- Email: [email protected]
Nucleotide sequence of the rDNA spacer 1 enables identification of isolates of Colletotrichum as C. acutatum
186
Mycol. Res. 98 (2): 1 8 6 1 8 8 (1994) Printed in Great Britain
Nucleotide sequence of the rDNA spacer I enables identification of isolates of Colletotrichum as C. actrtattrm
S. SREENIVASAPRASAD1, P. R. MILLS'rZY A N D AVERIL E. BROWNlr2
'Biofechnology Cenfre for Animal and Plant Health, The Queen's University of Belfast Plant Pathology Research Division, Department of Agriculture for Northern Ireland, Newforge Lane, Belfast BT9 5PX, U.K.
Nucleotide sequence of the rDNA internally transcribed spacer (ITS) 1 of twelve isolates of Colletotrichum, originally identified as either C. fructigenum, C. gloeosporioides or C. musae, was determined. Comparison of the sequence data with that from previously characterized isolates of Collefotrichum species revealed 97-100% homology with C. acutafum and only 79-81 % homology with C. gloeosporioides and C. musae. We conclude that the isolates belong to C. acufafum.The value of sequence data from ITS 1 in species assignment is demonstrated.
Collefofrichum comprises a diverse collection of phytopathogenic and saprotrophic species. Despite attempts to develop a species concept by various workers (e.g. von Arx, 1970; Baxter, Van Der Westhuizen & Eicker, 1985; Sutton, 1992), the phenotypic plasticity of several of these species has made the correct identification of members of the Collefofrichum genus highly ambiguous. Moreover, in certain instances, nonavailability of living type cultures makes comparison to authenticated reference cultures difficult. We are evaluating the potential of various molecular methods for determining the phylogenetic relationships and species diagnosis in Collefotrichum (Mills, Sreenivasaprasad &Brown, 1992; Sreenivasaprasad, Brown &Mills, 1992,1993). We report here the use of nucleotide sequence of the rDNA internally transcribed spacer (ITS) I for accurate identification of some atypical isolates of Colletotrichum.
MATERIALS A N D METHODS Original identification, host and source of the isolates of Collefofrichum species examined are given in Table I. Fungal mycelium was produced in glucose casamino acid liquid medium and the DNA extracted from freeze-dried mycelial powder as described in Sreenivasaprasad ef al. (1992). For PCR amplification and nucleotide sequence determination of the ITS 1 region, primers ITS 1 and ITS 2 (White ef al., 1990) and the solid phase sequencing methodology described in Sreenivasaprasad ef al. (1992) were used. ITS I nucleotide sequences of previously characterized C . acufafum Simmonds isolates 397 and NI 90, C. gloeosporioides (Penz.) Penz. & Sacc. isolate 23 1(Sreenivasaprasad e f al., 1992) and a C. musae (Berk. & M. A. Curtis) Arx isolate (Mills, Hodson & Brown, 1992) have been used for reference purposes. The sequence data were
* Corresponding author.
aligned and analysed using the CLUSTAL V package (Higgins, Bleasby & Fuchs, 1992).
RESULTS A N D DISCUSSION Nucleotide sequence of the ITS 1 region (180-181 bases) of the 12 isolates of Colletofrichum species examined showed a very high level of homology (97-100%) to C. acufafum isolates 397 and NI 90 (Fig. I and Table I). Isolates 495/17729,535/90.407,546,547/90.410,549,550 and 179 from Lupinus sp., 602191.326 from Phormium sp. and R I and R3 from Hevea brasiliensis (Wild ex A. Juss.) Muel1.-Arg., all originally identified as C . gloeosporioides, showed 98-100% homology to the C . acufafum isolates but had only 80-81% homology to C. gloeosporioides isolate 231 (Fig. 1and Table I). Similarly, isolate 58 supplied as C . m w a e revealed a low level of homology (79%) to the named species but showed 100% homology to C. acufafum isolate 397. C . frucfigenum has not been described as an accepted taxon in any of the recent reviews on Collefofrichum taxonomy and the isolate 4885 showed 97% homology to C . acufafum isolate 397. The nucleotide sequence of rRNA genes and spacer regions has been used to determine phylogenetic relationships in a broad range of organisms (Olsen e f al., 1986). In fungi such as Phytophfhora (Lee & Taylor, 1992) and Laccaria (Gardes et al., 1991), the degree of homology in the ITS I sequence has been found to be useful in delimiting some of the species. We have established the inter-specific homology levels (61-92%) in the ITS I sequence of some Collefofrichum species including C. musae (Mills ef al., 1992). We have also determined the extent of intra-specific variation in C . acutafum (0-6 %) as well as the divergence between C. gloeosporioides and C. acutafum (15-17%) based on ITS I sequence (Sreenivasaprasad e f al., 1992). The 12 Collefofrichum isolates, originally identified as
S. Sreenivasaprasad, P. R. Mills and Averil E. Brown
187
Table 1. Original identification, host and source of the isolates of Colletotrichum species examined and their ITS 1 sequence homology levels to previously characterized isolates Homology (%) to
Isolate
Original identification
Host
Homology (%) to named species
4951177298 (IMI 351259)
C. gloeosporioides
Lupinw sp.
80
535/90.407a (IMI 351250)
C . gloeosporioides
Lupinw sp.
80
546" (IMI 351260)
C. gl~eos~orioides
Lupinw sp.
80
547/90.410a (IMI 351249)
C. gloeosporioides
Lupinus sp.
80
549" (IMI 35 1251)
C. gloeosporioides
Lupinw sp.
80
550a (IMI 351244)
C. gl~eos~orioides
Lupinw sp.
602/91.3268 (IMI 351246)
C. gloeosporioides
Phormium sp.
81
Rlb
C . gioeosporioides
Heuea brasiliensis
81
100
R3'
C . gloeosporioides
Hevea brasiliensis
81
100
58" (IMI 165753)
C. musae
M w a nana
79
100
C. acutatumr
179"
C . gloeosporioides
Lupinw mutabilis
80
99
4885'
C. fructigenum
Acaena smithii
-
97
" MAFF CSL, Harpenden, U.K.
' Rubber Research Institute, Indonesia. ' University of Perideniya, Sri Lanka. Long Ashton Research Station, Bristol, U.K. DSIR Culture Collection, Auckland, New Zealand. ' Homology of all isolates except 602/91.326 relates to C. acutatum isolate 397; homology of 602/91.326 relates to C. acutatum isolate NI 90. Reference isolates: 397 - Fragaria x ananassa, U.S.A., Institute of Food and Agricultural Sciences, University of Florida; N1 90 - Fragaria x ananassa, U.K., isolated from anthracnosed fruits.
100 397 58
110
120
130
140
150
160
170
180
CGGCCCCCACCACGGGGACGGGGCGCCCGCCGGA'AATCT'CTTCTGAGTGGCACAAGCAAATMTTA
549
-------------------------------------*--------------------------*---------------------------------------------------------------.--------------------------*---------------------------
4885
-------------------------------------r-----------~--------------*---------------------------
NI90 -------ZGT-------G---A---------------.--------------------------4--------------------------602/91.326 -------'-T-------G---A-----------------*--------------------------*--------------------------231 -**--G--T--GG-C--GTC--*--------------T-----------GA--TA-------*-T-----------T-------------
CM
C-~*--G--C---G-*-CGT~--*--------------T-----------GA--TG-------*-T-----------T------------- C-
Fig. 1. Nucleotide sequence of the rDNA internally transcribed spacer 1 of the 12 isolates of Coiietotrichum species aligned with previously characterized isolates of C. acutatum (397 and NI 90), C. gloeosporioides (231) and C . musae (CM). ~solates and R3 have ITS 1 sequence identical to isolate 58; isolates 535/90.407, 546, 547/90.410, 550, 495/17729 and 179 have ITS 1 sequence identical to 549. (ITS 1 nucleotide sequence of C. acutatum isolates 397 and NI 90 and C. g l ~ e o s ~ o r i o i d eisolate s 231 has been reproduced from Sreeni~asa~rasad et al., 1992.)
RI
belonging to 3 different species, showed 97-100% homology (0-3 % variation) to the reference C. acritafum isolates and fitted well within the range of variation ( 0 4 % )established in this species. This clearly identifies these isolates as belonging to the species C. acutatum. The low level of homology ( 7 9 4 1 % ) shown by these isolates to isolates of their originally named species is indicative of inaccurate identifi-
cation arising from the use of characters such as conidial shape and size and colony morphology which are highly variable (Sutton, 1992). It is probable that the ITS I sequence will prove to be a suitable target for designing a C. acutatum -specific PCRprimeriprobe which could aid in rapid and reliable identification of this species.
Isolates of Colletofrichum
188
We thank Drs R. Cook and I. Barker (MAFF CSL., Har~enden) Mills, P. R.. Hodson, A. & Brown, A. E. (1992). Molecular differentiation of gloeosporioides isolates infecting tropical h i t s . In Colletoand D~J. A, ~ ~( Li ~ ~ l ~~~~~~~~h ~ ~ ~h ~ station, t ~~ ~ i ~for ~ t ~ lColletotrichum ) trichum - Biology, Pathology and Control (ed. J. A. Bailey & M. J. Jeger),pp. providing the "ltures. This work was by the 269-288, CAB fntemational Mycological Institute: Kew, ",K, Natural Resources Institute, Chatham and MAFF. Mills, P. R., Sreenivasaprasad, S. & Brown, A. E. (1992). Detection and ~
-
-
-
~
1
REFERENCES Arx, J. A. von. (1970). A revision of the fungi classified as Gloeosporium. Bibliotheca Mycologica 24, 1-203. Baxter, A. P., Van Der Westhuizen, G. C. A. & Eicker, A. (1985). A review of literature on the taxonomy, morphology and biology of the fungal genus Colletotrichum. Phytophylactica 17, 15-18. Gardes, M., White, T. J., Fortin, J. A., Bruns, T. D. & Taylor, J. W. (1991). Identification of indigenous and introduced symbiotic fungi in ectomycorrhizae by amplification of nuclear and mitochondria1 ribosomal DNA. Canadian journal of Botany 69, 180-190. Higgins, D. G., Bleasby, A. J. & Fuchs, R. (1992). CLUSTAL V: improved software for multiple sequence alignment. Computer Applications for Biosciences 8, 189-191. Lee, S. B. & Taylor, J. W. (1992). Phylogeny of five fungus-like protoctistan Phytophthora species, inferred from the internal transcribed spacers of ribosomal DNA. Molecular Biology and Evolution 9, 636-653.
(Accepted 27 A u g w t 1993)
differentiation of Colletotrichum gloeospor~oidesisolates using PCR. FEMS Microbiology Letters 98, 137-144. Olsen, G. J., Lane. D. J.. Giovannoni. S. J. & Pace, N. R. (1986). Microbial ecology and evolution: a ribosomal RNA approach. Annual Review of Microbiology 40, 337-365. S., Brown, A. E. & Mills, P. R. (1992). DNA sequence Sreeni~asa~rasad, variation and interrelationships among Colletotrichum species causing strawberry anthracnose. Physiological and Molecular Plant Pathology 41, 265-281. Sreeni~asa~rasad, S., Brown, A. E. & Mills, P. R. (1993). Coffee berry disease pathogen in Africa: genetic structure and relationship to the group species Colletotrichum gloeosporioides. Mycological Research 97,995-1000. Sutton, 8.C. (1992). The genus Glomerella and its anamorph Colletotrichum. In Colletotrichum - Biology, Pathology and Control (ed. J . A. Bailey & M. J. Jeger), pp. 1-26. CAB International Mycological Institute: Kew, U.K. White, T. J., Bruns, T., Lee, S. B. & Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols, A Guide to Methods and Applications (ed. M. A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White), pp. 315-322. Academic Press: San Diego, U.S.A.
Mycol. Res. 98 (2): 1 8 6 1 8 8 (1994) Printed in Great Britain
Nucleotide sequence of the rDNA spacer I enables identification of isolates of Colletotrichum as C. actrtattrm
S. SREENIVASAPRASAD1, P. R. MILLS'rZY A N D AVERIL E. BROWNlr2
'Biofechnology Cenfre for Animal and Plant Health, The Queen's University of Belfast Plant Pathology Research Division, Department of Agriculture for Northern Ireland, Newforge Lane, Belfast BT9 5PX, U.K.
Nucleotide sequence of the rDNA internally transcribed spacer (ITS) 1 of twelve isolates of Colletotrichum, originally identified as either C. fructigenum, C. gloeosporioides or C. musae, was determined. Comparison of the sequence data with that from previously characterized isolates of Collefotrichum species revealed 97-100% homology with C. acutafum and only 79-81 % homology with C. gloeosporioides and C. musae. We conclude that the isolates belong to C. acufafum.The value of sequence data from ITS 1 in species assignment is demonstrated.
Collefofrichum comprises a diverse collection of phytopathogenic and saprotrophic species. Despite attempts to develop a species concept by various workers (e.g. von Arx, 1970; Baxter, Van Der Westhuizen & Eicker, 1985; Sutton, 1992), the phenotypic plasticity of several of these species has made the correct identification of members of the Collefofrichum genus highly ambiguous. Moreover, in certain instances, nonavailability of living type cultures makes comparison to authenticated reference cultures difficult. We are evaluating the potential of various molecular methods for determining the phylogenetic relationships and species diagnosis in Collefotrichum (Mills, Sreenivasaprasad &Brown, 1992; Sreenivasaprasad, Brown &Mills, 1992,1993). We report here the use of nucleotide sequence of the rDNA internally transcribed spacer (ITS) I for accurate identification of some atypical isolates of Colletotrichum.
MATERIALS A N D METHODS Original identification, host and source of the isolates of Collefofrichum species examined are given in Table I. Fungal mycelium was produced in glucose casamino acid liquid medium and the DNA extracted from freeze-dried mycelial powder as described in Sreenivasaprasad ef al. (1992). For PCR amplification and nucleotide sequence determination of the ITS 1 region, primers ITS 1 and ITS 2 (White ef al., 1990) and the solid phase sequencing methodology described in Sreenivasaprasad ef al. (1992) were used. ITS I nucleotide sequences of previously characterized C . acufafum Simmonds isolates 397 and NI 90, C. gloeosporioides (Penz.) Penz. & Sacc. isolate 23 1(Sreenivasaprasad e f al., 1992) and a C. musae (Berk. & M. A. Curtis) Arx isolate (Mills, Hodson & Brown, 1992) have been used for reference purposes. The sequence data were
* Corresponding author.
aligned and analysed using the CLUSTAL V package (Higgins, Bleasby & Fuchs, 1992).
RESULTS A N D DISCUSSION Nucleotide sequence of the ITS 1 region (180-181 bases) of the 12 isolates of Colletofrichum species examined showed a very high level of homology (97-100%) to C. acufafum isolates 397 and NI 90 (Fig. I and Table I). Isolates 495/17729,535/90.407,546,547/90.410,549,550 and 179 from Lupinus sp., 602191.326 from Phormium sp. and R I and R3 from Hevea brasiliensis (Wild ex A. Juss.) Muel1.-Arg., all originally identified as C . gloeosporioides, showed 98-100% homology to the C . acufafum isolates but had only 80-81% homology to C. gloeosporioides isolate 231 (Fig. 1and Table I). Similarly, isolate 58 supplied as C . m w a e revealed a low level of homology (79%) to the named species but showed 100% homology to C. acufafum isolate 397. C . frucfigenum has not been described as an accepted taxon in any of the recent reviews on Collefofrichum taxonomy and the isolate 4885 showed 97% homology to C . acufafum isolate 397. The nucleotide sequence of rRNA genes and spacer regions has been used to determine phylogenetic relationships in a broad range of organisms (Olsen e f al., 1986). In fungi such as Phytophfhora (Lee & Taylor, 1992) and Laccaria (Gardes et al., 1991), the degree of homology in the ITS I sequence has been found to be useful in delimiting some of the species. We have established the inter-specific homology levels (61-92%) in the ITS I sequence of some Collefofrichum species including C. musae (Mills ef al., 1992). We have also determined the extent of intra-specific variation in C . acutafum (0-6 %) as well as the divergence between C. gloeosporioides and C. acutafum (15-17%) based on ITS I sequence (Sreenivasaprasad e f al., 1992). The 12 Collefofrichum isolates, originally identified as
S. Sreenivasaprasad, P. R. Mills and Averil E. Brown
187
Table 1. Original identification, host and source of the isolates of Colletotrichum species examined and their ITS 1 sequence homology levels to previously characterized isolates Homology (%) to
Isolate
Original identification
Host
Homology (%) to named species
4951177298 (IMI 351259)
C. gloeosporioides
Lupinw sp.
80
535/90.407a (IMI 351250)
C . gloeosporioides
Lupinw sp.
80
546" (IMI 351260)
C. gl~eos~orioides
Lupinw sp.
80
547/90.410a (IMI 351249)
C. gloeosporioides
Lupinus sp.
80
549" (IMI 35 1251)
C. gloeosporioides
Lupinw sp.
80
550a (IMI 351244)
C. gl~eos~orioides
Lupinw sp.
602/91.3268 (IMI 351246)
C. gloeosporioides
Phormium sp.
81
Rlb
C . gioeosporioides
Heuea brasiliensis
81
100
R3'
C . gloeosporioides
Hevea brasiliensis
81
100
58" (IMI 165753)
C. musae
M w a nana
79
100
C. acutatumr
179"
C . gloeosporioides
Lupinw mutabilis
80
99
4885'
C. fructigenum
Acaena smithii
-
97
" MAFF CSL, Harpenden, U.K.
' Rubber Research Institute, Indonesia. ' University of Perideniya, Sri Lanka. Long Ashton Research Station, Bristol, U.K. DSIR Culture Collection, Auckland, New Zealand. ' Homology of all isolates except 602/91.326 relates to C. acutatum isolate 397; homology of 602/91.326 relates to C. acutatum isolate NI 90. Reference isolates: 397 - Fragaria x ananassa, U.S.A., Institute of Food and Agricultural Sciences, University of Florida; N1 90 - Fragaria x ananassa, U.K., isolated from anthracnosed fruits.
100 397 58
110
120
130
140
150
160
170
180
CGGCCCCCACCACGGGGACGGGGCGCCCGCCGGA'AATCT'CTTCTGAGTGGCACAAGCAAATMTTA
549
-------------------------------------*--------------------------*---------------------------------------------------------------.--------------------------*---------------------------
4885
-------------------------------------r-----------~--------------*---------------------------
NI90 -------ZGT-------G---A---------------.--------------------------4--------------------------602/91.326 -------'-T-------G---A-----------------*--------------------------*--------------------------231 -**--G--T--GG-C--GTC--*--------------T-----------GA--TA-------*-T-----------T-------------
CM
C-~*--G--C---G-*-CGT~--*--------------T-----------GA--TG-------*-T-----------T------------- C-
Fig. 1. Nucleotide sequence of the rDNA internally transcribed spacer 1 of the 12 isolates of Coiietotrichum species aligned with previously characterized isolates of C. acutatum (397 and NI 90), C. gloeosporioides (231) and C . musae (CM). ~solates and R3 have ITS 1 sequence identical to isolate 58; isolates 535/90.407, 546, 547/90.410, 550, 495/17729 and 179 have ITS 1 sequence identical to 549. (ITS 1 nucleotide sequence of C. acutatum isolates 397 and NI 90 and C. g l ~ e o s ~ o r i o i d eisolate s 231 has been reproduced from Sreeni~asa~rasad et al., 1992.)
RI
belonging to 3 different species, showed 97-100% homology (0-3 % variation) to the reference C. acritafum isolates and fitted well within the range of variation ( 0 4 % )established in this species. This clearly identifies these isolates as belonging to the species C. acutatum. The low level of homology ( 7 9 4 1 % ) shown by these isolates to isolates of their originally named species is indicative of inaccurate identifi-
cation arising from the use of characters such as conidial shape and size and colony morphology which are highly variable (Sutton, 1992). It is probable that the ITS I sequence will prove to be a suitable target for designing a C. acutatum -specific PCRprimeriprobe which could aid in rapid and reliable identification of this species.
Isolates of Colletofrichum
188
We thank Drs R. Cook and I. Barker (MAFF CSL., Har~enden) Mills, P. R.. Hodson, A. & Brown, A. E. (1992). Molecular differentiation of gloeosporioides isolates infecting tropical h i t s . In Colletoand D~J. A, ~ ~( Li ~ ~ l ~~~~~~~~h ~ ~ ~h ~ station, t ~~ ~ i ~for ~ t ~ lColletotrichum ) trichum - Biology, Pathology and Control (ed. J. A. Bailey & M. J. Jeger),pp. providing the "ltures. This work was by the 269-288, CAB fntemational Mycological Institute: Kew, ",K, Natural Resources Institute, Chatham and MAFF. Mills, P. R., Sreenivasaprasad, S. & Brown, A. E. (1992). Detection and ~
-
-
-
~
1
REFERENCES Arx, J. A. von. (1970). A revision of the fungi classified as Gloeosporium. Bibliotheca Mycologica 24, 1-203. Baxter, A. P., Van Der Westhuizen, G. C. A. & Eicker, A. (1985). A review of literature on the taxonomy, morphology and biology of the fungal genus Colletotrichum. Phytophylactica 17, 15-18. Gardes, M., White, T. J., Fortin, J. A., Bruns, T. D. & Taylor, J. W. (1991). Identification of indigenous and introduced symbiotic fungi in ectomycorrhizae by amplification of nuclear and mitochondria1 ribosomal DNA. Canadian journal of Botany 69, 180-190. Higgins, D. G., Bleasby, A. J. & Fuchs, R. (1992). CLUSTAL V: improved software for multiple sequence alignment. Computer Applications for Biosciences 8, 189-191. Lee, S. B. & Taylor, J. W. (1992). Phylogeny of five fungus-like protoctistan Phytophthora species, inferred from the internal transcribed spacers of ribosomal DNA. Molecular Biology and Evolution 9, 636-653.
(Accepted 27 A u g w t 1993)
differentiation of Colletotrichum gloeospor~oidesisolates using PCR. FEMS Microbiology Letters 98, 137-144. Olsen, G. J., Lane. D. J.. Giovannoni. S. J. & Pace, N. R. (1986). Microbial ecology and evolution: a ribosomal RNA approach. Annual Review of Microbiology 40, 337-365. S., Brown, A. E. & Mills, P. R. (1992). DNA sequence Sreeni~asa~rasad, variation and interrelationships among Colletotrichum species causing strawberry anthracnose. Physiological and Molecular Plant Pathology 41, 265-281. Sreeni~asa~rasad, S., Brown, A. E. & Mills, P. R. (1993). Coffee berry disease pathogen in Africa: genetic structure and relationship to the group species Colletotrichum gloeosporioides. Mycological Research 97,995-1000. Sutton, 8.C. (1992). The genus Glomerella and its anamorph Colletotrichum. In Colletotrichum - Biology, Pathology and Control (ed. J . A. Bailey & M. J. Jeger), pp. 1-26. CAB International Mycological Institute: Kew, U.K. White, T. J., Bruns, T., Lee, S. B. & Taylor, J. W. (1990). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols, A Guide to Methods and Applications (ed. M. A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White), pp. 315-322. Academic Press: San Diego, U.S.A.