- Email: [email protected]
Nucleotide sequence of the regulatory region of the uvrD gene of Escherichia coli
Gene. 25 (1983) 317-323
317
Elsevier GENE 883 Nucleotide sequence of the regulatory region of the uvrD gene of Escherichia coli
(Dideoxy sequencing; LexA binding site; promoter sequences; transcription terminator; SOS response)
Paul Finch and Peter T. Emmerson Department of Biochemistry, University of Newcastle upon Tyne, Newcastle upon Yyne, NE1 7RU (U.K.) Tel. (0632) 328511 ext. 3434
(ReceivedJune 13th, 1983) (Revision receivedJuly 15th, 1983) (AcceptedJuly 18th, 1983)
SUMMARY We h~tve sequenced the control region of the Escherichia coli uvrD gene and demonstrated the presence of a nucleotide sequence which is a perfect match for the consensus LexA protein binding site [Little and Mount, Cell 29 (1982) 11-22]. Upstream of this presumed LexA binding site is a promoter sequence, uvrD P1 which would be under LexA control while farther downstream is another possible promoter, uvrD Pz, which would be independent of LexA control. Downstream of the LexA binding site is a potential transcription terminator in the form of a stem-loop structure followed by a series of T residues. On the basis of this sequence analysis, expression of the uvrD gene would be expected to increase after DNA damage or replication inhibition as part of the SOS response, as is reported in the preceding paper [Arthur and Eastlake, Gene 25 (1983) 309-316].
INTRODUCTION The recent cloning and sequencing of several DNA repair genes and the characterisation of the gene products has led to considerable progress towards our understanding of the control and mechanism of DNA repair. The uvrA, uvrB and uvrC genes, which are essential for the initial endonucleolytic incision step of exision repair (for review, see Hanawalt et al., 1979), have been cloned (Pannekoek et al., 1978; Sancar et al., 1981a, b, e; Yoakum et al., 1980) and their products identified and purified. Expression of these genes has been investigated in Abbreviations: Ap, ampieillin;bp, base pairs; EtBr, ethidium bromide; kb, kilobasepairs; r, resistance;s, sensitivity;UV, ultravioletlight. 0378-1119/83/$03.00 © 1983 ElsevierScience Publishers
vivo by the Mud(Aprlac) gene fusion technique (Kenyon and Walker, 1981; Fogliano and Schendel, 1981) and also by nucleotlde sequence analysis (Van den Berg et al., 1981; Sancar et al., 1982a, b). Mutants in uvrD are UV-sensitive but unlike the other uvr mutants are apparently capable of normal incision (KQmmede and Masker, 1980). The mutations are pleiotropic and genetic studies implicate the gene not only in DNArepair (Van Sluis et al., 1974; Rothman and Clark, 1977; KOmmerle and Masker, 1980), but also in genetic recombination (Horii and Clark, 1973; Arthur and Lloyd, 1980; Howard-Flanders and Bardwell, 1981), transposon excision (Lundblad and Kleekner, 1982), spomaneous mutagenesis (Smirnov et al., 1973; Siegel, 1973a) and possibly DNA replication (Hofiuchi and N.agata, 1973; Siegel, 1973b; Smirnov et al., 1973).
318
The uvrD gene has been cloned and its product identified as a protein of 73-76 kDal (Arthur et al., 1982; Oeda etal., 1982; Maples and Kushner, 1982). The UvrD protein has been purified to homogeneity and shown to be identical to DNA helicase II (Hickson et al., 1983), a previously well characterised enzyme (Abdel-Monem et al., 1976a, b; 1977a,
ments were recovered from gels by electroelution, concentrated by treatment with isobutanol, extracted with phenol and precipitated with ethanol (McDonnell et al., 1977).
b).
T4 DNA ligase was purified in this laboratory by A. Tomkinson from lysogens of ;tNM989 (Murray et al., 1979). Ligation reactions contained 2 ng vector DNA (M13mp8 or mp9), and 2-10 ng DNA fragments in 10/A ligation buffer. For blunt end ligations, excess ligase was added and incubated at 15°C for 24--35 h. Ligation products were used to transform JM101 made competent in ice cold 50 mM CaC12 (Cohen et al., 1972).
Here we present sequence analysis of the regulatory region of the uvrD gene which suggests that transcription of the gene is repressed by LexA protein. DNA helicase II would therefore be induced as part of the SOS response.
(c) Ligation and transformation
MATERIALS AND METHODS
(d) DNA sequence analysis (a) Bacteria and plasmids The uvrD gene lies on a 2.9-kb PvulI fragment (Maples and Kushner, 1982). This fragment (Fig. 1) was subcloned from plasmid priMA9 (Hiekson et al., 1983) into the HinclI site of M13mp9 to give the recombinant phage rpl. E. cell JM101 (Messing et al., 1981) was used as the host strain throughout.
(b) Preparation of plasmid DNA, restriction analysis and purification of DNA fragments Plasmid DNA was purified on CsCI-EtBr isopycnic gradients. Restriction endonucleases were obtained from BRL, New England Biolabs, Boehringet Mannheim and NBL Enzymes, and were used as recommended by the suppliers. DNA restriction fragments were analysed on 0.7 ~ agarose gels in electrophoresis buffer (40 mM Tris" acetate pH 7.6; 1 mM EDTA). Samples were visualised under UV after staining with EtBr. Frag0
1
2
I
I
I
2.gkb I
~RI ~4Ea BgL11 SsflI /'~1"BamHI PsI"I
]
I
,
!
uvrn Fig. 1. Restriction map of the 2.9-kb PvulI fragment from priMA9. The direction of transcription is indicated by an arro.w.
Sequences were determined by the dideoxy method (Sanger et al., 1977) using the M13mp8 and mp9 phage system (Messing and Vieira, 1982) and a synthetic 15-base universal primer (New England Biolabs). The Klenow fragment of DNA polymerase I was obtained from Boehdnger Mannheim, Cambridge Biotechnology Labs and NBL Enzymes. Clones for sequencing were generated by the "nonrandom" method of Poncz et al. (1982). In this method, exonuclease BAL31 is used to delete increasingly large fragments of DNA in order to bring more distant sequences within range of the primer. The orientation of the inserted fragment in rpl was determined by restriction mapping of the replicative form and it was found that the BglII site of the inserted fragment was adjacent to the unique Sinai site of M13mp9 (not shown). To generate the deletions the replicative form ofrp 1 was linearised with Sinai and digested with BAL31. Aliquots were removed periodically, the reaction was stopped by addition of EDTA to a concentration of 25 mM and samples were analysed on agarose gels. Aliquots containing deletions of the desired size range (up to 3 kb) were pooled and digested with HindIII, and analysed again on agarose gels. Fragments of 2.9 kb and smaller were isolated from the gel and purified. M13mp9 was cut with Sinai and HindIII, and deletion fragments were ligated into these sites. The recombinants obtained contain inserts of different size depending on the extent of digestion with
319 BAL31 and the inserts are oriented with the blunt end adjacent to the M13 primer site. The opposite strand was obtained for sequencing by creating deletions at the unique S s t l I site in rpl and cutting a second time with XmaI. The resulting fragments were ligated into M13mp8 digested with XmaI and
- 35 sequence is separated from the - 10 sequence
by 16 nucleotides. The - 10 sequence for uvrD P2, T A T T T T (bp 100 to bp 105), has less homology to the canonical sequence, although it is identical to the - 10 sequence of the TnlO tetA gene (Bertrand et al., 1983). The corresponding - 3 5 region, T T G C G C (bp 80 to bp 85), is consistent with the consensus T T G a c a and differs by only one residue from the - 35 sequence of rrnE P,, T T G C G G (deBoer et al., 1979). However, the - 35 sequence is separated from the - 10 sequence by only 14 nucleotides. Transcription from these promoters would be expected to start at an A or G residue between 4 and 8 residues downstream of the - 10 sequences (Hawley and McClure, 1983). Thus, transcription from P1 might start from one of the three A residues numbered 43 to 45 and transcription from P2 might start at the G residue at bp 109. Immediately downstream of uvrD P i beginning at bp 47 is a sequence which perfectly matches the consensus sequence of previously identified LexA protein binding sites (reviewed by Little and Mount, 1982), all of which consist of CTG followed 11 bp later by CAG in a 3-bp inverted repeat (Fig. 3). Further analysis of the sequence reveals two regions of dyad symmetry situated downstream of the LexA binding site which would permit the formation of stem-loop structures. The first, from bp 69 to bp 75, would result in a 7-bp stem with 8 5 ~ G-C pairing and a large ring of 12 bases. The second, from bp 75 to bp 79, would allow the formation of a shorter 5-bp stem with 100~o G-C pairing and a
HinclI.
Templates for sequencing were prepared as described (Sanger et al., 1980). Sequence analysis was aided by computer (Staden, 1982; Conrad and Mount, 1982).
RESULTS The sequence of the uvrD regulatory region was determined in both strands by sequencing clones generated by the "nonrandom" method of Poncz et al. (1982). Fig. 2 shows a 150-bp sequence numbered arbitrarily from an EcoRI * site. For simplicity, only the DNA strand coding for the uvrD gene is shown. Comparison of this sequence with the sequences of known promoters (reviewed by Hawley and McClure, 1983) reveals two potential promoters, designated uvrD PI and uvrD P2. For uvrD P~ the - 10 sequence, TATAAT (bp 33 to bp 38), is identical to the consensus sequence proposed by Rosenberg and Court (1979) and the - 3 5 sequence, T T G G C A (bp 11 to bp 16), differs by only one base from that of the consensus T T G a c a and is identical to the uvrB P~ - 35 sequence (Van den Berg et al., 1981; Sancar et al., 1982a). The - 3 5 sequence is preceded by the expected AT-rich region and the
-35 PI - 1 0 PI , LexA I 1 0 20 30 "40 I 50 60 I 70 AATTTCCCGGI~TGGCAITCTCTGACCT CGCTGA~ATAATICAGCAAATCTGTATATATACCCAGCTTTTTGGCGGAG "
"
m, AI "RN - ' ' ~ start
--
,,
-35 P2 -I0 P2 SD 80 90 100 110 120 13G 140 150 GGCG~-~-G~TTCTCCGCCCAACC~-~-~TACGCGGCGGTGCCAATGGACGTTTCTTACCTGCTCGACAGCCTT = 4 ~ ~A 2 MetAspValSerTyrLeuLeuAspSerLeu Terminator R start? Fig. 2. Sequenceof the ,~vrDcontrol region.The - 10 and - 35 sequencesfor uvrD Pt and uvrD P2 are enclosedby boxes. Someregions of dyad symmetryare depicted by facingarrows. The putative LexA protein binding site, terminator and ribosomebinding site (SD) are indicated. Vertical arrows indicate possible start points for transcription.The first 10 amino acids (includingf-Met) predicted by the nucleotidesequence are shown.
320 Sequence
Gene
~exA1
TGCTGTATATACTCACAGCA
Z_C.~ 2 recA uvr'~
AACTGTATATACACCCAGGG TACTGTATGAGCATACAGTA
olo13 coL~1 sulA rDaU-dnaG-rooD
TACTGTATATTCATTCAGGT AACTGTTTTTTTATCCAGTA TACTGTGTATATATACAGTA TGCTGTATATAAAACCAGTG TACTGTACATCCATACAGTA AGCTGGCGTTGATGCCAGCG
oonsenaus
taCTGtatat-cat-CAGta
uvrD
ATCTGTATATATACCCAGCT
uvrB
Fig. 3. Comparison of LexA protein binding sites. The LexA bindingsites for lex.A,recA, uvrA, uvrB,sulA and the rpsU-dnaGrpoD operon, and for the baeterioein genes clo13 and clel of plasmids CIoDFI3 and ColEI, respectively,are shown. Below them is a consensus sequence (taken from Little and Mount, 1982;Van den Elzenet al., 1982;Cole, 1983;Lupskiet al., 1983). At the bottom is the putative LexA binding site for the uvrD control region. smaller l 1-base loop (Fig. 4). Calculation of the secondary structure free energy (AG) (Tinoco et al., 1973) indicates that the structure with the 7-bp stem would be formed preferentially. Immediately downstream of this potential stem loop is a run of 5 T residues beginning at bp 102 which suggests that the structure may constitute a system for premature termination of transcription from P~. The - 3 5 sequence of P2 is contained within this putative terminator sequence. The - 10 sequence of P1 is at the centre of a region ofdyad symmetry in a region which has a nucleotide
(a)
.r.T_G..C"
(b) /C/13~C~T~T\
A---T G-C (i--C C-=fi -16-6Kcal
G--C fi-C bp69---] L-bp~
5
C
l
l
T, 7 T',.G~ C,,,C C--G G-- C
-12.2Kcal
G-C G-C bp75--j l~bp%
Fig.4. Structuresof two potential terminators in the uvrD control region.(a) Stem of 7 bp with 85% G-C pairing and a 12-bp loop; (b) stem of 5 bp with 100% G-C pairing and a 11-bp loop.
sequence with some similarity to that of the LexA binding site. A ribosome binding site G G C G G T (Steitz, 1979) beginning at bp 111 is followed by an ATG beginning at bp 121 and an open reading frame. The first 10 amino acids of the UvrD protein predicted by the sequence are presented (Fig. 2). The complete sequence of the uvrD gene will be published elsewhere (Finch, P. and Emmerson, P.T., in preparation).
DISCUSSION Sequence analysis of the operator-promoter region of the uvrD gene suggests that the gene may be transcribed from two promoters uvrD P1 and uvrD P2 and that a LexA protein binding site functions as an operator for Pl but not P2. In the presence of LexA protein, transcription from P1 would be expected to be repressed while that from P2 would be unaffected. The sequence of P~ matches very well with the consensus sequence derived from analysis of 168 promoter sequences (Hawley and McClure, 1983). Moreover, the location and sequences of most promoter mutations suggest that the consensus sequence corresponds to maximum function of the promoter (Hawley and McClure, 1983). Thus, PI could be expected to be an efficient promoter. On the other hand, the sequence of P2 does not match the consensus sequence as well as does PI and the P2 - 3 5 and - 10 sequences are separated by only 14 nucleotides. This spacing would be unusually low for a promoter, the optimal separation being approx. 17 (Hawley and McClure, 1983). It would be expected on the basis of this sequence analysis that transcription from Pf would occur much more frequently than any from P2 and this is supported by S1 nuclease mapping of RNA transcripts synthesised in vivo (Bramhill, D. and Emmerson, P.T., in preparation). Identification of a LexA-controlled operator in the uvrD control region explains the observation that fl-galactosidase synthesis is inducible by DNA damaging agents in strains eont0Jning Mud(Aprlac) fusions in the uvrD gene (Arthur and Eastlake, 1983; Siegel, personal communication). However, despite the apparently strong P~ promoter, the approx. 1.5-
321
fold induction (Arthur and Eastlake, 1983; Siegel, personal communication) is small when compared to that of other SOS genes (Kenyon and Walker, 1981 ; Fogliano and Schendel, 1981; Huisman and D'Ari, 1981), possibly because of termination of the P1 transcripts by the putative terminator downstream of the LexA protein binding site. Multiple copies of the uvrD gene sensitise a uvrD + host to UV (Oeda et al., 1981; Maples and Kushner, 1982) and a system for premature termination of transcription of uvrD may be part of the fine tuning control mechanism required to limit the level of UvrD protein. The mechanism for anti-termination, if any, is not clear. A computer search of the control region failed to reveal a sequence similar to the nut sites of phage lambda (Drahos and Szybalski, 1981; Ward and Gottesman, 1982) although an equivalent site occurs in the SOS inducible E. coli rpsU-dnaG-rpoD operon (Lupski et al., 1983). However, it may or may not be significant with respect to anti-termination that the sequence GGCGG, bp 69 to 73, which appears in the stem of the putative terminator (Fig. 4a), appears also in the Shine--Dalgarno sequence, bp 11 l t o 115. This suggests two possible means of disrupting the stem-loop terminator structure in the mRNA. Either ribosomes could bind to this site in the stem-loop of the mRNA and open it up, or the stem-loop structure could be disrupted by pairing of the CCGCC, bp 90 to bp94, with the Shine--Dalgarno sequence GGCGG, bp 111 to 115 to give an alternative stem loop in the mRNA. There is extensive homology between the LexAcontrolled operator of the uvrD gene and the second SOS box of lexA (Fig. 3). The homology continues upstream and the sequence between bp 29 and bp 41, which is in the approximate position of the first SOS box oflexA, is similar to a lexA binding site except that there are 3 bp less between the CTG and CAG sequences than in the consensus sequence. This suggests that the control regions of lexA and uvrD may have common ancestry. Sequence analysis of the operator-promoter region of the sulA gene (Cole, 1983) has revealed, in addition to a putative LexA binding site, extensive homology between a promoter-proximal region and the second SOS box of the lexA gene, also suggesting common ancestry. Sequence analysis suggests that control of the uvrD gene may be sophisticated. Further work will be required to elucidate the mechanisms involved and
to explain the apparently low extent of induction when measured by gene fusion techniques.
ACKNOWLEDGEMENTS
We thank Dr. R. Staden and Dr. D. Mount for the gift of their computer programmes, and Mr. M.D. Emmerson for local help with computing. We also thank Mrs. P. Heslop and Mr. C. Robson for technical help, and the Medical Research Council for financial support. P. Finch was supported by a SERC-CASE studentship.
REFERENCES Ahdel-Monem, M. and Hoffmann-Berling, H.: Enzymatic unwinding of DNA, I. Purification and characterization of a DNA-dependent ATPase from Escherichia coli. Eur. J. Biochem. 65 (1976a) 431-440. AbdeI-Monem, M., Durwald, H. and Hoffinann-Beriing, H.: Enzymatic unwinding of DNA, II. Chain separation by an ATP-dependent DNA unwinding enzyme. Eur, J. Biochem. 65 (1976b) 441-449. Abdel-Monem, M., Chanal, M.C. and Hoffmann-Berling, H.: DNA unwinding enzyme II of Escherichia coil, I. Purification and characterization ofthe ATPase activity. Eur. J. Biochem. 79 (1977a) 33-38. AbdeI-Monem, M., Durwaid, H. and Hoffmann-Berling, H.: DNA unwinding enzyme II ofE. coli, II. Characterization of the DNA unwinding activity. Eur. J. Biochem. 79 (1977b) 39--46. Arthur, H.M., Bramhill, D., Easflake, P.B. and Emmerson, P.T.: Cloning of the uvrD gene of E. coli and identification of the product. Gene 19 (1982) 285-295. Arthur, H.M. and Lloyd, R.G.: Hyper-recombination in uvrD mutants ofEscherichia coliK-12. Mol. Gen. Genet. 180 (1980) 185--191. Arthur, H.M. and Eastlake, P.B.: Transcriptional control of the uvrD gone of E. coll. Gene 25 (1983) 309-316. Bertrand, K.P., Pestle, K., Wray, L.V. and Reznikoff, W.S.: Overlapping divergent promoters control expression of Tnl0 tetracycline resistance. Gene 23 (1983) 149-156. Cohen, S.N., Chang, C.Y, and Hsu, L.: Nonchrom0somal antibiotic resistance in bacteria. Prec. Natl. Acad. Sci. USA 69 (1972) 2110-2114. Cole, S.T.: Characterisation of the promoter for the LexA regulated sulA gene of E. coli. Mol. Gen. Genet. 189 (1983) 400-404. Conrad, B. and Mount, D.W.: Microcomputer programs for DNA sequence analysis. Nucl. Acids Res. 10 (1982) 31-38.
322 DeBoer, H.A., Gilbert, S.F. and Nomura, M.: DNA sequences of promoter regions for rRNA operons rrnE and rrnA in E. coll. Cell 17 (1979) 201-209. Drahos, D. and Szybalski, W.: Antitermination and termination functions of the cloned nutL, N and tLI modules of coliphage lambda. Gene 16 (1981) 261-274. Fogliano, M. and Schendel, P.F.: Evidence for the inducibility of the uvrB operon. Nature 289 (1981) 196-198. Hanawalt, P.C., Cooper, P.K., Ganesan, A.K. and Smith, C.A.: DNA repair in bacteria and mammalian cells. Annu. Rev. Biochem. 48 (1979) 783-836. Hawley, D.K. and McClure, W.R.: Compilation and analysis of Escherichia coil promoter DNA sequences. Nucl. Acids Res. 11 (1983) 2237-2255. Hickson, I.D., Arthur, H.M., Bramhill, D. and Emmerson, P.T.: The E. coil uvrD product is DNA heliease II. Mol. Gen. Ganet. 190 (1983) 265-270. Horii, Z.-I. and Clark, A.J.: Genetic analysis ofthe recFpathway to genetic recombination in Escherichia coll. Isolation and characterization of mutants. J. Mol. Biol. 80 (1973) 327-344. Horiuchi, T. and Nagata, T.: Mutations affecting growth of the Escherichia coil cell under a condition of DNA polymerase I deficiency. Mol. Gen. Genet. 123 (1973) 89-110. Howard-Flanders, P. and Bardw¢ll, E.: Effects of recB21, reeF143 and uvrD152 on recombination in lambda baeteriophage-prophage and Hfr by F - crosses. J. Bacteriol. 148 (1981) 739-743. Huisman, O. and D'Ari, R.: An inducible DNA replication-cell division coupling mechanism in E. cog. Nature 290 (1981) 797-799. Kenyon, C.J. and Walker, G.C.: Expression of the E. cog uvrA gene is inducible. Nature 289 (1981) 808-810. KQmmerle, N.B. and Masker, W.E.: Effect &the uvrD mutation on excision repair. J. Baeteriol. 142 (1980) 535-546. Little, J.W. and Mount, D.W.: The SOS regulatory system of E. coil Cell 29 (1982) 11-22. Lundblad, V. and Kleckner, N.: Mutants ofE. coli K-12 which affect excision of transposon Tnl0, in Lemontt, J.F. and Generoso, W.M. (Eds.), Molecular and Cellular Mechanisms of Mutagenesis. Plenum, New York, 1982, pp. 245-258. Lupski, J.R., Smiley, B.L. and Godson, G.N.: Regulation of rpsU-dnaG-rpoD macromolecular synthesis operon and the initiation of DNA replication in E. coli K-12. Mol. Gen. Genet. 189 (1983) 48-57. Maples, V.F. and Kushner, S.R.: DNA repair in Escherichia cog: Identification of the uvrD gen¢ product. Prec. Natl. Acad. Sci. USA 79 (1982) 5616-5620. McDonnell, M.W., Simon, M.N. and Studier, F.W.: Analysis of restriction fragments of T7 DNA and determination of molecular weights by electrophoresis in neutral and alkaline gels. J. Mol. Biol. 110 (1977) 119-146. Messing, J., Crea, R. and Seeburg, P.H.: A system for shotgun DNA sequencing. Nucl. Acids Res. 9 (1981) 309-321. Messing, J. and Vieira, J.: A new pair of M 13 vectors for selecting either DNA strand of double digest restriction fragments. Gene 19 (1982) 269-276. Murray, N.E., Bruce, S. and Murray, K.: Molecular cloning of
the DNA ligase gene from T4, ll. Expression of the gene and purification of its product. J. Mol. Biol. 132 (1979) 493-505. Oeda, K., Horiuchi, T. and Sekiguchi, M.: The uvrD gene of E. cog encodes a DNA-depandent ATPase. Nature 298 (1982) 98-100. Pannekoek, H., Noordermeer, I.A., Van Sluis, C.A. and Van de Putte, P.: Expression of the uvrB gene of E. coil: in vitro construction ofpMB9 uvrB plasmid. J. Bacteriol. 133 (1978) 884-896. Poncz, M., Solowiejczyk, D., Ballantine, M., Schwartz, E. and Surrey, S.: "Nonrandom" DNA sequence analysis in bacteriophage MI3 by the dideoxy chain termination method. Prec. Natl. Acad. Sci. USA 79 (1982) 4298-4302. Rosenberg, M. and Court, D.: Regulatory sequences involved in the promotion and termination of RNA transcription. Annu. Rev. Genet. 13 (1979) 319-353. Rothman, R.H. and Clark, A.J.: Defective excision and postreplication repair of UV-damaged DNA in a reel strain of E. cog K-12. Mol. Gen. Genet. 155 (1977) 26%277. Sancar, A., Wharton, R.P., Seltzer, S., Kacinski, B.M., Clarke, N.D. and Rupp, W.D.: Identification of the uvrA gene product. J. Mol. Biol. 148 (1981a) 45-62. Sancar, A., Clarke, N.D., Griswold, J., Kennedy, W.J. and Rupp, W.D.: Identification of the uvrB gene product. J. Mol. Biol. 148 (1981b) 63-76. Sancar, A., Kacinski, B.M., Mott, D.L. and Rupp, W.D.: Identification of the uvrC gen¢ product. Prec. Natl. Acad. Sci. USA 78 (1981c) 5450--5454. Sancar, G.B., Sancar, A., Little, J.W. and Rupp, W.D.: The uvrB gene of E. coil has both lexA repressed and lexA independent promoters. Cell 28 (1982a) 523-530. Sancar, A., Sanear, G.B., Rupp, W.D., Little, J.W. and Mount, D.W.: LexA protein inhibits transcription of the E. coli uvrA gane in vitro. Nature 289 (1982b) 96--98. Sanger, F., Coulson, A.R., Barrell, B.G., Smith, A.J.H. and Roe, B.A.: Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J. Mol. Biol. 143 (1980) 161-178. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. Prec. Natl. Aead. Sci. USA 74 (1977) 5463-5467. Siegel, E.C.: Ultraviolet-sensitive mutator strain of Escherichia coil K-12. J. Bacteriol. 113 (1973a) 145-160. Siegel, E.C.: Ultraviolet-sensitive mutator mutU4 of Escherichia coil inviable with polA. J. Baeteriol. 113 (1973b) 161-166. Smirnov, G.B., Filkova, E.V. and Skavronskaya, A.G.: The mutator property ofuvr-502 mutation affecting UV-sensitivity of Escherichia coil Mol. Gen. Ganet. 118 (1972) 51-66. Smirnov, G.B., Filkova, E.V. and Skavronskaya, A.G.: Loss and restoration of viability of E. cog due to combinations of mutations affecting DNA polymerase I and repair activities. Mol. Gen. Genet. 121 (1973) 139-150. Staden, R.: Automation of the computer handling of gel reading data produced by the shotgun method of DNA sequencing. Nucl. Acids Res. 10 (1982) 4731--4751. Steitz, J.A.: RNA-RNA interactions during polypeptide chain initiation, in Chambliss, G., Craven, G.R:, Davies, J., Kahan, L. and Nomura, M. (Eds.), Ribosomes, Unive.rsity Park
323
Press, Baltimore, 1979, pp. 349-399. Tinoco, I., Borer, P.N., Dengler, B., Levine, M.D., Uhlenbeck, O.C., Crothers, D.M. and Gralla, J.: Improved estimation of secondary structure in ribonucleic acids. Nature 246 (1973) 40-41. Van den Berg, E., Zwetsloot, J., Noordermeer, I., Pannekoek, H., Dekker, B., Dijkema, R. and Van Ormondt, H.: The structure and function of the regulatory elements of the Escherichia coli uvrB gene. Nucl. Acids Res. 9 (1981) 5623-5643. Van den Elzen, P.J.M., Maat, J., Waiters, H.H.B., Veltkamp, E. and Nijkamp, H.J.J.: The nucleotide sequence of the bac-
teriocin promoters of plasmids CloDF13 and ColE l: role of LexA represser and cAMP in the regulation of promoter activity. Nucl. Acids Res. 10 (1982) 1913-1928. Van Sluis, C.A., Mattern, I.E. and Patterson, M.C.: Properties ofEscherichia coli K-12, I. Effects of UV-irradiation on DNA metabolism. Mutation Res. 25 (1974)273-279. Ward, D.F. and Gottesman, M.E.: Suppression oftranscription termination by phage lambda. Science 216 (1982) 946-951.
Communicated by R.W. Davies.
317
Elsevier GENE 883 Nucleotide sequence of the regulatory region of the uvrD gene of Escherichia coli
(Dideoxy sequencing; LexA binding site; promoter sequences; transcription terminator; SOS response)
Paul Finch and Peter T. Emmerson Department of Biochemistry, University of Newcastle upon Tyne, Newcastle upon Yyne, NE1 7RU (U.K.) Tel. (0632) 328511 ext. 3434
(ReceivedJune 13th, 1983) (Revision receivedJuly 15th, 1983) (AcceptedJuly 18th, 1983)
SUMMARY We h~tve sequenced the control region of the Escherichia coli uvrD gene and demonstrated the presence of a nucleotide sequence which is a perfect match for the consensus LexA protein binding site [Little and Mount, Cell 29 (1982) 11-22]. Upstream of this presumed LexA binding site is a promoter sequence, uvrD P1 which would be under LexA control while farther downstream is another possible promoter, uvrD Pz, which would be independent of LexA control. Downstream of the LexA binding site is a potential transcription terminator in the form of a stem-loop structure followed by a series of T residues. On the basis of this sequence analysis, expression of the uvrD gene would be expected to increase after DNA damage or replication inhibition as part of the SOS response, as is reported in the preceding paper [Arthur and Eastlake, Gene 25 (1983) 309-316].
INTRODUCTION The recent cloning and sequencing of several DNA repair genes and the characterisation of the gene products has led to considerable progress towards our understanding of the control and mechanism of DNA repair. The uvrA, uvrB and uvrC genes, which are essential for the initial endonucleolytic incision step of exision repair (for review, see Hanawalt et al., 1979), have been cloned (Pannekoek et al., 1978; Sancar et al., 1981a, b, e; Yoakum et al., 1980) and their products identified and purified. Expression of these genes has been investigated in Abbreviations: Ap, ampieillin;bp, base pairs; EtBr, ethidium bromide; kb, kilobasepairs; r, resistance;s, sensitivity;UV, ultravioletlight. 0378-1119/83/$03.00 © 1983 ElsevierScience Publishers
vivo by the Mud(Aprlac) gene fusion technique (Kenyon and Walker, 1981; Fogliano and Schendel, 1981) and also by nucleotlde sequence analysis (Van den Berg et al., 1981; Sancar et al., 1982a, b). Mutants in uvrD are UV-sensitive but unlike the other uvr mutants are apparently capable of normal incision (KQmmede and Masker, 1980). The mutations are pleiotropic and genetic studies implicate the gene not only in DNArepair (Van Sluis et al., 1974; Rothman and Clark, 1977; KOmmerle and Masker, 1980), but also in genetic recombination (Horii and Clark, 1973; Arthur and Lloyd, 1980; Howard-Flanders and Bardwell, 1981), transposon excision (Lundblad and Kleekner, 1982), spomaneous mutagenesis (Smirnov et al., 1973; Siegel, 1973a) and possibly DNA replication (Hofiuchi and N.agata, 1973; Siegel, 1973b; Smirnov et al., 1973).
318
The uvrD gene has been cloned and its product identified as a protein of 73-76 kDal (Arthur et al., 1982; Oeda etal., 1982; Maples and Kushner, 1982). The UvrD protein has been purified to homogeneity and shown to be identical to DNA helicase II (Hickson et al., 1983), a previously well characterised enzyme (Abdel-Monem et al., 1976a, b; 1977a,
ments were recovered from gels by electroelution, concentrated by treatment with isobutanol, extracted with phenol and precipitated with ethanol (McDonnell et al., 1977).
b).
T4 DNA ligase was purified in this laboratory by A. Tomkinson from lysogens of ;tNM989 (Murray et al., 1979). Ligation reactions contained 2 ng vector DNA (M13mp8 or mp9), and 2-10 ng DNA fragments in 10/A ligation buffer. For blunt end ligations, excess ligase was added and incubated at 15°C for 24--35 h. Ligation products were used to transform JM101 made competent in ice cold 50 mM CaC12 (Cohen et al., 1972).
Here we present sequence analysis of the regulatory region of the uvrD gene which suggests that transcription of the gene is repressed by LexA protein. DNA helicase II would therefore be induced as part of the SOS response.
(c) Ligation and transformation
MATERIALS AND METHODS
(d) DNA sequence analysis (a) Bacteria and plasmids The uvrD gene lies on a 2.9-kb PvulI fragment (Maples and Kushner, 1982). This fragment (Fig. 1) was subcloned from plasmid priMA9 (Hiekson et al., 1983) into the HinclI site of M13mp9 to give the recombinant phage rpl. E. cell JM101 (Messing et al., 1981) was used as the host strain throughout.
(b) Preparation of plasmid DNA, restriction analysis and purification of DNA fragments Plasmid DNA was purified on CsCI-EtBr isopycnic gradients. Restriction endonucleases were obtained from BRL, New England Biolabs, Boehringet Mannheim and NBL Enzymes, and were used as recommended by the suppliers. DNA restriction fragments were analysed on 0.7 ~ agarose gels in electrophoresis buffer (40 mM Tris" acetate pH 7.6; 1 mM EDTA). Samples were visualised under UV after staining with EtBr. Frag0
1
2
I
I
I
2.gkb I
~RI ~4Ea BgL11 SsflI /'~1"BamHI PsI"I
]
I
,
!
uvrn Fig. 1. Restriction map of the 2.9-kb PvulI fragment from priMA9. The direction of transcription is indicated by an arro.w.
Sequences were determined by the dideoxy method (Sanger et al., 1977) using the M13mp8 and mp9 phage system (Messing and Vieira, 1982) and a synthetic 15-base universal primer (New England Biolabs). The Klenow fragment of DNA polymerase I was obtained from Boehdnger Mannheim, Cambridge Biotechnology Labs and NBL Enzymes. Clones for sequencing were generated by the "nonrandom" method of Poncz et al. (1982). In this method, exonuclease BAL31 is used to delete increasingly large fragments of DNA in order to bring more distant sequences within range of the primer. The orientation of the inserted fragment in rpl was determined by restriction mapping of the replicative form and it was found that the BglII site of the inserted fragment was adjacent to the unique Sinai site of M13mp9 (not shown). To generate the deletions the replicative form ofrp 1 was linearised with Sinai and digested with BAL31. Aliquots were removed periodically, the reaction was stopped by addition of EDTA to a concentration of 25 mM and samples were analysed on agarose gels. Aliquots containing deletions of the desired size range (up to 3 kb) were pooled and digested with HindIII, and analysed again on agarose gels. Fragments of 2.9 kb and smaller were isolated from the gel and purified. M13mp9 was cut with Sinai and HindIII, and deletion fragments were ligated into these sites. The recombinants obtained contain inserts of different size depending on the extent of digestion with
319 BAL31 and the inserts are oriented with the blunt end adjacent to the M13 primer site. The opposite strand was obtained for sequencing by creating deletions at the unique S s t l I site in rpl and cutting a second time with XmaI. The resulting fragments were ligated into M13mp8 digested with XmaI and
- 35 sequence is separated from the - 10 sequence
by 16 nucleotides. The - 10 sequence for uvrD P2, T A T T T T (bp 100 to bp 105), has less homology to the canonical sequence, although it is identical to the - 10 sequence of the TnlO tetA gene (Bertrand et al., 1983). The corresponding - 3 5 region, T T G C G C (bp 80 to bp 85), is consistent with the consensus T T G a c a and differs by only one residue from the - 35 sequence of rrnE P,, T T G C G G (deBoer et al., 1979). However, the - 35 sequence is separated from the - 10 sequence by only 14 nucleotides. Transcription from these promoters would be expected to start at an A or G residue between 4 and 8 residues downstream of the - 10 sequences (Hawley and McClure, 1983). Thus, transcription from P1 might start from one of the three A residues numbered 43 to 45 and transcription from P2 might start at the G residue at bp 109. Immediately downstream of uvrD P i beginning at bp 47 is a sequence which perfectly matches the consensus sequence of previously identified LexA protein binding sites (reviewed by Little and Mount, 1982), all of which consist of CTG followed 11 bp later by CAG in a 3-bp inverted repeat (Fig. 3). Further analysis of the sequence reveals two regions of dyad symmetry situated downstream of the LexA binding site which would permit the formation of stem-loop structures. The first, from bp 69 to bp 75, would result in a 7-bp stem with 8 5 ~ G-C pairing and a large ring of 12 bases. The second, from bp 75 to bp 79, would allow the formation of a shorter 5-bp stem with 100~o G-C pairing and a
HinclI.
Templates for sequencing were prepared as described (Sanger et al., 1980). Sequence analysis was aided by computer (Staden, 1982; Conrad and Mount, 1982).
RESULTS The sequence of the uvrD regulatory region was determined in both strands by sequencing clones generated by the "nonrandom" method of Poncz et al. (1982). Fig. 2 shows a 150-bp sequence numbered arbitrarily from an EcoRI * site. For simplicity, only the DNA strand coding for the uvrD gene is shown. Comparison of this sequence with the sequences of known promoters (reviewed by Hawley and McClure, 1983) reveals two potential promoters, designated uvrD PI and uvrD P2. For uvrD P~ the - 10 sequence, TATAAT (bp 33 to bp 38), is identical to the consensus sequence proposed by Rosenberg and Court (1979) and the - 3 5 sequence, T T G G C A (bp 11 to bp 16), differs by only one base from that of the consensus T T G a c a and is identical to the uvrB P~ - 35 sequence (Van den Berg et al., 1981; Sancar et al., 1982a). The - 3 5 sequence is preceded by the expected AT-rich region and the
-35 PI - 1 0 PI , LexA I 1 0 20 30 "40 I 50 60 I 70 AATTTCCCGGI~TGGCAITCTCTGACCT CGCTGA~ATAATICAGCAAATCTGTATATATACCCAGCTTTTTGGCGGAG "
"
m, AI "RN - ' ' ~ start
--
,,
-35 P2 -I0 P2 SD 80 90 100 110 120 13G 140 150 GGCG~-~-G~TTCTCCGCCCAACC~-~-~TACGCGGCGGTGCCAATGGACGTTTCTTACCTGCTCGACAGCCTT = 4 ~ ~A 2 MetAspValSerTyrLeuLeuAspSerLeu Terminator R start? Fig. 2. Sequenceof the ,~vrDcontrol region.The - 10 and - 35 sequencesfor uvrD Pt and uvrD P2 are enclosedby boxes. Someregions of dyad symmetryare depicted by facingarrows. The putative LexA protein binding site, terminator and ribosomebinding site (SD) are indicated. Vertical arrows indicate possible start points for transcription.The first 10 amino acids (includingf-Met) predicted by the nucleotidesequence are shown.
320 Sequence
Gene
~exA1
TGCTGTATATACTCACAGCA
Z_C.~ 2 recA uvr'~
AACTGTATATACACCCAGGG TACTGTATGAGCATACAGTA
olo13 coL~1 sulA rDaU-dnaG-rooD
TACTGTATATTCATTCAGGT AACTGTTTTTTTATCCAGTA TACTGTGTATATATACAGTA TGCTGTATATAAAACCAGTG TACTGTACATCCATACAGTA AGCTGGCGTTGATGCCAGCG
oonsenaus
taCTGtatat-cat-CAGta
uvrD
ATCTGTATATATACCCAGCT
uvrB
Fig. 3. Comparison of LexA protein binding sites. The LexA bindingsites for lex.A,recA, uvrA, uvrB,sulA and the rpsU-dnaGrpoD operon, and for the baeterioein genes clo13 and clel of plasmids CIoDFI3 and ColEI, respectively,are shown. Below them is a consensus sequence (taken from Little and Mount, 1982;Van den Elzenet al., 1982;Cole, 1983;Lupskiet al., 1983). At the bottom is the putative LexA binding site for the uvrD control region. smaller l 1-base loop (Fig. 4). Calculation of the secondary structure free energy (AG) (Tinoco et al., 1973) indicates that the structure with the 7-bp stem would be formed preferentially. Immediately downstream of this potential stem loop is a run of 5 T residues beginning at bp 102 which suggests that the structure may constitute a system for premature termination of transcription from P~. The - 3 5 sequence of P2 is contained within this putative terminator sequence. The - 10 sequence of P1 is at the centre of a region ofdyad symmetry in a region which has a nucleotide
(a)
.r.T_G..C"
(b) /C/13~C~T~T\
A---T G-C (i--C C-=fi -16-6Kcal
G--C fi-C bp69---] L-bp~
5
C
l
l
T, 7 T',.G~ C,,,C C--G G-- C
-12.2Kcal
G-C G-C bp75--j l~bp%
Fig.4. Structuresof two potential terminators in the uvrD control region.(a) Stem of 7 bp with 85% G-C pairing and a 12-bp loop; (b) stem of 5 bp with 100% G-C pairing and a 11-bp loop.
sequence with some similarity to that of the LexA binding site. A ribosome binding site G G C G G T (Steitz, 1979) beginning at bp 111 is followed by an ATG beginning at bp 121 and an open reading frame. The first 10 amino acids of the UvrD protein predicted by the sequence are presented (Fig. 2). The complete sequence of the uvrD gene will be published elsewhere (Finch, P. and Emmerson, P.T., in preparation).
DISCUSSION Sequence analysis of the operator-promoter region of the uvrD gene suggests that the gene may be transcribed from two promoters uvrD P1 and uvrD P2 and that a LexA protein binding site functions as an operator for Pl but not P2. In the presence of LexA protein, transcription from P1 would be expected to be repressed while that from P2 would be unaffected. The sequence of P~ matches very well with the consensus sequence derived from analysis of 168 promoter sequences (Hawley and McClure, 1983). Moreover, the location and sequences of most promoter mutations suggest that the consensus sequence corresponds to maximum function of the promoter (Hawley and McClure, 1983). Thus, PI could be expected to be an efficient promoter. On the other hand, the sequence of P2 does not match the consensus sequence as well as does PI and the P2 - 3 5 and - 10 sequences are separated by only 14 nucleotides. This spacing would be unusually low for a promoter, the optimal separation being approx. 17 (Hawley and McClure, 1983). It would be expected on the basis of this sequence analysis that transcription from Pf would occur much more frequently than any from P2 and this is supported by S1 nuclease mapping of RNA transcripts synthesised in vivo (Bramhill, D. and Emmerson, P.T., in preparation). Identification of a LexA-controlled operator in the uvrD control region explains the observation that fl-galactosidase synthesis is inducible by DNA damaging agents in strains eont0Jning Mud(Aprlac) fusions in the uvrD gene (Arthur and Eastlake, 1983; Siegel, personal communication). However, despite the apparently strong P~ promoter, the approx. 1.5-
321
fold induction (Arthur and Eastlake, 1983; Siegel, personal communication) is small when compared to that of other SOS genes (Kenyon and Walker, 1981 ; Fogliano and Schendel, 1981; Huisman and D'Ari, 1981), possibly because of termination of the P1 transcripts by the putative terminator downstream of the LexA protein binding site. Multiple copies of the uvrD gene sensitise a uvrD + host to UV (Oeda et al., 1981; Maples and Kushner, 1982) and a system for premature termination of transcription of uvrD may be part of the fine tuning control mechanism required to limit the level of UvrD protein. The mechanism for anti-termination, if any, is not clear. A computer search of the control region failed to reveal a sequence similar to the nut sites of phage lambda (Drahos and Szybalski, 1981; Ward and Gottesman, 1982) although an equivalent site occurs in the SOS inducible E. coli rpsU-dnaG-rpoD operon (Lupski et al., 1983). However, it may or may not be significant with respect to anti-termination that the sequence GGCGG, bp 69 to 73, which appears in the stem of the putative terminator (Fig. 4a), appears also in the Shine--Dalgarno sequence, bp 11 l t o 115. This suggests two possible means of disrupting the stem-loop terminator structure in the mRNA. Either ribosomes could bind to this site in the stem-loop of the mRNA and open it up, or the stem-loop structure could be disrupted by pairing of the CCGCC, bp 90 to bp94, with the Shine--Dalgarno sequence GGCGG, bp 111 to 115 to give an alternative stem loop in the mRNA. There is extensive homology between the LexAcontrolled operator of the uvrD gene and the second SOS box of lexA (Fig. 3). The homology continues upstream and the sequence between bp 29 and bp 41, which is in the approximate position of the first SOS box oflexA, is similar to a lexA binding site except that there are 3 bp less between the CTG and CAG sequences than in the consensus sequence. This suggests that the control regions of lexA and uvrD may have common ancestry. Sequence analysis of the operator-promoter region of the sulA gene (Cole, 1983) has revealed, in addition to a putative LexA binding site, extensive homology between a promoter-proximal region and the second SOS box of the lexA gene, also suggesting common ancestry. Sequence analysis suggests that control of the uvrD gene may be sophisticated. Further work will be required to elucidate the mechanisms involved and
to explain the apparently low extent of induction when measured by gene fusion techniques.
ACKNOWLEDGEMENTS
We thank Dr. R. Staden and Dr. D. Mount for the gift of their computer programmes, and Mr. M.D. Emmerson for local help with computing. We also thank Mrs. P. Heslop and Mr. C. Robson for technical help, and the Medical Research Council for financial support. P. Finch was supported by a SERC-CASE studentship.
REFERENCES Ahdel-Monem, M. and Hoffmann-Berling, H.: Enzymatic unwinding of DNA, I. Purification and characterization of a DNA-dependent ATPase from Escherichia coli. Eur. J. Biochem. 65 (1976a) 431-440. AbdeI-Monem, M., Durwald, H. and Hoffinann-Beriing, H.: Enzymatic unwinding of DNA, II. Chain separation by an ATP-dependent DNA unwinding enzyme. Eur, J. Biochem. 65 (1976b) 441-449. Abdel-Monem, M., Chanal, M.C. and Hoffmann-Berling, H.: DNA unwinding enzyme II of Escherichia coil, I. Purification and characterization ofthe ATPase activity. Eur. J. Biochem. 79 (1977a) 33-38. AbdeI-Monem, M., Durwaid, H. and Hoffmann-Berling, H.: DNA unwinding enzyme II ofE. coli, II. Characterization of the DNA unwinding activity. Eur. J. Biochem. 79 (1977b) 39--46. Arthur, H.M., Bramhill, D., Easflake, P.B. and Emmerson, P.T.: Cloning of the uvrD gene of E. coli and identification of the product. Gene 19 (1982) 285-295. Arthur, H.M. and Lloyd, R.G.: Hyper-recombination in uvrD mutants ofEscherichia coliK-12. Mol. Gen. Genet. 180 (1980) 185--191. Arthur, H.M. and Eastlake, P.B.: Transcriptional control of the uvrD gone of E. coll. Gene 25 (1983) 309-316. Bertrand, K.P., Pestle, K., Wray, L.V. and Reznikoff, W.S.: Overlapping divergent promoters control expression of Tnl0 tetracycline resistance. Gene 23 (1983) 149-156. Cohen, S.N., Chang, C.Y, and Hsu, L.: Nonchrom0somal antibiotic resistance in bacteria. Prec. Natl. Acad. Sci. USA 69 (1972) 2110-2114. Cole, S.T.: Characterisation of the promoter for the LexA regulated sulA gene of E. coli. Mol. Gen. Genet. 189 (1983) 400-404. Conrad, B. and Mount, D.W.: Microcomputer programs for DNA sequence analysis. Nucl. Acids Res. 10 (1982) 31-38.
322 DeBoer, H.A., Gilbert, S.F. and Nomura, M.: DNA sequences of promoter regions for rRNA operons rrnE and rrnA in E. coll. Cell 17 (1979) 201-209. Drahos, D. and Szybalski, W.: Antitermination and termination functions of the cloned nutL, N and tLI modules of coliphage lambda. Gene 16 (1981) 261-274. Fogliano, M. and Schendel, P.F.: Evidence for the inducibility of the uvrB operon. Nature 289 (1981) 196-198. Hanawalt, P.C., Cooper, P.K., Ganesan, A.K. and Smith, C.A.: DNA repair in bacteria and mammalian cells. Annu. Rev. Biochem. 48 (1979) 783-836. Hawley, D.K. and McClure, W.R.: Compilation and analysis of Escherichia coil promoter DNA sequences. Nucl. Acids Res. 11 (1983) 2237-2255. Hickson, I.D., Arthur, H.M., Bramhill, D. and Emmerson, P.T.: The E. coil uvrD product is DNA heliease II. Mol. Gen. Ganet. 190 (1983) 265-270. Horii, Z.-I. and Clark, A.J.: Genetic analysis ofthe recFpathway to genetic recombination in Escherichia coll. Isolation and characterization of mutants. J. Mol. Biol. 80 (1973) 327-344. Horiuchi, T. and Nagata, T.: Mutations affecting growth of the Escherichia coil cell under a condition of DNA polymerase I deficiency. Mol. Gen. Genet. 123 (1973) 89-110. Howard-Flanders, P. and Bardw¢ll, E.: Effects of recB21, reeF143 and uvrD152 on recombination in lambda baeteriophage-prophage and Hfr by F - crosses. J. Bacteriol. 148 (1981) 739-743. Huisman, O. and D'Ari, R.: An inducible DNA replication-cell division coupling mechanism in E. cog. Nature 290 (1981) 797-799. Kenyon, C.J. and Walker, G.C.: Expression of the E. cog uvrA gene is inducible. Nature 289 (1981) 808-810. KQmmerle, N.B. and Masker, W.E.: Effect &the uvrD mutation on excision repair. J. Baeteriol. 142 (1980) 535-546. Little, J.W. and Mount, D.W.: The SOS regulatory system of E. coil Cell 29 (1982) 11-22. Lundblad, V. and Kleckner, N.: Mutants ofE. coli K-12 which affect excision of transposon Tnl0, in Lemontt, J.F. and Generoso, W.M. (Eds.), Molecular and Cellular Mechanisms of Mutagenesis. Plenum, New York, 1982, pp. 245-258. Lupski, J.R., Smiley, B.L. and Godson, G.N.: Regulation of rpsU-dnaG-rpoD macromolecular synthesis operon and the initiation of DNA replication in E. coli K-12. Mol. Gen. Genet. 189 (1983) 48-57. Maples, V.F. and Kushner, S.R.: DNA repair in Escherichia cog: Identification of the uvrD gen¢ product. Prec. Natl. Acad. Sci. USA 79 (1982) 5616-5620. McDonnell, M.W., Simon, M.N. and Studier, F.W.: Analysis of restriction fragments of T7 DNA and determination of molecular weights by electrophoresis in neutral and alkaline gels. J. Mol. Biol. 110 (1977) 119-146. Messing, J., Crea, R. and Seeburg, P.H.: A system for shotgun DNA sequencing. Nucl. Acids Res. 9 (1981) 309-321. Messing, J. and Vieira, J.: A new pair of M 13 vectors for selecting either DNA strand of double digest restriction fragments. Gene 19 (1982) 269-276. Murray, N.E., Bruce, S. and Murray, K.: Molecular cloning of
the DNA ligase gene from T4, ll. Expression of the gene and purification of its product. J. Mol. Biol. 132 (1979) 493-505. Oeda, K., Horiuchi, T. and Sekiguchi, M.: The uvrD gene of E. cog encodes a DNA-depandent ATPase. Nature 298 (1982) 98-100. Pannekoek, H., Noordermeer, I.A., Van Sluis, C.A. and Van de Putte, P.: Expression of the uvrB gene of E. coil: in vitro construction ofpMB9 uvrB plasmid. J. Bacteriol. 133 (1978) 884-896. Poncz, M., Solowiejczyk, D., Ballantine, M., Schwartz, E. and Surrey, S.: "Nonrandom" DNA sequence analysis in bacteriophage MI3 by the dideoxy chain termination method. Prec. Natl. Acad. Sci. USA 79 (1982) 4298-4302. Rosenberg, M. and Court, D.: Regulatory sequences involved in the promotion and termination of RNA transcription. Annu. Rev. Genet. 13 (1979) 319-353. Rothman, R.H. and Clark, A.J.: Defective excision and postreplication repair of UV-damaged DNA in a reel strain of E. cog K-12. Mol. Gen. Genet. 155 (1977) 26%277. Sancar, A., Wharton, R.P., Seltzer, S., Kacinski, B.M., Clarke, N.D. and Rupp, W.D.: Identification of the uvrA gene product. J. Mol. Biol. 148 (1981a) 45-62. Sancar, A., Clarke, N.D., Griswold, J., Kennedy, W.J. and Rupp, W.D.: Identification of the uvrB gene product. J. Mol. Biol. 148 (1981b) 63-76. Sancar, A., Kacinski, B.M., Mott, D.L. and Rupp, W.D.: Identification of the uvrC gen¢ product. Prec. Natl. Acad. Sci. USA 78 (1981c) 5450--5454. Sancar, G.B., Sancar, A., Little, J.W. and Rupp, W.D.: The uvrB gene of E. coil has both lexA repressed and lexA independent promoters. Cell 28 (1982a) 523-530. Sancar, A., Sanear, G.B., Rupp, W.D., Little, J.W. and Mount, D.W.: LexA protein inhibits transcription of the E. coli uvrA gane in vitro. Nature 289 (1982b) 96--98. Sanger, F., Coulson, A.R., Barrell, B.G., Smith, A.J.H. and Roe, B.A.: Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J. Mol. Biol. 143 (1980) 161-178. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. Prec. Natl. Aead. Sci. USA 74 (1977) 5463-5467. Siegel, E.C.: Ultraviolet-sensitive mutator strain of Escherichia coil K-12. J. Bacteriol. 113 (1973a) 145-160. Siegel, E.C.: Ultraviolet-sensitive mutator mutU4 of Escherichia coil inviable with polA. J. Baeteriol. 113 (1973b) 161-166. Smirnov, G.B., Filkova, E.V. and Skavronskaya, A.G.: The mutator property ofuvr-502 mutation affecting UV-sensitivity of Escherichia coil Mol. Gen. Ganet. 118 (1972) 51-66. Smirnov, G.B., Filkova, E.V. and Skavronskaya, A.G.: Loss and restoration of viability of E. cog due to combinations of mutations affecting DNA polymerase I and repair activities. Mol. Gen. Genet. 121 (1973) 139-150. Staden, R.: Automation of the computer handling of gel reading data produced by the shotgun method of DNA sequencing. Nucl. Acids Res. 10 (1982) 4731--4751. Steitz, J.A.: RNA-RNA interactions during polypeptide chain initiation, in Chambliss, G., Craven, G.R:, Davies, J., Kahan, L. and Nomura, M. (Eds.), Ribosomes, Unive.rsity Park
323
Press, Baltimore, 1979, pp. 349-399. Tinoco, I., Borer, P.N., Dengler, B., Levine, M.D., Uhlenbeck, O.C., Crothers, D.M. and Gralla, J.: Improved estimation of secondary structure in ribonucleic acids. Nature 246 (1973) 40-41. Van den Berg, E., Zwetsloot, J., Noordermeer, I., Pannekoek, H., Dekker, B., Dijkema, R. and Van Ormondt, H.: The structure and function of the regulatory elements of the Escherichia coli uvrB gene. Nucl. Acids Res. 9 (1981) 5623-5643. Van den Elzen, P.J.M., Maat, J., Waiters, H.H.B., Veltkamp, E. and Nijkamp, H.J.J.: The nucleotide sequence of the bac-
teriocin promoters of plasmids CloDF13 and ColE l: role of LexA represser and cAMP in the regulation of promoter activity. Nucl. Acids Res. 10 (1982) 1913-1928. Van Sluis, C.A., Mattern, I.E. and Patterson, M.C.: Properties ofEscherichia coli K-12, I. Effects of UV-irradiation on DNA metabolism. Mutation Res. 25 (1974)273-279. Ward, D.F. and Gottesman, M.E.: Suppression oftranscription termination by phage lambda. Science 216 (1982) 946-951.
Communicated by R.W. Davies.