initiating male
this article have been deposited with Libraries under Accession No. X60687.
GENOMICS 13, 236-237 (1992) 08W7543/92 $3.00 Copyright 0 1992 by Academic Press, All rights of reproduction in any form
Inc.
reserved
amino
acid
substitution
SJL/J (M. m. domeshs
f
lmamichi Institute for Animal Reproduction, Dejima-mura, lbaraki 300-O 1; and *Department of Animal Pathology, Institute of Medical Science, University of Tokyo, Minato-ku, Tokyo 108, Japan August
and
the Sry,ISRY and Sry-related
type)
5
Tetsuo Kunieda and Yutaka Toyoda*
Received
males,
among
the
A A G A c’ c c T A C A C A
Lys
Thr
Leu
His
3'
FIG. 1. Part of the nucleotide sequence and deduced amino acid sequence of the Sry gene, obtained by PCR amplification and the direct sequencing method. Amplification and sequencing were performed using the Sry-specific primers: 5’ TCTTAAACTCTGAAGAAGAGAC 3’ and 5’ GTCTTGCCTGTATGTGATGG 3’. The nucleotide difference between Al. m. musculus type Y chromosome and M. m. domesticus type Y chromosome is indicated by arrows.
BRIEF
genes have been reported in human XY females (1). Although the position of the amino acid substitution in the Sry gene is different from that of the SRY gene, the substitution could result in some functional differences of the Sry gene. The nucleotide substitution causes disruption of the Sau3AI site (GATC) present in the Sry gene of the C57BL/6N mouse. Digestion of the Sry fragments amplified from 10 inbred mouse strains with Sau3AI revealed that the Sau3AI site is absent in AKR/J, SJL/J, SWR/J, RFM/J, and NOD/shi strains, while it is present in C57BL/6N, C3H/HeN, BALB/ CA, DBA/N, and NZB strains. Based on Y-chromosomal RFLPs, the five strains not having the Sau3AI site are known to possess the M. m. domesticus-type Y chromosome, while the remaining strains having the SauSAI site possess the M. m. musculus-type
Y chromosome
((8);
our unpublished
data),
Although fying
from
detailed
the relation
the
different
functional
between
the
origins.
analysis functional
is necessary difference
for clariof the
Tdy
and the nucleotide sequence difference of the Sry gene, the present findings reveal that the products of the Sry gene are different between the two types of mouse Y chromosomes. It has been suggested that later acting of the Tdy allele of the M. m. domesticus-type Y chromosome is responsible for the aberrant testicular differentiation, and it has been predicted that
this
may
be due to the difference
in expression
of the Sry
gene or structural difference of the Sry gene product (9). The latter prediction could be in agreement with the present findings. ACKNOWLEDGMENTS We thank Drs. H. Katoh and S. Wakana for providing samples. This work was supported by the Bio-oriented Research Advancement Institution (BRAIN) of Japan.
mouse DNA Technology
REFERENCES 1.
2.
3.
4.
5.
6.
7.
Nagamine,
C. M., Taketo, XY sex
genetics of tda-I
T., and Koo,
G. (1987).
Studies
on the
reversal in the mouse. Differentiation
33: 223-231. 8. 9.
10.
Nishioka, Y. (1987). Y-chromosomal DNA polymorphism in mouse inbred strains. Genet. Res. 50: 69-72. Palmer, S. J., and Bourgoyne, P. S. (1991). The Mus musculus domesticus Tdy allele acts later than the Mus musculus musculus Tdy allele: A basis for XY sex-reversal in C57BL/6-YPoS mice. Development 113: 709-714. Sinclair, A. H., Berta, P., Palmer, M. S., Hawkins, J. R., Griffiths, B. L., Smith, M. J., Foster, J. W., Frischauf, A-M., LovellBadge, R., and Goodfellow, P. N. (1990). A gene from the human sex-determining region encodes a protein with homology to a conserved DNA-binding motif. Nature 346: 240-244.
and
at least the Y chromosomes of AKR/J and SJL/J are known to cause aberrant testicular differentiation on the C57BL/6 genetic background (7). Therefore, the present findings indicate that the difference in nucleotide 285 corresponds to the type of Y chromosome
237
REPORTS
Berta, P., Hawkins, J. R., Sinclair, A. H., Taylor, A., Griffiths, B. L., Goodfellow, P. N., and Fellous, M. (1990). Genetic evidence equating SRY and the testis-determining factor. Nature 348: 448-450. Either, E. M., Washburn, L. L., Whitney, J. B., III, and Morrow, K. E. (1982). Musposchiavinus Y chromosome in the C57BL/6J murine genome causes sex reversal. Science 217: 535-537. Either, E. M., and Washburn, L. L. (1986). Genetic control of primary sex determination in mice. Annu. Rev. Genet. 20: 327360. Gubbay, J., Collignon, J., Koopman, P., Capel, B., Economou, A., Miinsterberg, A., Vivian, N., Goodfellow, P., and Lovell-Badge, R. (1990). A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature 346: 245-250. Koopman, P., Gubbay, J., Vivian, N., Goodfellow, P., and LovellBadge, R. (1991). Male development of chromosomally female mice transgenic for Sry. Nature 351: 117-121. Kusukawa, N., Uemori, T., Asada, K., and Kate, I. (1990). Rapid and reliable protocol for direct sequencing of material amplified by the polymerase chain reaction. BioTechniques 9: 66-72.
Solid-Phase Minisequencing Test Reveals Asp187 + Asn (Gsss --) A) Mutation of Gelsolin in All Affected Individuals with Finnish Type of Familial Amyloidosis Tiina Paunio,*+’ Sari Kiuru,* Vera Hongell,S Eila Mustonen,§ Ann-Christine Syv;inen,t Marina Bengtstr6m,l’ Jorma Palo,* and Leena Peltonent *Department of Neurology, University of Helsinki, Haartmaninkatu 2, 00280 Helsinki; tLaboratory of Molecular Genetics, National Public Health Institute, Mannerheimintie 166, 00300 Helsinki; *Department of Ophthalmology, Kymenlaakso Central Hospital, 48210 Kotka; SDepartment of Ophthalmology, University of Oulu, Kajaanintie 50 90220 0th; and liOrion Corp., Orion Pharmaceutics, Biotechnology, Valimotie 7, 00380 Helsinki, Finland Received
August
29, 1991
Familial amyloidosis of the Finnish type (FAF)2 is a systemic hereditary amyloidosis with cornea1 lattice dystrophy and progressive cranial and peripheral neuropathy. Usually the first clinical signs of the disorder appear in the third decade of life (9). The amyloid fibrils in FAF consist of peptides of gelsolin, an actin-modulating protein (7). A single gene on chromosome 9 encodes both the secreted and the cytoplasmic forms of gelsolin, which are generated through alternative transcription and splicing mechanisms (5). In the accumulating gelsolin fragments of FAF tissues, asparagine replaces aspartic acid at position 187 (numbering based on the sequence of the secretory form) (1). A corresponding G-A transition at nucleotide position 654, the first nucleotide of codon 187, has been demonstrated in several FAF individuals from two families (6,8). We have recently shown the cosegregation of this mutation in three extended pedigrees (3). 1 To whom correspondence should Public Health Institute, Mannerheimintie land. ’ Abbreviations used: FAF, familial nucleotide.
All
be addressed at the National 166, 00300 Helsinki, Finamyloidosis,
Finnish
GENOMICS
13, 237-239
Copyright 0 1992 rights of reproduction
type;
nt,
(19%)
0888-7543/92 $3.00 by Academic Press, Inc. in any form reserved.