- Email: [email protected]
Nucleotide sequence of the thermostable direct hemolysin gene (tdh gene) of Vibrio mimicus and its evolutionary relationship with the tdh genes of Vibrio parahaemolyticus
FEMS MicrobiologyLetters 71 (1990) 319-324 Published by Elsevier
319
FEMSLE 04156
Nucleotide sequence of the thermostable direct hemolysin gene ( tdh gene) of Vibrio mimicus and its evolutionary relationship with the tdh genes of Vibrio parahaemolyticus A k i t o Terai 2, H i r o m a s a Shirai ~, O s a m u Y o s h i d a " Y o s h i f u m i T a k e d a 1 and Mitsuaki Nishibuchi 1 i Department o/Microbiolog):and ' Department of UroloD'. Facultyo~Medicine. Kyoto University. Kyoto,Japan Received25 April 1990 Revisionreceived15 May 1990 Accepted29 May 1990 Key words: Thermostable direct hemolysin gene; Vibrio
1. S U M M A R Y
2. I N T R O D U C T I O N
The gene encoding a hemolysin similar to the thermostable direct hemolysin (TDH) of Vibrio ,~arahaemolyticus was previously cloned from the chromosome of Vibrio mimicus. The nucleotide sequence of the hemolysin gene was determined in this study. The gene proved to be a variant of the thermostable direct hemolysin gene (tdh gene) and was designated as Vm-tdh because the sequence divergences between the Vm-tdh gene and four tdh genes of V. parahaemolyticus were 2.1-3.0%, while the sequence divergences among the four tdh genes of V. parahaemolyticus ranged between 1.4 and 3.3%. Analysis of these five tdh genes revealed that they evolved from a common ancestor in discrete and understandable order by sporadic base substitutions.
Vibrio parahaemolyticus is an important pathogen of seafood-borne gastroenteritis It]. The thermostable direct hemolysin (TDH) produced by this organism has been considered the major virulence factor although its pathogenic role is still not clearly understood [2]. The gene encoding T D H (tdh gene) has been studied recently. Four tdh gene copies were cloned from strains of V. parahaemolyticus and nucleotide sequence analysis revealed 1.4-3.3% sequence divergence among these gene copies [3,4]. Among other vibrios implicated as causes of gastroenteritis, some strains of V. cholerae non-01 [5,6], V. hollisae [7,8], and V. mimicus [9] were found to produce hemolysins with similar characteristics to those of TDH. The D N A colony hybridization test with a probe specific for the tdh gene revealed that the genes in these strains have homologous nucleotide sequences to that of the tdh gene [10-12]. The genes encoding these hemolysins were cloned [11,12], and compared with the tdh genes of V. parahaemolyticus by physical mapping and hy-
Correspondence to: Mitsuaki Nishibuchi, Department of Microbiology. Faculty of Medicine. Kyoto University, Sakyo-ku, Kyoto 606, Japan.
0378-1097/90/$03.50 © 1990 Federation of European MicrobiologicalSocieties
320 bridization with oligodeoxyribonucleotide probes [12]. All the cloned hemolysin genes appeared to have only minor sequence variations in their coding regions but dissimilar flanking regions [12]. In this study we determine the nucleotide sequence of the hemolysin gene cloned from V. mimicus. Because the hemolysin gene showed only 2.1-3.0% sequence divergence from the four tdhgene copies sequenced previously, we designate it as a variant of the tdh gene. We also propose a scheme for the evolutionary relationship of the five tdh genes deduced from their nucleotide sequences.
3. MATERIALS A N D METHODS
3.1. Bacterial strains and plasmids Escherichia coil HB101, originally obtained from S. Falkow, was used as a host for propagation of plasmids pCVD546, pBIK4, pKTN401, and pKTN402. E. coil MVl184 [13] v;.,s used for preparing single-stranded D N A from the derivatives of pKTN401 and pKTN402. pBIK4 was described previously [12]. Plasmids pKTN401 and pKTN402 were constructed in this study as described below. 3.2. Preparation of plasmid DNA Plasmid D N A was isolated by the rapid alkaline extraction method of Birnboim and Doly [14] and purified by CsCl-ethidium bromide equilibrium density gradient centrifugation. 3.3. Nucleotide sequence determination For determination of the nucleotide sequence of the 1.7 kb tdh probe-positive HindIII.Bglll fragment originally cloned from 11. mimicus 6 [12], this fragment was subcloned into p U C l l S , pBIK4
contained this 1.7 kb fragment cloned into the HindIII-BamHI site of pBR322 [12]. The Bglll (insert)/BamHI(pBR322) ligation site of pBIK4 could not be recur with Bglll or BamHL so a 2.0 kb HindIII-SalI fragment of pBIK4, which contained an extra 0.3 kb BamHI-Sall sequence from pBR322, in addition to the 1.7 kb HindIII-BglII insert fragment, was isolated, its ends were repaired and it was cloned into the Smal site of pUC118 in both orientations, resulting in the recombinant plasmids pKTN401 and pKTN402. Various derivatives of pKTN401 and pKTN402 were prepared by introducing deletions within the 2.0 kb HindIII.Sall region by the method of Henikoff [15] and were introduced into E. coil MVl184 by transformation. Single-stranded D N A was then prepared by the method of Vieira and Messing [13]. D N A sequences were determined by the dideoxy chain termination method as described by Mizusawa et al. [16].
4. RESULTS A N D DISCUSSION The nucleotide sequence of the 1.7 kb tdh probe-positive HindlII-BgllI fragment originally cloned from V. mimicus 6 [12] was determined. Search of the sequence for homology with the nucleotide ~quence of the tdh gene of V. parahaemolyticus (first reported by Nishibuchi and Kaper [3] and now named the Vp-tdhl gene) revealed that the hemolysin gene of V. mimicus possessed an open reading frame composed of 567 base pairs, which was the same size as that of the Vp-tdhl gene of V. parahaemolyticus (Fig. 1). The nucleotide sequence homology between these two coding sequences was 97.9~, so we concluded that the hemolysin gene of V. mimicus can be designated as the tdh gene (here designated as the
Fig. 1. Comparison of nucleotidesequencesof tdh genesof V. mimicus and It, parahaemolyticus.The nucleotidesequenceof the tdh gene of V. mimicus (Vm.tdh) was determined in thi~ study. The nucleotide sequences of the tdh genes of V. parahaemolyticus (Vp-tdhl, Vp-tdh2, Vp-tdh3, and Vp-tdh4) were reported previously[3,4]. These genes were originallydesignated as tdhl, tdh2. tdh3, and tdh4, respectively.The sequences flanking the coding regions of Vp-tdhl, -tdh2, -tdh3, and -tdh4 not reported in refs. 3 and 4 were determined in a previous study (Baba ©t aL, manuscript in preparation). Sequences showing homology with the consensus sequences of E. coli such as the Shine-Dalgarnosequence (SD) and -35 and -10 regions (-35 and -10) of the promoter are indicated by dots above the underlined sequences. An inverted repeat, a possible transcription terminator, is also indicated by an underline. * Missing base. Other symbols(ll, v, ~, o) arc explained in the text.
321
5~, Vm-td_._hh Vp-tdh
T&AGCACT&TCAAAGaTTTG I
....
T--C-C
.....
*GGAGGTGTTTTTTT
G ....
A-A-k-CA
-35
-~
OC&TGATTATTCAGT~CTTTTT~GTTTTTTTTAGGTTTCATGACGTCTGC
.....
e*
'--CA
. . . . . . . . . . . . . . . .
C--T-°
e ........
- 2 A - - - - -2- - - ' ' ;' . - 2' - - ' 'T - - -A - - - - - - - - - k~ ' A
T ......
-'-'----------'-22---
C~
Vp-t~_~4
...................
C&A--A--A
v . to~
:; ,~o so.. 0A__,T0 .......................................
Vp-tdhl vp-t-'~2 Vp-t--d~3 Vp-t_~_4
........................ ........................ ........................ . . . . . . . . . . . . . . . . . . . . . . . . . .
Vn-td_..~h Vp-tdhl
TTT ATA TCC ATG TTG GCT GCA ...............................
Vp-t-'~2 Vp-tdh3 Vp-t~_4
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Vm-tdh Vp-tdhl
CCC GGT TCT GAT GAG ATA TTG TTT GTT GTT CGA ...................................................
vp-t-~2 Vp-tdh3 Vp-t--~[~4
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
VM-td_~h Vp-tdhl V p - t-'~2
GTa AAG GTC TCT GAC TTT TGG .............................. --- G ..........................
Vp-tdh3 Vp-t~4
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Vm-td_hh
CAA
Vp-td~l Vp- t--~ 2
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
......
GG "--222-.2G
A--A--C-T
V p - t--4"~ t--~2 3
"* .......................
T-GA ........
C 222-2222
~AC_ - 2 2 - -
C ........
AAC ....
,~,
X~mo 0~ . . . . . . .
T .... ° ........ T- --G ......... T---G ......... T. . . . .G . . . . .
• T • "
. . . .
. . . .
. . . .
. . . .
. . C. . . . . . . . . G . . . . G. . . . . G . . . . G. . . . . G . . . .- G. - . . .
0oA A ' ~ . . . .
. . . . . . . .
. . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . .
0. . . . . . .
. . . . . . . .
. . . . . . . . . . . . . . . . . . .
20O
TCA
GTA
TTC
ACA
ACG
TTC
mmk
ACA
TCA
ACA
AAC
GGT
T ~ T G C ~ T~TT C A G C T T C C A T C T G T C C .................................. c C C
CGT
GAT
~CA
ACT
TTT
AAT
ACC
TTT
CCT
GCC
~A~ GC~ CCG GTC C .............. T T T
--a --k --A
AAT
. . . . . . . . . . . . . . . . . . . . . . . . . . .
~mT GTA AAA AGA AAA CCG TAC ~aa °AT GTT TAT a ................................... m .................... A .............. m. . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . . . . . . . . . .
mC~
CCT
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
AAA
TGG
~TG
AAA
G4~AC T A T
GGT
A. . . . . . . . . . . . . . k . . . . . . . . . . . . . .
ACA
ATG
°CA
GCG
GTG
TCT
°GC
Vp-t--d~3
Vp-tdh4
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
,~o ACA
Vp-tdhl Vp-t~_2 Vp-t4h3 Vp-tdh4
. . . .
Vm-td~h Vp-tdhl
°IT
vp-t-a~2
-G~ ~2~ -22 22_A 22~ -2~ 22~ 2-~ 2-2 G22 ~22 ........... . ~. . ..... ........... ......... .. ...... . . . . . . . . . . . .
Vp-tah3
......................................
T
............
Vp-t--~4
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
T
. . . . . . . . . . . . . . . . . . . . . . . . . . .
Vm-tdh Vp-tdhl
ATT CCA AGT AAA ATG TAT TTG GAT GAA ACT CCA GAA TAT TTT GTT ~AT GTA GAA °CA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
V p - t-'d~2
..............................................................
Vp-tdh3
. . . .
. . . .
TCC . . . .
. . . .
. . . .
CAA
TAC . . . .
. . . .
. . . .
. . . .
ATG . . . .
GTA
. . . . . . . .
CA~
vp-t_~
"
-"
-''-"
Vm-tdh
GGT
AGT
GGT
Vp-tdhl Vp-~2 Vp-t4h3 Vp-t--~4
. . . . . . . . . . . .
ACT . . . . . . . .
GTG
. . . . . . . .
. . . . . . . .
CTT
AAC
. . . . . . . .
CAA
ATT
on ao
Vu-tdh
AAT
GAT
TAT
AAG
AGC
GGT
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CA . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . A.
CAT
TCC
TAT
~AT
TCT
GTA
. . . .
. . . .
GC~
. . . .
CAT . . . .
. . . .
mac
. . . .
. . . .
TCT . . . .
TTT
. . . .
GCT
. . . .
. . . .
. . . .
GTT
GTG
. . . . . . . . . . . . . . . .
GGT
TTC
. . . . . . . . . . . . . . . .
~AA
............
. . . . . . . . . . . . . . . . . . . . . . . .
~v~
i
TAm
TCA
OAT
GAA
GIT TCT G ....
A ..............
TAT
GAlA AGT G ---
G
---
o
•
GAA
CAT
CAm
0....................
~o ~TA a . m. A. m.
AAA
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
-" AAT
GTA
. . . . . . . . . . . . . . . . . . . . . . .
. . . .
TTG . . . .
. . . .
. . . .
GTA . . . .
. . . .
. . . .
. . . .
ATG . . . .
. . . .
Transcription
. . . .
TGT . . . .
. . . .
. . . .
. . . .
ATA . . . .
. . . .
. . . .
TCC . . . .
. . . .
. . . .
mAC . . . .
. . . .
. . . .
. . . .
AAA . . . .
. . . .
. . . .
GAA . . . .
. . . .
. . . .
. . . .
TCG . . . .
. . . .
. . . .
TTT . . . .
. . . .
. . . .
. . . .
TTT . . . .
. . . .
. . . .
GAA
TGT
. m. . . . . . . . . A. . . . . . . . . . . . . . . . . . . m-T. . . . .
terminator
~A-~ee-e~GT~A~GCC~C~G~T~TTCTGTGG~TT''~-TG~A~TA~TT~T~T~TT~eTCTG~T~TG~TGTCA
Vm-~:d._._~h
CGA
V p - t-d-h l Vp-tdn2 V p - t--~3 Vp-tdh4__
-A ...... -A ...... AA ...... AAT _ ....
* e e * ~ . . m - - - -~-. . . . . . . . . . . . . . . . . . . . . . ~ ...................... • . . . . . . . . . . . . . . . . .A *~*e~*~A ................................... G .............. "'--A ........... T-~TAAAAA .................................... G .............. AT--A ........... T-* * e e e e * . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .A. . . . . . .G. . . . . . . . . . . . . . . . .A.A.T. A T
322 Vm-tdhh
Vm-tdh gene) and the hemolysin encoded by the Vm-tdh gene can be named T D H (here designated as Vm-TDH). By analogy with the tdh gene of V. parahaemoly~'icus, the Vm-tdh gene is predicted to encode the precursor form of Vm-TDH, which is predicted to be a 189-amino-acid polypeptide with a deduced molecular mass of 21512. Assuming that Vm-TDH, like T D H of V. parahaemolyticus, has a signal peptide of 24 amino acid residues, the mature form of Vm-TDH is predicted to be a 165-amino-acid polypeptide with a molecular mass of 18648. Putative promoter and ribosome binding (Shine-Dalgarno) sequences and an inverted repeat sequence, which is a possible transcription terminator of the Vm-tdh gene, are indicated in Fig. 1. Fig. 1 also compares the Vm-tdh gene with the three other tdh gene copies of V. parahaemolyticus reported previously [4] (herein designated as Vptdh2, -tdh3, and -tdh4). Within the coding regions of the five tdh genes (bases 127-693), there were 29 sites where the bases of all five genes are not identical (indicated by ll, • or v in Fig. 1). Evidently the five tdh genes were derived from a common ancestor and evolved by base changes and small insertions/deletions. From comparative analysis of the nucleotide sequence differences described below, we propose that the evolutionary relationships of the five genes are as shown schematically in Fig. 2. A similarity matrix constructed from the nucleotide sequence homologies of the coding regions suggested that Vp-tdh2, -tdh3, and -tdh4 belong to a highly homologous group (Table 1). In fact, comparison of the Vp-tdh2, -tdh3, and -tdh4 coding sequences revealed that the three gene se-
B a ~ ' ~ A
~
vp - tcl_._hhI
/ vp -
C
~
td_h2h
Vo-tdh3
Vp-~4 Fig. 2. Hypothetical evolutionaryrelationship of Vm-tdh. VptdhL Vp-tdh2, Vp-tdh3, and Vp-tdh4. For details, see text. quences differed in 12 sites (indicated by • in Fig. 1) but that each of the three genes had sporadic base changes at 4 sites where the the other two genes shared a common base. This means that the Vp-tdh2, -tdh3, and -tdh4 genes are evolutionally very close. Next, the coding sequences of the Vm.tdh and Vp-tdhl genes were compared with those of the Vp-tdh2-tdh3-tdh4 group. Base substitutions unique to Vm-tdh or Vp-tdhl were recognized at 10 sites (indicated by • in Fig. 1) and base substitutions that could cluster the Vm-tdh and Vptdhl genes as a group distinct from the Vp-tdh2tdh3-tdh4 group were present at 7 sites (indicated by v in Fig. 1). This finding suggested that a putative ancestor of the five tdh genes diverged into two types of offspring (point A in Fig. 2) and then each of these two offsprings diverged further into other types of offspring (points B and C in Fig. 2). Probably the 7 base substitutions (v) accumulated after point A and before points B and C, and the 10 base substitutions (v) accumulated after point B. The patterns of base substitutions are somewhat complex at 5 sites (indi-
Table 1 Comparison of nucleotidesequencesof various tdh genes Percent homologieswithin the coding regions(567 bp) of the tdh genesare indicated. Numerals in parentheses denote the number of bases that differ in pairs of tdh genes, Vm-tdh Vp-tdhl Vp-tdh2 Vp-tdh3 Vp-tdh4
Vm-tdh
Vp.tdhl
Vp-tdh2
Vp-tdh3
Vp-tdh4
97.9 (12) 97.0 (17) 97.4 (15) 97.0 (17)
97.0 (17) 96.7 (19) 96.7 (19)
98.6 (8) 98,6 (8)
98,6 (8)
-
323 cated by o superimposed on ll in Fig. 1). At 3 sites (bases 463, 464, and 691), one of the Vp-tdh 2, -tdh3, and -tdh4 genes may have acquired the s a m e type o f base mutation after point C as that which oeeurred between point A and point B. At 2 sites (bases 621 and 682), the same type of base mutation, which ? , o b a b l y is a transition from A to G, may have occurred independently after point B and after point C. The p r o p o s e d evolutionary relationships are mainly based on the observed base substitutions in the coding regions. Systematic analysis with more sequence data of the tdh and related genes in not only the coding regions but also in surrounding regions should provide support for our hypothesis. Studies on these sequences are in progress. Vm-tdh is present in the c h r o m o s o m e of a strain of V. mimicus [121. Both Vp-tdhl and Vptdh2 are present in the c h r o m o s o m e o f a strain o f V. parahaemolyticus [4]. A n o t h e r strain of V. parahaemolyticus contains Vp-tdh3 in the chrom o s o m e a n d Vp-tdh4 on a plasmid [4]. If the above hypothesis is correct, Vm-tdh and Vp-tdhl m a y have begun to diverge w h e n the ancestral tdh gene was transferred between V. mimicus and V. parahaemolyticus. Vp-tdh2, Vp-tdh3, and Vp-tdh4 might also have diverged as a result of transfer to different organisms or between different replicons ( c h r o m o s o m e and plasmid). It is interesting that two evolutionally distinct tdh genes such as Vptdhl and Vp-tdh2 coexist in the same organism. T h e tdh gene previously suggested to be present o n a mobile genetic element because the coding regions o f tdh genes have lower G + C contents t h a n the average G + C c o n t e n t of the total D N A o f V. parahaemolyticus [ 3 , 4 1 7 ~. and because s o m e strains of V. parahaemolyticus lose the tdh gene spontaneously [3,18]. The present data support this hypothesis. ~tudies on the nucleotide sequences flanking the tdh genes may clarify this mechanism.
ACKNOWLEDGEMENTS This work was s u p p o r t e d in part by a Grant-inAid for Scientific Research from the Ministry of
Education, Science and Culture of Japan a n d by grants from Suzuken Memorial F o u n d a t i o n , U e h a r a Memorial F o u n d a t i o n , and O h y a m a Health F o u n d a t i o n .
REFERENCES [I l Blake, P.A., Weaver, R.E. and Holhs, D.G. (1980) Ann. Rev. Microbiol. 34, 341-367. [2] Takeda, Y. (1983) Pharmacol. Ther. 19,123-146. 13l Nishibuchi. M.. and Kaper, J.B. (1985) J. Bacteriol. 162,
558-564. [41 Nishibuchi, M., and Kaper. J.B. (1990) Mol. Microbiol. 4. 87-99. [51 Yoh, M., Honda, T. and Miwatani. T. (1985) FEMS Microbiol. Lett. 29. 197-200. 161 Yoh. M.. Honda, T. and Miwatani, T. (1986) Infect. lmmun. 52, 319-322. [7] Yoh. M., Honda, T. and Miwatani. T. (1986) Can. J. Microbiol. 32. 632-636. [81 Nishibuchi, M., Doke, S., Toizumi. S., Umeda, T.. Yoh. M. and Miwatani, T. (1988) Appl. Environ. Microbiol. 54, 2144-2146. [91 Honda, T. and Miwatani, T. (1988) in Advances in Research on Cholera and Related Diarrheas, 6 (Ohtomo, N. and R.B. Sack. eds.), pp. 23-32. KTK Seientifie Publishers, Tokyo. [10] Nishibuchi. M., lshibashi, M., Takeda, Y. and Kaper, J.B. (1985) Infect. lmmun. 49, 481-486. [111 Hond~ T., Nishibuchi, M.. Miwatani, T. and Kaper, J.B. (1986) Appl. Environ. Microbiol. 52,1218-1220. [12] Nishibuchi. M., Khaeomanee-iam, V., Honda, T,, Kaper, J.B. and Miwatani. T. (1990) FEMS Microbiol. Lett. 67, 251-256. [13] Vieira` J. and Messing, J. (1'387) Methods Enzymol. 153, 3-11. [14] Birnboim, H.C. and Doly. J. (1979) Nucleic Acids Res. 7, 1513-1523. [15] Henikoff, S. (1984) Gene 28, 351-359. [16] Mizusawa. S., Nishimura` S. and Seela` F. (1986) Nucleic Acids Res. 14, 1319-1324. [17] Taniguchi, H., Hirano, H., Kubomura, S.. Higashi, K. and Mizuguchi, Y. (1986) Microb. Pathogen. 1,425-432. [18] Taniguchi, H., Ohta, H., Ogawa, M. and Mizuguchi, Y. (1985) J. Bacteriol. 162. 510-515.
319
FEMSLE 04156
Nucleotide sequence of the thermostable direct hemolysin gene ( tdh gene) of Vibrio mimicus and its evolutionary relationship with the tdh genes of Vibrio parahaemolyticus A k i t o Terai 2, H i r o m a s a Shirai ~, O s a m u Y o s h i d a " Y o s h i f u m i T a k e d a 1 and Mitsuaki Nishibuchi 1 i Department o/Microbiolog):and ' Department of UroloD'. Facultyo~Medicine. Kyoto University. Kyoto,Japan Received25 April 1990 Revisionreceived15 May 1990 Accepted29 May 1990 Key words: Thermostable direct hemolysin gene; Vibrio
1. S U M M A R Y
2. I N T R O D U C T I O N
The gene encoding a hemolysin similar to the thermostable direct hemolysin (TDH) of Vibrio ,~arahaemolyticus was previously cloned from the chromosome of Vibrio mimicus. The nucleotide sequence of the hemolysin gene was determined in this study. The gene proved to be a variant of the thermostable direct hemolysin gene (tdh gene) and was designated as Vm-tdh because the sequence divergences between the Vm-tdh gene and four tdh genes of V. parahaemolyticus were 2.1-3.0%, while the sequence divergences among the four tdh genes of V. parahaemolyticus ranged between 1.4 and 3.3%. Analysis of these five tdh genes revealed that they evolved from a common ancestor in discrete and understandable order by sporadic base substitutions.
Vibrio parahaemolyticus is an important pathogen of seafood-borne gastroenteritis It]. The thermostable direct hemolysin (TDH) produced by this organism has been considered the major virulence factor although its pathogenic role is still not clearly understood [2]. The gene encoding T D H (tdh gene) has been studied recently. Four tdh gene copies were cloned from strains of V. parahaemolyticus and nucleotide sequence analysis revealed 1.4-3.3% sequence divergence among these gene copies [3,4]. Among other vibrios implicated as causes of gastroenteritis, some strains of V. cholerae non-01 [5,6], V. hollisae [7,8], and V. mimicus [9] were found to produce hemolysins with similar characteristics to those of TDH. The D N A colony hybridization test with a probe specific for the tdh gene revealed that the genes in these strains have homologous nucleotide sequences to that of the tdh gene [10-12]. The genes encoding these hemolysins were cloned [11,12], and compared with the tdh genes of V. parahaemolyticus by physical mapping and hy-
Correspondence to: Mitsuaki Nishibuchi, Department of Microbiology. Faculty of Medicine. Kyoto University, Sakyo-ku, Kyoto 606, Japan.
0378-1097/90/$03.50 © 1990 Federation of European MicrobiologicalSocieties
320 bridization with oligodeoxyribonucleotide probes [12]. All the cloned hemolysin genes appeared to have only minor sequence variations in their coding regions but dissimilar flanking regions [12]. In this study we determine the nucleotide sequence of the hemolysin gene cloned from V. mimicus. Because the hemolysin gene showed only 2.1-3.0% sequence divergence from the four tdhgene copies sequenced previously, we designate it as a variant of the tdh gene. We also propose a scheme for the evolutionary relationship of the five tdh genes deduced from their nucleotide sequences.
3. MATERIALS A N D METHODS
3.1. Bacterial strains and plasmids Escherichia coil HB101, originally obtained from S. Falkow, was used as a host for propagation of plasmids pCVD546, pBIK4, pKTN401, and pKTN402. E. coil MVl184 [13] v;.,s used for preparing single-stranded D N A from the derivatives of pKTN401 and pKTN402. pBIK4 was described previously [12]. Plasmids pKTN401 and pKTN402 were constructed in this study as described below. 3.2. Preparation of plasmid DNA Plasmid D N A was isolated by the rapid alkaline extraction method of Birnboim and Doly [14] and purified by CsCl-ethidium bromide equilibrium density gradient centrifugation. 3.3. Nucleotide sequence determination For determination of the nucleotide sequence of the 1.7 kb tdh probe-positive HindIII.Bglll fragment originally cloned from 11. mimicus 6 [12], this fragment was subcloned into p U C l l S , pBIK4
contained this 1.7 kb fragment cloned into the HindIII-BamHI site of pBR322 [12]. The Bglll (insert)/BamHI(pBR322) ligation site of pBIK4 could not be recur with Bglll or BamHL so a 2.0 kb HindIII-SalI fragment of pBIK4, which contained an extra 0.3 kb BamHI-Sall sequence from pBR322, in addition to the 1.7 kb HindIII-BglII insert fragment, was isolated, its ends were repaired and it was cloned into the Smal site of pUC118 in both orientations, resulting in the recombinant plasmids pKTN401 and pKTN402. Various derivatives of pKTN401 and pKTN402 were prepared by introducing deletions within the 2.0 kb HindIII.Sall region by the method of Henikoff [15] and were introduced into E. coil MVl184 by transformation. Single-stranded D N A was then prepared by the method of Vieira and Messing [13]. D N A sequences were determined by the dideoxy chain termination method as described by Mizusawa et al. [16].
4. RESULTS A N D DISCUSSION The nucleotide sequence of the 1.7 kb tdh probe-positive HindlII-BgllI fragment originally cloned from V. mimicus 6 [12] was determined. Search of the sequence for homology with the nucleotide ~quence of the tdh gene of V. parahaemolyticus (first reported by Nishibuchi and Kaper [3] and now named the Vp-tdhl gene) revealed that the hemolysin gene of V. mimicus possessed an open reading frame composed of 567 base pairs, which was the same size as that of the Vp-tdhl gene of V. parahaemolyticus (Fig. 1). The nucleotide sequence homology between these two coding sequences was 97.9~, so we concluded that the hemolysin gene of V. mimicus can be designated as the tdh gene (here designated as the
Fig. 1. Comparison of nucleotidesequencesof tdh genesof V. mimicus and It, parahaemolyticus.The nucleotidesequenceof the tdh gene of V. mimicus (Vm.tdh) was determined in thi~ study. The nucleotide sequences of the tdh genes of V. parahaemolyticus (Vp-tdhl, Vp-tdh2, Vp-tdh3, and Vp-tdh4) were reported previously[3,4]. These genes were originallydesignated as tdhl, tdh2. tdh3, and tdh4, respectively.The sequences flanking the coding regions of Vp-tdhl, -tdh2, -tdh3, and -tdh4 not reported in refs. 3 and 4 were determined in a previous study (Baba ©t aL, manuscript in preparation). Sequences showing homology with the consensus sequences of E. coli such as the Shine-Dalgarnosequence (SD) and -35 and -10 regions (-35 and -10) of the promoter are indicated by dots above the underlined sequences. An inverted repeat, a possible transcription terminator, is also indicated by an underline. * Missing base. Other symbols(ll, v, ~, o) arc explained in the text.
321
5~, Vm-td_._hh Vp-tdh
T&AGCACT&TCAAAGaTTTG I
....
T--C-C
.....
*GGAGGTGTTTTTTT
G ....
A-A-k-CA
-35
-~
OC&TGATTATTCAGT~CTTTTT~GTTTTTTTTAGGTTTCATGACGTCTGC
.....
e*
'--CA
. . . . . . . . . . . . . . . .
C--T-°
e ........
- 2 A - - - - -2- - - ' ' ;' . - 2' - - ' 'T - - -A - - - - - - - - - k~ ' A
T ......
-'-'----------'-22---
C~
Vp-t~_~4
...................
C&A--A--A
v . to~
:; ,~o so.. 0A__,T0 .......................................
Vp-tdhl vp-t-'~2 Vp-t--d~3 Vp-t_~_4
........................ ........................ ........................ . . . . . . . . . . . . . . . . . . . . . . . . . .
Vn-td_..~h Vp-tdhl
TTT ATA TCC ATG TTG GCT GCA ...............................
Vp-t-'~2 Vp-tdh3 Vp-t~_4
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Vm-tdh Vp-tdhl
CCC GGT TCT GAT GAG ATA TTG TTT GTT GTT CGA ...................................................
vp-t-~2 Vp-tdh3 Vp-t--~[~4
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
VM-td_~h Vp-tdhl V p - t-'~2
GTa AAG GTC TCT GAC TTT TGG .............................. --- G ..........................
Vp-tdh3 Vp-t~4
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Vm-td_hh
CAA
Vp-td~l Vp- t--~ 2
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
......
GG "--222-.2G
A--A--C-T
V p - t--4"~ t--~2 3
"* .......................
T-GA ........
C 222-2222
~AC_ - 2 2 - -
C ........
AAC ....
,~,
X~mo 0~ . . . . . . .
T .... ° ........ T- --G ......... T---G ......... T. . . . .G . . . . .
• T • "
. . . .
. . . .
. . . .
. . . .
. . C. . . . . . . . . G . . . . G. . . . . G . . . . G. . . . . G . . . .- G. - . . .
0oA A ' ~ . . . .
. . . . . . . .
. . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . .
0. . . . . . .
. . . . . . . .
. . . . . . . . . . . . . . . . . . .
20O
TCA
GTA
TTC
ACA
ACG
TTC
mmk
ACA
TCA
ACA
AAC
GGT
T ~ T G C ~ T~TT C A G C T T C C A T C T G T C C .................................. c C C
CGT
GAT
~CA
ACT
TTT
AAT
ACC
TTT
CCT
GCC
~A~ GC~ CCG GTC C .............. T T T
--a --k --A
AAT
. . . . . . . . . . . . . . . . . . . . . . . . . . .
~mT GTA AAA AGA AAA CCG TAC ~aa °AT GTT TAT a ................................... m .................... A .............. m. . . . . . . . . . . . . . . . . . . . A. . . . . . . . . . . . . . . . . . . .
mC~
CCT
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
AAA
TGG
~TG
AAA
G4~AC T A T
GGT
A. . . . . . . . . . . . . . k . . . . . . . . . . . . . .
ACA
ATG
°CA
GCG
GTG
TCT
°GC
Vp-t--d~3
Vp-tdh4
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
C. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
,~o ACA
Vp-tdhl Vp-t~_2 Vp-t4h3 Vp-tdh4
. . . .
Vm-td~h Vp-tdhl
°IT
vp-t-a~2
-G~ ~2~ -22 22_A 22~ -2~ 22~ 2-~ 2-2 G22 ~22 ........... . ~. . ..... ........... ......... .. ...... . . . . . . . . . . . .
Vp-tah3
......................................
T
............
Vp-t--~4
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
T
. . . . . . . . . . . . . . . . . . . . . . . . . . .
Vm-tdh Vp-tdhl
ATT CCA AGT AAA ATG TAT TTG GAT GAA ACT CCA GAA TAT TTT GTT ~AT GTA GAA °CA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
V p - t-'d~2
..............................................................
Vp-tdh3
. . . .
. . . .
TCC . . . .
. . . .
. . . .
CAA
TAC . . . .
. . . .
. . . .
. . . .
ATG . . . .
GTA
. . . . . . . .
CA~
vp-t_~
"
-"
-''-"
Vm-tdh
GGT
AGT
GGT
Vp-tdhl Vp-~2 Vp-t4h3 Vp-t--~4
. . . . . . . . . . . .
ACT . . . . . . . .
GTG
. . . . . . . .
. . . . . . . .
CTT
AAC
. . . . . . . .
CAA
ATT
on ao
Vu-tdh
AAT
GAT
TAT
AAG
AGC
GGT
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . CA . . . . . . . . . . . . . . . . C. . . . . . . . . . . . . . . . . . A.
CAT
TCC
TAT
~AT
TCT
GTA
. . . .
. . . .
GC~
. . . .
CAT . . . .
. . . .
mac
. . . .
. . . .
TCT . . . .
TTT
. . . .
GCT
. . . .
. . . .
. . . .
GTT
GTG
. . . . . . . . . . . . . . . .
GGT
TTC
. . . . . . . . . . . . . . . .
~AA
............
. . . . . . . . . . . . . . . . . . . . . . . .
~v~
i
TAm
TCA
OAT
GAA
GIT TCT G ....
A ..............
TAT
GAlA AGT G ---
G
---
o
•
GAA
CAT
CAm
0....................
~o ~TA a . m. A. m.
AAA
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
-" AAT
GTA
. . . . . . . . . . . . . . . . . . . . . . .
. . . .
TTG . . . .
. . . .
. . . .
GTA . . . .
. . . .
. . . .
. . . .
ATG . . . .
. . . .
Transcription
. . . .
TGT . . . .
. . . .
. . . .
. . . .
ATA . . . .
. . . .
. . . .
TCC . . . .
. . . .
. . . .
mAC . . . .
. . . .
. . . .
. . . .
AAA . . . .
. . . .
. . . .
GAA . . . .
. . . .
. . . .
. . . .
TCG . . . .
. . . .
. . . .
TTT . . . .
. . . .
. . . .
. . . .
TTT . . . .
. . . .
. . . .
GAA
TGT
. m. . . . . . . . . A. . . . . . . . . . . . . . . . . . . m-T. . . . .
terminator
~A-~ee-e~GT~A~GCC~C~G~T~TTCTGTGG~TT''~-TG~A~TA~TT~T~T~TT~eTCTG~T~TG~TGTCA
Vm-~:d._._~h
CGA
V p - t-d-h l Vp-tdn2 V p - t--~3 Vp-tdh4__
-A ...... -A ...... AA ...... AAT _ ....
* e e * ~ . . m - - - -~-. . . . . . . . . . . . . . . . . . . . . . ~ ...................... • . . . . . . . . . . . . . . . . .A *~*e~*~A ................................... G .............. "'--A ........... T-~TAAAAA .................................... G .............. AT--A ........... T-* * e e e e * . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .A. . . . . . .G. . . . . . . . . . . . . . . . .A.A.T. A T
322 Vm-tdhh
Vm-tdh gene) and the hemolysin encoded by the Vm-tdh gene can be named T D H (here designated as Vm-TDH). By analogy with the tdh gene of V. parahaemoly~'icus, the Vm-tdh gene is predicted to encode the precursor form of Vm-TDH, which is predicted to be a 189-amino-acid polypeptide with a deduced molecular mass of 21512. Assuming that Vm-TDH, like T D H of V. parahaemolyticus, has a signal peptide of 24 amino acid residues, the mature form of Vm-TDH is predicted to be a 165-amino-acid polypeptide with a molecular mass of 18648. Putative promoter and ribosome binding (Shine-Dalgarno) sequences and an inverted repeat sequence, which is a possible transcription terminator of the Vm-tdh gene, are indicated in Fig. 1. Fig. 1 also compares the Vm-tdh gene with the three other tdh gene copies of V. parahaemolyticus reported previously [4] (herein designated as Vptdh2, -tdh3, and -tdh4). Within the coding regions of the five tdh genes (bases 127-693), there were 29 sites where the bases of all five genes are not identical (indicated by ll, • or v in Fig. 1). Evidently the five tdh genes were derived from a common ancestor and evolved by base changes and small insertions/deletions. From comparative analysis of the nucleotide sequence differences described below, we propose that the evolutionary relationships of the five genes are as shown schematically in Fig. 2. A similarity matrix constructed from the nucleotide sequence homologies of the coding regions suggested that Vp-tdh2, -tdh3, and -tdh4 belong to a highly homologous group (Table 1). In fact, comparison of the Vp-tdh2, -tdh3, and -tdh4 coding sequences revealed that the three gene se-
B a ~ ' ~ A
~
vp - tcl_._hhI
/ vp -
C
~
td_h2h
Vo-tdh3
Vp-~4 Fig. 2. Hypothetical evolutionaryrelationship of Vm-tdh. VptdhL Vp-tdh2, Vp-tdh3, and Vp-tdh4. For details, see text. quences differed in 12 sites (indicated by • in Fig. 1) but that each of the three genes had sporadic base changes at 4 sites where the the other two genes shared a common base. This means that the Vp-tdh2, -tdh3, and -tdh4 genes are evolutionally very close. Next, the coding sequences of the Vm.tdh and Vp-tdhl genes were compared with those of the Vp-tdh2-tdh3-tdh4 group. Base substitutions unique to Vm-tdh or Vp-tdhl were recognized at 10 sites (indicated by • in Fig. 1) and base substitutions that could cluster the Vm-tdh and Vptdhl genes as a group distinct from the Vp-tdh2tdh3-tdh4 group were present at 7 sites (indicated by v in Fig. 1). This finding suggested that a putative ancestor of the five tdh genes diverged into two types of offspring (point A in Fig. 2) and then each of these two offsprings diverged further into other types of offspring (points B and C in Fig. 2). Probably the 7 base substitutions (v) accumulated after point A and before points B and C, and the 10 base substitutions (v) accumulated after point B. The patterns of base substitutions are somewhat complex at 5 sites (indi-
Table 1 Comparison of nucleotidesequencesof various tdh genes Percent homologieswithin the coding regions(567 bp) of the tdh genesare indicated. Numerals in parentheses denote the number of bases that differ in pairs of tdh genes, Vm-tdh Vp-tdhl Vp-tdh2 Vp-tdh3 Vp-tdh4
Vm-tdh
Vp.tdhl
Vp-tdh2
Vp-tdh3
Vp-tdh4
97.9 (12) 97.0 (17) 97.4 (15) 97.0 (17)
97.0 (17) 96.7 (19) 96.7 (19)
98.6 (8) 98,6 (8)
98,6 (8)
-
323 cated by o superimposed on ll in Fig. 1). At 3 sites (bases 463, 464, and 691), one of the Vp-tdh 2, -tdh3, and -tdh4 genes may have acquired the s a m e type o f base mutation after point C as that which oeeurred between point A and point B. At 2 sites (bases 621 and 682), the same type of base mutation, which ? , o b a b l y is a transition from A to G, may have occurred independently after point B and after point C. The p r o p o s e d evolutionary relationships are mainly based on the observed base substitutions in the coding regions. Systematic analysis with more sequence data of the tdh and related genes in not only the coding regions but also in surrounding regions should provide support for our hypothesis. Studies on these sequences are in progress. Vm-tdh is present in the c h r o m o s o m e of a strain of V. mimicus [121. Both Vp-tdhl and Vptdh2 are present in the c h r o m o s o m e o f a strain o f V. parahaemolyticus [4]. A n o t h e r strain of V. parahaemolyticus contains Vp-tdh3 in the chrom o s o m e a n d Vp-tdh4 on a plasmid [4]. If the above hypothesis is correct, Vm-tdh and Vp-tdhl m a y have begun to diverge w h e n the ancestral tdh gene was transferred between V. mimicus and V. parahaemolyticus. Vp-tdh2, Vp-tdh3, and Vp-tdh4 might also have diverged as a result of transfer to different organisms or between different replicons ( c h r o m o s o m e and plasmid). It is interesting that two evolutionally distinct tdh genes such as Vptdhl and Vp-tdh2 coexist in the same organism. T h e tdh gene previously suggested to be present o n a mobile genetic element because the coding regions o f tdh genes have lower G + C contents t h a n the average G + C c o n t e n t of the total D N A o f V. parahaemolyticus [ 3 , 4 1 7 ~. and because s o m e strains of V. parahaemolyticus lose the tdh gene spontaneously [3,18]. The present data support this hypothesis. ~tudies on the nucleotide sequences flanking the tdh genes may clarify this mechanism.
ACKNOWLEDGEMENTS This work was s u p p o r t e d in part by a Grant-inAid for Scientific Research from the Ministry of
Education, Science and Culture of Japan a n d by grants from Suzuken Memorial F o u n d a t i o n , U e h a r a Memorial F o u n d a t i o n , and O h y a m a Health F o u n d a t i o n .
REFERENCES [I l Blake, P.A., Weaver, R.E. and Holhs, D.G. (1980) Ann. Rev. Microbiol. 34, 341-367. [2] Takeda, Y. (1983) Pharmacol. Ther. 19,123-146. 13l Nishibuchi. M.. and Kaper, J.B. (1985) J. Bacteriol. 162,
558-564. [41 Nishibuchi, M., and Kaper. J.B. (1990) Mol. Microbiol. 4. 87-99. [51 Yoh, M., Honda, T. and Miwatani. T. (1985) FEMS Microbiol. Lett. 29. 197-200. 161 Yoh. M.. Honda, T. and Miwatani, T. (1986) Infect. lmmun. 52, 319-322. [7] Yoh. M., Honda, T. and Miwatani. T. (1986) Can. J. Microbiol. 32. 632-636. [81 Nishibuchi, M., Doke, S., Toizumi. S., Umeda, T.. Yoh. M. and Miwatani, T. (1988) Appl. Environ. Microbiol. 54, 2144-2146. [91 Honda, T. and Miwatani, T. (1988) in Advances in Research on Cholera and Related Diarrheas, 6 (Ohtomo, N. and R.B. Sack. eds.), pp. 23-32. KTK Seientifie Publishers, Tokyo. [10] Nishibuchi. M., lshibashi, M., Takeda, Y. and Kaper, J.B. (1985) Infect. lmmun. 49, 481-486. [111 Hond~ T., Nishibuchi, M.. Miwatani, T. and Kaper, J.B. (1986) Appl. Environ. Microbiol. 52,1218-1220. [12] Nishibuchi. M., Khaeomanee-iam, V., Honda, T,, Kaper, J.B. and Miwatani. T. (1990) FEMS Microbiol. Lett. 67, 251-256. [13] Vieira` J. and Messing, J. (1'387) Methods Enzymol. 153, 3-11. [14] Birnboim, H.C. and Doly. J. (1979) Nucleic Acids Res. 7, 1513-1523. [15] Henikoff, S. (1984) Gene 28, 351-359. [16] Mizusawa. S., Nishimura` S. and Seela` F. (1986) Nucleic Acids Res. 14, 1319-1324. [17] Taniguchi, H., Hirano, H., Kubomura, S.. Higashi, K. and Mizuguchi, Y. (1986) Microb. Pathogen. 1,425-432. [18] Taniguchi, H., Ohta, H., Ogawa, M. and Mizuguchi, Y. (1985) J. Bacteriol. 162. 510-515.