Nucleotide sequence specifying the glycoprotein gene, gB, of herpes simplex virus type 1

VIROLOGY

133, 301-314 (1984)

Nucleotide

Sequence

Specifying

of Herpes DAVID Molecular

and Cell Biology

the Glycoprotein

Simplex

J. BZIK, BARBARA A. FOX, NEAL AND STANLEY PERSON’ Program, Received

Pennsylvania September

Gene, gB,

Virus Type 1

State

University,

13, 1983; accepted

A. DELUCA,~

University

December

Park,

Pennsylvalzia

16802

9, 1983

The nucleotide sequence thought to specify the glycoprotein gene, gB, of the KOS strain of herpes simplex virus type 1 (HSV-1) has been determined. A 3.1-kilobase (kb), viralspecified RNA was mapped to the left half of the BamHI-G fragment (0.345 to 0.399 map units). TATA, CAT-box, and possible mRNA start sequences characteristic of HSV-1 genes are found near 0.368 map units. The first available ATG codon is at 0.366 and the first in-phase chain terminator at 0.348 map units. A polyA-addition signal (AATAAA) occurs 17 nucleotides past the chain terminator. Translation of these sequences would yield a 100.3-kilodalton (kDa) polypeptide characterized by a 5’ signal sequence, nine N-linked saccharide addition sites, a strongly hydrophobic membrane-spanning sequence, and a highly charged 3’ cytoplasmic anchor sequence. Two mutants of KOS, tsJ12 and tJ20, that are temperature-sensitive for viral growth and for the production of gB, have been physically mapped to 0.357 to 0.360 and 0.360 to 0.364 map units, respectively (DeLuca et al, in preparation). The nucleotide sequence of the mutants was determined in these regions. In both cases a single amino acid replacement within the 100.3-kDa polypeptide is predicted from the sequence analysis.

Two mutants of HSV-1, tsB5 (Manservigi et aL, 1981), have been isolated that are temperaturesensitive for viral growth and the accumulation of gB. They have been assigned to the l-9 complementation group (Schaffer et aL, 1978) and accumulate pgB at the nonpermissive temperature. tsJ12 was mapped to the BarnHI-G fragment (0.345 to 0.399 map units) of HSV-1 (Little et aL, 1981). The ts lesion in tsB5 has been mapped between 0.360 and 0.368 map units (DeLuca et aL, 1982; Holland et al, 1983b). tsB5 is also known to cause cell fusion due to the presence of a syncytia-inducing (syn)

INTRODUCTION

et aL, 1977) and tsJ12 (Little

The envelope of herpes simplex virus type 1 (HSV-1) and the plasma membrane of HSV-l-infected cells contain four antigenically distinct glycoproteins: gB, gC, gD, and gE (Spear, 1976; Baucke and Spear, 1979; Norrild, 1980). The nucleotide sequence specifying gD (Watson et aL, 1982) and gC (Frink et aL, 1983) have been reported recently, but no essential biological roles have been determined for these glycoproteins. gE binds the Fc portion of immunoglobulin IgG (Baucke and Spear, 1979; Para et aL, 1982), although the biological significance of this finding remains to be demonstrated. gB is the only glycoprotein that is known to be required for viral growth and probably has a role in viral entry and cell fusion (Manservigi et aL, 1977; Sarmiento et aL, 1979; Little et cd, 1981; DeLuca et at., 1982).” 1 Present address: Dana-Farber Cancer Institute, Harvard University, 44 Binney Street, Boston, Mass. 02115. ‘Author to whom requests for reprints should be addressed. ‘At the International Herpesvirus Workshop in Oxford, England (August 1983) it was agreed that 301

the glycoprotein gA be designated pgB, a precursor to gB. gA and gB share antigenic determinants (Eberle and Courtney, 1980; Pereira et al, 1981). gA can be chased into gB in some cells and is sensitive to an enzyme (endoglycosidase H) that is specific for the cleavage of high-mannose saccharides from precursor glycoproteins (Serafini-Cessi and Campadelli-Fiume, 1981; Person et aL, 1982; Wenske et QL, 1982; Johnson and Spear, 1983). gB precursors are not processed as efficiently as those for gC and gD, especially in HEp2 cells, a finding that led to the early assignment of pgB as a distinct glycoprotein. 0042.6822/84 $3.00 Copyright 0 1984 by Academic Press, Inc. All rights of reproduction in any form reserved.

302

BZIK

mutation (Manservigi et a& 1977). The sgn lesion of tsB5 was shown to be physically close to but separable by recombination from the ts lesion (Honess et aL, 1980). The syn lesion of tsB5 has been mapped to between 0.345 and 0.355 map units (DeLuca et aL, 1982). Recently, DeLuca et al (in preparation) have mapped tsJ12 and four newly isolated ts mutants defective in accumulation of gB (including tsJ20) to three adjacent but separate regions: 0.350 and 0.357,0.357 to 0.360, and 0.360 to 0.368 map units. Monoclonal antibodies specific to HSV1 glycoproteins have been used to select for antigenic variants of HSV-1 (Holland et al, 1983a). One of the antigenic variant viruses isolated, designated rnurB1.l, is resistant to immune cytolysis by the gB-specific monoclonal antibody used in the selection process. The gB produced by murB1.1 appears to be normal in all respects, except that a single antigenic site has been altered. The lesion in marB1.1 has been mapped between 0.350 and 0.361 map units (Holland et aZ., 1983b). The structural gene for gB has been mapped to the coordinates 0.350 to 0.400 from the combined data of Marsden et al (1978) and Ruyechan et al. (1979). Physical mapping data of ts mutants would localize the structural peptide of gB to sequences between 0.345 and 0.368 map units. In this publication we present the nucleotide sequences within these coordinates, the relevant nucleotide sequences of two gB mutants (tsJ12 and tsJ20), and the identification of a 3.1-kb RNA that mapped to these coordinates.

ET AL.

Escherichia coli strains RR1 and JM103 were used for recombinant DNA experiments. RR1 was grown on Luria (L) broth or on L plates (Miller, 1972). To select for cells containing plasmids, plates contained ampicillin or chloramphenicol at 25 pg/ml. JM103 was grown in V broth (10 g/liter tryptone, 5 g/liter yeast extract, 7 g/liter NaCl, 1.5 g/liter KCl, and 0.5 g/liter MgS04. 7Hz0, or on V plates (V broth plus 15 g/liter agar). The Ml3 bacteriophage strains M13mp7, M13mp8, and M13mp9 were previously described (Messing et cd., 1981; Messing and Vieira, 1982) and were propagated in JM103 cells in V medium. DNA isolatim Intact HSV-I tsJ12 and tsJ20 DNA were isolated as previously described (Goldin et al, 1981). Plasmid DNA and Ml3 double-stranded replicative form (RF) DNA were extracted from bacteria using the procedure previously described by Birnboim and Doly (1979). For largescale preparation the plasmid or Ml3 RF DNA was further purified by equilibrium banding in 50% (w/w) CsCl and 150 pg/ml ethidium bromide. Ethidium bromide was removed by n-butanol extraction, and the DNA was dialyzed against cold TE (10 mM Tris, pH 8, 1 mM EDTA). Cloning of HSV-1 KOS, tsJl2, and td20 DNA. The plasmids described by DeLuca et al. (1982) served as the source of HSV1 KOS DNA. The EcoRI-F fragments (0.315 to 0.421) from tsJ12 and tsJ20 were cloned into the unique EcoRI site in the chloramphenicol-resistance gene of pBR325. Defined restriction fragments of HSV-1 DNA were inserted into the cloning-sequencing vectors M13mp8 and M13mp9 (Heidecker et aL, 1980). In several M13/ MATERIALS AND METHODS HSV-1 recombinants one end of the HSVCells and wirusea Procedures for the 1 DNA was defined by a B&E11 or Sat11 growth and maintenance of human em- site. In these constructions blunt ends were bryonic lung (HEL) cells and HSV-1 were prepared using either Klenow fragment previously described (Person et al, 1976). (BstEII) or T4 DNA polymerase (S&II) (see, for example, Maniatis et al, 1982) and were Strain KOS and the temperature-sensitive mutant tsJ12 (Schaffer et cd, 1973) were ligated to HincII-cleaved M13. To isolate Sau3A, H@aII, and Tag1 M13/ kindly supplied by Dr. P. Schaffer (DanaFarber Cancer Institute, Harvard Univer- HSV-1 recombinants the 2.25-kilobase pair sity). The mutant virus tsJ20 was isolated (kbp) BamHI-Sal1 HSV-1 DNA fragment in this laboratory by in vitro mutagenesis (0.345 to 0.360 map units) cleaved from the of a cloned HSV-1 DNA fragment (DeLuca plasmid pKBG-BSl was gel eluted and purified (McDonell et aZ., 1977). Following et aL, in preparation).

NUCLEOTIDE

SEQUENCE

separate digestions with Sau3A, HpaII, or To&, the resulting fragments were shotgun cloned into the BamHI, AccI, or AccI sites of M13mp7, respectively. Following ligation and transformation (Cohen et al, 19’72)of JM103, the resulting Ml3 phage were plated under selective conditions and putative M13/HSV-1 recombinants were picked (Messing et aZ., 1981). The RF DNA from each recombinant was analyzed for the presence of the correct size insert. Single-stranded M13/HSV-1 DNA was prepared as previously described (Heidecker et al, 1980) and was the source of HSV-1 DNA used in DNA sequencing experiments. Hybridization to previously characterized M13/HSV-1 recombinants (Howarth et aL, 1981) was occasionally used to identify recombinants containing HSV1 DNA of the opposite strand. RNA isolation and transcript mapping. Polyribosomes, and subsequently polyribosomal-associated RNA, were isolated from the cytoplasm of HSV-1 KOS-infected cells 6 hr after infection by the Mg+’ precipitation method of Palmiter (1974), as modified for HSV-1 (Anderson et aL, 1981; Costa et aL, 1981; Frink et aL, 1981). The polyribosomal-associated RNA (10 pg) was glyoxylated, electrophoresed, and transferred to nitrocellulose paper (Thomas, 1980). The nitrocellulose was probed with radioactively labeled HSV-1 DNA using the conditions described by Thomas (1980). Radioactively labeled HSV-1 DNA was prepared by nick translation (Maniatis et aL, 1975). Gel electrophwesis. DNA was electrophoresed in horizontal agarose gels, as previously described by Bolivar et al. (1977). Electrophoresis buffer (TBE) contained 89 mM Tris (pH 8.3), 89 mM boric acid, and 2.5 mM EDTA. The concentrations of agarose were varied from 0.5 and 2.5%. Denaturing polyacrylamide gels were used to electrophorese DNA fragments created for sequencing and RNA-protection experiments. The gels (35 cm X 42 cm X 0.35 mm) were made and electrophoresed as described by Smith (1980). Gels were 5, 6, or 10% acrylamide in TBE in order to resolve different fragment sizes. Following electrophoresis the gels were wrapped in

OF HSV-1

gB GENE

303

thin plastic and exposed to X-ray film (typically for 15 hr). DNA sequencing. DNA sequencing with the dideoxy nucleotide analogs was first described by Sanger et al. (1977). The DNA sequencing protocol previously described by Heidecker et al. (1980) was used in this study. The universal 17-base, M13-specific primer used in the sequencing reactions was obtained from Collaborative Research; deoxy and dideoxy nucleotides were obtained from P-L Biochemicals. [a-32P]deoxynucleotide triphosphates (>600 Ci/ mmol) were obtained from New England Nuclear. Enzymes. Restriction endonucleases were obtained from Bethesda Research Laboratories or from New England Biolabs and were used as prescribed by the supplier. Sl nuclease, Klenow polymerase, and DNAse I were obtained from Boehringer-. Mannheim Biochemicals. T4 DNA polymerase and DNA polymerase I (E. co&) were obtained from Bethesda Research Labs. RESULTS

RNAs Homologous to BamHI-G Polyribosomal-associated RNA was isolated from HSV-1 (strain KOS)-infected cells at 6 hr after infection, glyoxylated, separated electrophoretically, and transferred to nitrocellulose paper. The immobilized RNA was hybridized with radioactively labeled pKBG-BSl, a recombinant plasmid that contains HSV-1 DNA representing 0.345 to 0.360 map units (Fig. la), or with radioactively labeled pKBG DNA, a recombinant plasmid containing the HSV-1 BamHI-G fragment that contains sequences between 0.345 and 0.399 map units (Fig. lb). The major RNA species identified were 3.1-kb RNA, homologous to DNA sequences between 0.345 and 0.360 map units, and three RNAs of 3.1,4.2, and 5.2 kb, homologous to DNA sequences between 0.345 and 0.399 map units. The 3.1kb RNA identified in these experiments is almost certainly the same as the 3.3-kb (p) mRNA previously mapped to these coordinates (Holland et d, 1979), and the 4.2kb RNA (Fig. lb) is probably the same as

304

BZIK

5.2 Kb 4.2 Kb

3.1 Kb 0

b

a

FIG. 1. RNA species homologous to BarnHI-G. (a) HSV-1 RNA localization by hybridization to =P-laheled HSV-1 DNA between 0.345 and 0.360 map units, or (b) 0.345 and 0.399 map units. The solid circles indicate the positions of 28 and 18 S rRNA run in parallel as size standards. The markers were from HEL cells, and the sizes were taken as 4.85 and 1.74 kb, respectively (Lewin, 1980).

the 4.5kb mRNA (homologous to HSV-1 DNA between 0.385 and 0.419 map units) that apparently encodes ICP8 (Godowski and Knipe, 1983). The 3.1-kb RNA had no detectable homology to radioactively labeled BamHI-E’ (0.339 to 0.345 map units) or to BamHI-D’ (0.333 to 0.339 map units), and Sl nuclease experiments indicated that the 3’ end of the RNA was near 0.348 map units (not shown). Nucleotide Sequence Analysis of HSV-1 DNA between 0.370 and 0.345 Map Units

The restriction

endonuclease

cleavage

sites shown in Fig. 2a represent the endpoints of HSV-1 DNA in M13/HSV-1 recombinant clones used in the determina-

ET AL.

tion of the HSV-1 DNA sequence (Fig. 2b). This permitted the sequence determination of greater than 97% of both DNA strands between 0.368 and 0.345 map units. The DNA sequence was determined by the dideoxy chain-termination method and is presented in Fig. 3. The sequence given originates at 0.370 map units (5’) and continues to the BamHI site at 0.345 map units (3’). The DNA sequence is written in the same sense as the 3.1-kb RNA. Potential TATA box signals, ATATATT and TATATCT, were observed between nucleotide residues 234 to 240, and 362 to 368, respectively. The sequence TATATCT (nucleotide residues 362 to 368) is probably not a true TATA-box signal because the 3.1-kb RNA apparently includes this region. In addition, this sequence was found as TGTACCT in HSV-2 DNA, but the ATATATT sequence and 25 nucleotides surrounding this sequence were completely conserved in HSV-2 DNA (to be published). The TATA box typically occurs 24 to 32 nucleotides before mRNA cap sites (Gannon et aL, 1979; Busslinger et aL, 1980; Efstratiadas et aL, 1980; Breathnach and Chambon, 1981). Often the first transcribed base of eukaryotic mRNAs is an A residue that is surrounded by pyrimidine residues (Busslinger et ah, 1980; Breathnach and Chambon, 1981). The sequence CCACCACACTCTTT was observed between nucleotide residues 257 and 270. The A residues within this pyrimidine-rich sequence occur at 26, 29, and 31 nucleotides following the presumptive TATA box (nucleotide residues 234 to 240) and one of the A residues is probably the first transcribed base of this gene. Another conserved sequence in the 5’flanking region of eukaryotic messages is commonly called the CCAAT box (or simply the CAT box) and is often found about 85 nucleotides before the cap site (Benoist et aZ.,1980; Efstratiadas et al, 1980). Two potential CAT boxes were observed prior to the presumptive TATA box. The sequences CGGAATA (nucleotide residues 201 to 207) and GCGAATT (nucleotide res-

idues 164 to 170) represent possible CAT boxes. The sequence GCGAATT is identical

NUCLEOTIDE

SEQUENCE

OF HSV-1

305

gB GENE

200 bD 0.345 I

0.350 I

0.355 I I

0.360 I

0.365 I I

0.370 1 I

FIG. 2. Strategy used for determining the DNA sequence between 0.370 and 0.245 map units. (a) A partial restriction map of HSV-1 (KOS) between 0.345 and 0.372 map units. The enzymes used were BumHI (Ba), B&E11 (Bs), H&I (HP), NarI (Na), PstI (Ps), PvuII (Pv), SalI (Sl), Sau3A (Sa), SmaI (Xm), SstII (Ss), TagI (Ta), and XhoI. The map shown is complete for BarnHI, BstEII, PstI, PvuII and XhoI. (h) MlVHSV-1 clones constructed for DNA sequence determination. Endpoints are indicated by solid dots (5’ ends) and arrowheads (3’ ends).

to the seven internal nucleotides of the HSV-1 thymidine kinase gene mRNA CAT box (McKnight, 1980; Wagner et ab, 1981) and occurs 92 to 98 bp before the presumed mRNA start site. A polyadenylation signal AATAAA occurred near 0.348 map units (nucleotide residues 3276 to 3281). This polyA-addition signal is found about 20 nucleotides prior to the polyA-addition site of many eukaryotic mRNAs (Proudfoot and Brownlee, 1976; Efstratiadas et al, 1980; Fitzgerald and Shenk, 1981). From the combined DNA sequence and RNA experiments the mRNA would have a length of approximately 3050 nucleotides prior to polyadenylation. Analysis of all possible reading frames revealed only one that could specify a polypeptide as large as gB (Fig. 4). Frame 2 or 3 could encode polypeptides no longer than 10 or 19 kDa, respectively. The longest open-reading frame (frame 1) begins with the ATG codon at nucleotide residue 548 and continues until a chain-termination codon, TGA, is encountered at nucleotide residue 3257. The polypeptide would contain 903 amino acids and have a molecular weight of 100.3 kDa. The predicted amino acid sequence of this polypeptide is pre-

sented (Fig. 3). The polypeptide has several features in common with the polypeptide backbones of other glycoproteins. Amino acid residues 1 to 41 define a potential hydrophobic signal sequence (Kreil, 1981). Amino acid residues 751 to 794 define a hydrophobic membrane-spanning region (Garoff et ab, 1980; Rose et aZ., 1980). A highly charged sequence of 109 amino acids following the hydrophobic membranespanning region probably functions to anchor the glycoprotein into the membrane (Rose and Bergmann, 1982). Nine possible N-linked glycosylation sites (asn-X-ser/ thr; Hubbard and Ivatt, 1981) are found on the external portion of the polypeptide. The 100.3-kDa polypeptide would initiate at the first available ATG codon found after the mRNA start site and is consistent with a ribosome-scanning model of translation initiation (Kozak, 1978,198l). Translation initiation by ribosomes in prokaryotes is enhanced by the formation of a short hybrid with the 3’ end of the 16 S rRNA (Shine and Dalgarno, 1974a). A similar pairing of mRNA and 18 S rRNA has been suggested to occur on eukaryotic ribosomes (Shine and Dalgarno, 197413; Hagenbiichle et ah, 1978). Nucleotide sequences, TCCTC-

306

BZIK

ET AL.

~~~-~~~~AGG~TA~~T~~GGGGGG~A~GA~GGGCCCCCGTAGTCCCGCCATG cAc CAG GGC GCC ccc TCG TGG GGG CGC CGG TGG TTC met his gln gly ala pro SW trp gly arg arg trp phe -13 S87-GTC 'al

GTA TGG GCG CTC TTG GGG TTG ACG CTG GGG GTC CTG GTG GCG TCG GCG GCT CCG AGT TCC CCC GGC ACG CCT Val trp ala 1.2~ leu g1y leu thr leu gly val leu val ala SOP ala ala pro SW SW pm gly thr pm -38

662-666 gly

GTC GCG CGC GAC CCA GGC GGC GM CGG GGG CCC TGC CAC TCC GGC GCC GCC GCC CTT GGC GCC GCC CCA ACG val ala arg asp pro gly gly glu arg gly pro cys his SW gly ala ala ala leu gly ala ala pro thr -63

737-GGG GAC CCG AM CCG AAG AdG AAC AAA AAA CCG AAA AK CCA ACG CCA CCA CGC CCC GCC GGC GAC AAC GCG ACC gly asp pm lys pm lys lys as" lys lys pro lys as" pro thr pro pro arg pro ala gly asp dsn ala thr -88 812-GTC val

GCC GCG GGC CAC GCC ACC CTG CGC GAG CAC CTG CGG GAC ATC A4G GCG GAG AAC ACC WIT GCA AAC TTT TAC ala ala gly his ala thr leu arg glu his leu arg asp ile lys ala glu asn thr Ssp ala asn phe tyr -113

887-GTG TGC CCA CCC CCC ACG GGC GCC ACG GTG GTG CAG TTC GAG CAG CCG CGC CGC TGC CCG ACC CGG CCC GAG GGT Val Cys pro pro pro thr gly ala thr val val gin phe glu gin pro arg arg cys pro thr arg pro glu gly -138 962-CAG AAC TAC ACG GAG GGC ATC GCG GTG GTC TTC AAG GAG AN ATC GCC CCG TAC AAG TTC AAG GCC ACC ATG TAC gln asn tyr thr glu gly ile ala val val phe lys glu asn ile ala pro tyr lsy phe lys ala thr met tyr-163 1037-TAC tyr

AAA GAC GTC ACC GTT TCG CAG GTG TGG TTC GGC CAC CGC TAC TCC CAG TTT ATG GGG ATC TTT GAG GAC CGC lys asp val thr val SW gln val trp phe gly his arg tyr SW gin phe met gly ile phe glu asp arg -188

lIlL-GCC ala

CCC GTC CCC TTC GAG GAG GTG ATC GAC AAG ATC AAC GCC AAG GGG GTC TGT CGG TCC ACG GCC AAG TAC GTG pro vrl pro phe glu glu val ile dsp lys ile as" ala lys gly val cys arg SW thr ala lys tyr val -213

1187-CGC AAC AAC CTG GAG ACC ACC GCG TTT CAC CGG GAC GAC CAC GAG ACC GAC ATG GAG CTG AAA CCG GCC A4C GCC arg asn asn leu glu thr thr ala phe his Srg asp asp his glu thr asp met glu leu lys pro ala asn ala -238 1262-GCG ACC CGC ACG AGC CGG GGC TGG CAC ACC ACC GAC CTC AAG TAC AAC CCC TCG CGG GTG GAG GCG TTC CAC CGG ala thr arg thr SW rrg giy trp his thr thr asp leu lys tyr asn pro SW wg val glu ala phe his arg-263 1337-TAC tyr

GGG ACG ACG GTA AAC TGC ATC GTC GAG GAG GTG GAC GCG CGC TCG GTG TAC CCG TAC GAC GAG TTT GTG CTG gly thr thr val E." cys ile val glu glu val asp ala arg SW val tyr pro tyr .~sp glu phe val leu -288

1412-GCG ACT GGC GAC TTT GTG TAC ATG TCC CCG TTT TAC GGC TAC CGG GAG GGG TCG CAC ACC GAA CAC ACC ACG TAC ala thr gly asp phe val tyr met SW pro phe tyr gly tyr arg glu gly SW his thr glu his thr thr tyr-313 1487-GCC XC GAC CGC TTC AAG CAG GTC GAC GGC TTC TAC GCG CGC GAC CTC ACC ACC AAG GCC CGG GCC ACG GCG CCG ala ala asp arg phe lys gln val asp gly phe tyr ala arg asp leu thr thr lys ala arg ala thr ala pro -338 1562-ACC thr

ACC CGG AdC CTG CTC ACG ACC CCC AAG TTC ACC GTG GCC TGG GAC TGG GTG CCA AAG CGC CCG TCG GTC TGC thr arg asn leu leu thr thr pro lys phe thr val ala trp asp trp val pro lys arg pro SW val Cys -363

1637-ACC thr

ATG ACC AAG TGG CAG GAA GTG GAC GAG ATG CTG CGC TCC GAG TAC GGC GGC TCC TTC CGA TTC TCC TCC GAC met thr lys trp gin glu val asp glu met leu arg SW glu tyr gly gly SW phe arg phe SW SW asp -388

1712-GCC ala

ATA TCC ACC ACC TTC ACC ACC AdC CTG ACC GAG TAC CCG CTC TCG CGC GTG GAC CTG GGG GAC TGC ATC GGC ile SW thr thr phe thr thr asn leu thr glu tyr pm leu SBP arg val asp leu gly asp cys ile gly -413

1787-AAG lys

GAC GCC CGC GAC GCC ATG GAC CGC ATC TTC GCC CGC AGG TAC ARC GCG ACG CAC ATC PAG GTG GGC CAG CCG asp ala arg asp ala met asp arg ile phe ala arg arg tyr Ssn ala thr his ile lys val gly gln pro -438

1862-CAG gin

TAC TAC CTG GCC AAT GGG GGC TTT CTG ATC GCG TAC CAG CCC CTT CTC AGC AAC ACG CTC GCG GAG CTG TAC tyr tyr leu ala asn gly gly phe leu ile ala tyr gln pm leu leu ser ~sn thr leu ala glu leu tyr-463

1937-GTG vrl

CGG GAA CAC CTC CGA GAG CAG AGC CGC AAG CCC CCA AAC CCC ACG CCC CCG CCG CCC GGG GCC AGC GCC AAC arg glu his leu arg glu gin SW arg lys pm pm en pm thr pro pro pro pro gly ala SW ala s-488

2012-GCG ala

TCC GTG GAG CGC ATC AAG ACC ACC TCC TCC ATC GAG TTC GCC CGG CTG CAG TTT ACG TAC ARC CAC ATA CAG val glu arg ile lys thr thr SW SW ile glu phe ala arg :eu gln phe thr tyr asn his ile gin -613

2087-CGC CAT GTC AAC GAT ATG TTG GGC CGC GTT GCC ATC GCG TGG TGC GAG CTA CAG A4T CAC GAG CTG ACC CTG TGG arg his val asn asp met leu gly arg val ala ile ala trp cys glu leu gin asn his glu leu thr leu trP -638 2162-AAC GAG GCC CGC AAG CTG AAC CCC AAC GCC ATC GCC TCG GTC ACC GTG GGC CGG CGG GTG AGC GCG CGG ATG CTC am glu ala arg lys leu 4Sn pro dsn ala ile ala SW val thr val gly arg arg val SW ala arg met leu -563 2237-GGC gly

GAC GTG ATG GCC GTC TCC ACG TGC GTG CCG GTC GCC GCG MC AAC GTG ATC GTC CAA AAC TCG ATG CGC ATC asp val met ala val SW thr cys val pro val ala ala asp asn val ile val gln asn SW met arg ile -588

FIG. 3. Nucleotide sequence of DNA between 0.370 and 0.345 map units. The nucleotide sequence of the noncoding, or message, strand of DNA is shown in the 5’ (upper left) to 3’ (lower right) direction. Nucleotide numbers are shown in the left margin. CAT, TATA, mRNA start and stop sites, and the polyadenylation signal are underlined. The predicted amino acid sequence of a 100.3kDa polypeptide that could be encoded by these sequences is shown below the nucleotide sequence. Amino acid numbers are shown in the right margin. Potential N-linked glycosylation sites (asnX-ser or thr) are underlined. Computer programs described by Larson and Messing (1982) were used in data handling and storage. All of the autoradiograms used for sequence determination are on file in our laboratory.

NUCLEOTIDE

SEQUENCE

OF HSV-1

30’7

gB GENE

2312-AGC TCG CGG CCC GGG GCC TGC TAC AGC CGC CCC CTG GTC AGC TTT CGG TAC GAA GAC CAG GGC CCG TTG GTC GAG set' SW arg pro gly ala cys tyr SW arg pro leu val ser phe arg tyr glu asp gin gly pro leu val glu -613 2387-GGG gly

CAG CTG GGG GAG AAC AAC GAG CTG CGG CTG ACG CGC GAT GCG ATC GAG CCG TGC ACC GTG GGA CAC CGG CGC gin leu gly glu asn asn glu leu arg leu thr arg asp ala ile glu pm cys thr val gly his arg arg -638

2462-TAC tyr

TTC ACC TTC GGT GGG GGC TAC GTG TAC TTC GAG GAG TAC GCG TAC TCC CAC CAG CTG AGC CGC GCC GAC ATC phe thr phe gly gly gly tyr val tyr phe glu glu tyr ala tyr ser his gln leu ser arg ala asp ile -663

2537-ACC thr

ACC GTC AGC ACC TTC ATC GAC CTC AAC ATC ACC ATG CTG GAG GAT CAC GAG TTT GTC CCC CTG GAG GTG TAC thr val SW thr phe ile asp leu asn ile thr met leu glu asp his glu phe val pro leu glu val tyr -688

2612-ACC thr

CGC CdC GAG ATC AAG GAC AGC GGC CTG CTG GAC TAC ACG GAG GTC CAG CGC CGC AAC CAG CTG CAC GAC CTG arg his glu ile lys asp se? gly leu leu asp tyr thr glu ml gln arg arg asn gin leu his asp leu -713

2687-CGC TTC GCC GAC ATC GAC ACG GTC ATC CAC GCC GAC GCC AAC GCC GCC ATG TTC GCG GGC CTG GGC GCG TTC TTC w-g phe ala asp ile asp thr val ile his ala asp ala am ala ala met phe ala gly leu gly ala phe phe -73.5 2762-GAG GGG ATG GGC GAC CTG GGG CGC GCG GTC GGC AAG GTG GTG ATG GGA CTC GTG GGC GGC GTG GTA TCG GCC GTG glu gly met gly asp leu gly arg ala val gly lys ml val met gly leu vrl gly gly val val SW ala val -763 2837-TCG GGC GTG TCC TCC TTC ATG TCC AAC CCC TTT GGG GCG CTG GCC GTG GGT CTG TTG GTC CTG GCC GGC CTG GCG se,' gly val se? ser phe met ser as" pro phe gly ala leu ala val gly ,eu leu val leu ala gly leu ala -788 2912-GCG ala

GCC TTC TTC GCC TTT CGT TAC GTC ATG CGG CTG CAG AGC AAC CCC ATG AAG GCC CTG TAC CCT CTA ACC ACC ala phe phe ala phe arg tyr val met arg leu gln ser an pro met lys ala leu tyr pro leu thr thr -813

2987-AAG lys

GAG CTC AAG AAC CCC ACC MC CCG GAC GCG TCC GGG GAG GGC GAG GAG GGC GGC GAC TTT GAC GAG GCC AAG glu leu lys as" pro thr as" pro asp ala SW gly glu gly glu glu gly gly asp phe asp glu ala lys -838

3062-CTA GCC GAG GCC AGG GAG ATG ATA CGG TAC ATG GCC CTG GTG TCG GCC ATG GAG CGC ACG GAA CAC AAG GCC AAG leu ala glu ala at-9 glu met ile arg tyr met ala leu val ser ala met glu arg tkr glu his lys ala lys -863 3137-AAG AAG GGC ACG AGC CGG CTG CTC AGC GCC AAG GTC ACC GAC ATG GTC ATG CGC AAG CGC CGC AAC ACC AAC TAC lys lys gly thr ser arg leu ,eu se? ala lys val thr asp met val met arg lys arg arg as" thr as" tyr -888 3212-ACC thr

CAA GTT CCC AAC AAA GAC GGT GAC GCC GAC GAG GAC GAC CTG TGACGGGGGGTTTGTTGTAAATAAAAACCACGGGTGTTAA gin val pro as" lys asp gly asp ala asp glu asp asp leu END

3297-ACCGCATGCGCATCTrrrGGTTTTTTTGTTTGGTCAGCCTT~GTGTGTGTGTGG~A~~~AGG~CACATAAACTCCCCCGGGTGTCCGCGGC 3397-CTGTTTCCTCTTTCCTTTCCCGTGACAAAACGGACCCCCTTGGTCAGTGCC~TTTCCTCCCCCCCACGCCTTCCTCCACGTC~AGGCTTTTGCATTGi 3497-AAAGCTACCCGCCTACCCGCCCCTCCCAAAAATATACAGTA 3597-AGACATCCCATGGTACCAAAGACCGGGGCW\ATCAGCGGGCCCCCATCATCTGAGAGAC~ACAAATCGGCGGCGCGGGCCGTGTCAACGTCCACGTGTG 3697-CTGCGCTGCTGGCGTTGACAAGGCCCCGGCCTCCGCG~GGATGCTCCGGTTGG~TCC

FIG. 3-Continued.

CAGCA, that could hybridize with the 18 S rRNA sequence AGGAAGGCGT (Hagenbiichle et al, 1978) for eight out of ten nucleotides were located between residues 485 and 494,53 to 63 nucleotides before the ATG initiation codon. The codon usage and amino acid composition of the 100.3-kDa polypeptide are presented in Table 1. The overall G + C content in the coding region is 66%. The G + C content of the first, second, and third nucleotides of codons is 61, 46, and 92%, respectively. A high G + C content of the third-base codon position within the coding region of HSV genes was first noted in the HSV-1 thymidine kinase gene by Wagner et al. (1981). A strong preference for G or C in the third-base codon position also occurs in the gD (Watson et aZ., 1982), gC (Frink et ak, 1983), Vmwl2, and Vmw175 HSV-1 genes (Murchie and McGeoch, 1982), and may be a property of all HSV-1 genes. This undoubtedly reflects the high overall

GC content of the virus, which the highest for any organism.

IdentiJicatitm of the ts Lesim tsJ20

is among

of tsJ12 and

tsJ12 and tsJ20 are two temperaturesensitive viruses assigned to the l-9 complementation group. The mutations in these strains were recently physically mapped between 0.357 and 0.360 map units (tsJ12) and 0.360 and 0.364 (tsJ20) (DeLuca et aL, in preparation). Because of the fine-mapping data, it became a reasonable task to determine the specific nucleotide change(s) that cause temperature sensitivity of the mutants. Therefore, the EcoRI-F fragments (0.315 to 0.421 map units) of tsJ12 and tsJ20 were cloned into the unique EcoRI site of pBR325. SalI- and P&I-digested EcoRI-F (tsJ12) and SalI- and NurI-digested EcoRI-F (tsJ20) fragments were shotgun cloned M13mp8 and mpg. The

308

BZIK 0.345

0.350

0.355

I4axQ<<<<< II

I

<

0.365

0.360

<<< <

<<<

I 4 lllll<

I

ET AL.

F I I

<

< <<

III

0.370 TRLWXITION II

<

II

I

I

III

:

I-

3

FIG. 4. Analysis of available open translation reading frames. Open reading frames are measured by the distance between an initiation codon (<) and the adjacent termination codon (1) proceeding from right to left. The longest reading distance for each of the three frames is indicated by rectangular boxes. The size and location of the mRNA mapped to this region, and consistent with the DNA sequence analysis, is shown at the bottom of the figure.

relevant clones were identified (Fig. 5) and sequenced. No nucleotide changes were observed relative to wild type for recombinants 1 and 4 (not shown). The gels for recombinants 2 and 3 (Fig. 6) revealed a single substitution for each mutant. For tsJ12 the change occurred at a band that corresponds to nucleotide 1673 of Fig. 3; for tsJ20 the change occurred at nucleotide 1361. Both changes produce a single amino acid substitution in the 100.3-kDa poly-

TABLE

peptide, arginine to cysteine, at amino acid residue 376 for tsJ12 and valine to isoleutine at amino acid residue 272 for tsJ20 (Fig. 3). DISCUSSION

In the present study we have determined the nucleotide sequence of HSV-1 strain KOS between 0.370 and 0.345 map units and mapped a 3.1-kb RNA to these coor-

1

CODON USAGE AND PREDICTED AMINO ACID COMPOSITION OF THE 100.3-kDa POLYPEPTIDE 1st

2nd U (25%)

u (15%)

C (25%)

A (24%)

G (36%)

14 26 0 5

phe phe leu leu

c (27%) 0 19 0 14

ser ser ser ser

3rd A (29%)

G (19%)

0 37 0 0

1 10 1 10

tyr tyr stop stop

cys cys stop trp

Residue U C A G

ala aw asn

asp CYS gin

2 13 3 40

leu leu leu leu

2 24 8 20

pro pro pro pro

1 22 2 21

his his gln gln

1 38 2 24

arg arg arg arg

U C A G

0 24 3 24

ile ile ile met

1 44 0 24

thr thr thr thr

2 38 6 33

asn asn lys lys

1 14 0 2

ser ser arg arg

U C A G

dY his ile leu 1YS met phe pro

1 57 1 31

ala ala ala ala

4 asp 46 asp

4 IzlY 38 dY 2 fJlY 21 IzlY

U C A G

thr trp tw val

3 val 27 val

3 val 36 val

6 glu 48 glu

du

No. per molecule 90 67 40 50 11 23 54 65 23 27 63 39 24 40 54 48 69 10 37 69

NUCLEOTIDE

SEQUENCE

OF HSV-1

gB GENE

309

quences, were identified upstream from the putative start sites of the RNA. A G-rich sequence 10 nucleotides long begins 55 nuI I I I PS NO SI cleotides prior to the HSV-1 P-gene I 2 mRNAs for thymidine kinase (McKnight and Kingsbury, 1982) and about 75 nu3 4 ~ cleotides upstream from gD (Watson et al., FIG. 5. Sequencing strategy for determination of 1982). For gB there is a similar sequence the ts lesions of tdl2 and tsJ20. The tsJ12 ts lesion GGGGCGGGGG beginning about 125 nuis physically defined by the PstI (Ps) and SalI (Sl) cleotides before the mRNA start site that sites, and the tsJ20 ts lesion by the Sull and Nor1 agrees with the thymidine kinase sequence (Na) sites. The four M13/HSV-1 clones were conat 9 of the 10 nucleotides and with the gD structed for the mutant sequence determination. The corresponding wild-type clones were obtained from sequence at 8 of the 10 nucleotides. In adthe collection shown in Fig. 2. dition, an AG-rich sequence precedes the gD mRNA start site by about 60 nucleotides and is found about 150 nucleotides dinates. The 3.1-kb RNA appears to be upstream in the case of gB. These seunspliced and extends from 0.368 to 0.348 quences AGGAGGAG are identical for the map units. Our data are in agreement with two cases. An AG-rich region also begins those of Holland et ab (1979) who mapped 148 nucleotides before the thymidine kia 3.3-kb (p) mRNA to these sequences. nase gene (McKnight, 1980). DNA sequence analyses predicted an RNA All available evidence indicates that the of about 3050 nucleotides prior to polyA 100.3-kDa polypeptide constitutes the addition. Nucleotide sequences commonly polypeptide backbone of the glycoprotein found in the 5’ flanking region of eukaryotic gB of HSV-1. The location of the gene specgenes, representing CAT and TATA se- ifying the polypeptide coincides with phe-15otQ

0.356

C

0.360

G

a364

TA

C

KOS

G

tSJ20

1

A

C

G

T

A

KOS

FIG. 6. Autoradiograms of sequencing gels for mutant (tsJ12, tsJ20) and wild-type (KOS) DNA. For both gels the sequence originates at the SalI site at 0.360. Wild-type DNA sequences of the same fragments are shown on the left. For tsJ12 (clone 3 of Fig. 5) a single nucleotide difference is noted (*) at a band that corresponds to nucleotide 1673 of Fig. 3. For tsJ20 (clone 2 of Fig. 5) a single nucleotide substitution is apparent (*) at a band that corresponds to nucleotide 1361 of Fig. 3. The gel shown for tsJ20 is of the complementary strand to the strand shown in Fig. 3. The dideoxynucleotide present in each DNA synthesis reaction is shown at the top of each lane.

310

BZIK XhoI 0.3716

0.365 I

I

(a) 0

ET AL.

I

(41)

N-linked

BOlllttI 0.345

0.350 I I 3000

2ooo

1000

signal

0.355 I

0.360 I

sacch. (9)

membrane

i 4000

spanning

(441

internal

(109)

(b)

tsJ20 (cl

I I

I

1

99

213

tsJl2

peptide

I 1 356

II

mol.

IA

1

447

weight

632

710753

95.7

662

KD

FIG. 7. Glycoprotein character of the predicted 100.3-kDa polypeptide. (a) The 4 kb of HSV-1 DNA between the XhoI site at 0.3716 and the BornHI site at 0.345 map units are shown. (b) Glycoprotein character of the predicted 100.3~kDa polypeptide. The locations of the presumptive 41 amino acid signal sequence, the nine potential N-linked saccharide-addition sites, the presumptive 44 amino acid membrane-spanning sequence, and the highly charged presumptive internal 109 amino acid sequence are shown. (c) Predicted polypeptide product after removal of the presumptive 41 amino acid signal sequence. The polypeptide has a predicted length of 862 amino acids, with 710 of these expected to be external to the membrane. Locations of the potential N-linked saccharideaddition sites are denoted by short vertical bars. The location of the predicted amino acid changes in tsJ20 (residue 231) and tsJ12 (residue 335) in the mature polypeptide are shown.

notypes normally associated with gB. These include mutations causing temperature sensitivity for viral growth and the accumulation of gB, a mutation that alters an antigenic site on gB, and alterations in its fusion activity (rate of virus entry and the syn phenotype). The coding sequences for gB derived from the present study are well within the sequences assigned to the structural gene for gB (see Introduction). In addition, HSV-1 DNA representing 0.343 to 0.361 and 0.361 to 0.368 map units select mRNA that translates in u&o into polypeptides of approximately 100 kDa and that are precipitable with gB polyclonal antisera (L. Rafield and D. Knipe, submitted). Some significant features of the polypeptide are summarized in Fig. 7. It has glycoprotein character, including a signal sequence (41 amino acids), a hydrophobic

membrane-spanning sequence (44 amino acids), and a highly charged cytoplasmic anchor sequence (109 amino acids). Removal of the presumptive signal sequence gives an 862 amino acid polypeptide of molecular weight 95.7 kDa (Fig. 7~). The size of the gB polypeptide has been estimated between 92 and 98 kDa (Bond et aL, 1982; Norrild and Pederson, 1982; Kousoulas et aL, 1983; Wenske and Courtney, 1983). The presence of nine possible N-linked saccharide-addition sites (asn-X-ser/thr) on the polypeptide is sufficient to account for the observed sizes of the high-mannose precursor to gB, pgB (-110 kDa), and the mature form of gB (-120 kDa) (Wenske et aL, 1982). Since gB retains partial sensitivity to endoglycosidase H (Wenske et aL, 1982; Johnson and Spear, 1983) it is likely that not all sites are fully glycosylated on any one gB molecule. Three of the sites in

NUCLEOTIDE

SEQUENCE

the gB peptide have the sequence asn-proser/thr, a sequence that is not glycosylated in some glycoproteins (see, for example, Gething et al, 1980). The mature form of gB is presumably due to the further maturation of saccharides, including the presence of a small number of O-linked saccharides (Johnson and Spear, 1983). The positions of the point mutations in tsJ12 and tsJ20 were determined and are shown in Fig. 7. These mutations are representative of the class that cause HSV-1 to become temperature sensitive for viral growth and the accumulation of pgB. Both mutations are GC to AT transitions. For tsJ20 the change is GUC(va1) to AUC(ile) at residue 231, and for tsJ12 the change is CGC(arg) to UGC(cys) at residue 335 in the mature peptide. tsJ20 was isolated in this laboratory by in vitro mutagenesis of cloned HSV-1 (KOS) DNA representing 0.345 to 0.368 map units, using hydroxylamine mutagenesis (100 mM) at ‘75” for 30 min (DeLuca et a.$ in preparation). GC to AT transitions should predominate in single-stranded, and therefore AT-rich, stretches of DNA (Freese and Strack, 1962). The GC to AT transition creating tsJ20 occurred in a relatively AT-rich region (62% A + T; 8 of 13 residues are A + T, see Fig. 6) relative to 34% A + T in the overall gB gene. It is disappointing that all mutants so far isolated have the same phenotype; the precursor pgB but not the mature glycoprotein gB is formed at the nonpermissive temperature. Presumably this results from a common processing defect in all of the mutants (DeLuca et aZ., in preparation). Informative structure-function relationships in gB will require the isolation of a broader spectrum of mutants; this is now underway in this laboratory. The nucleotide sequence of most of the gB gene of HSV-2, as well as noncoding regions, has been determined and will be presented elsewhere. However, one point should be noted here. The 5’ region of both genes, including signals for transcription as well as untranslated mRNA sequences, is highly conserved and appears to encode part of another gene whose amino acid

OF HSV-1

gB GENE

311

coding sequences could end at the TAG, 10 nucleotides prior to the start codon of gB. ACKNOWLEDGMENTS We gratefully acknowledge many helpful suggestions from Dr. Ross Hardison and discussions with Dr. Chitrita DebRoy, Nels Pederson, and Wei-Zhong Cai. We thank Dr. Roger Everett for drawing to our attention the G-rich and AG-rich regions preceding the gD mRNA start site, and Dr. David Knipe for communicating his unpublished results. This work was supported by grants from the National Institutes of Health and the American Cancer Society. REFERENCES ANDERSON, K. P., FRINK, R. J., DEVI, G. B., GAYLORD, B. H., COSTA, R. H., and WAGNER, E. K. (1981). Detailed characterization of the mRNA mapping in the Hind111 fragment K region of the herpes simplex virus type 1 genome. .I Vird 37,1011-1027. BAUCKE, R. B., and SPEAR, P. G. (1979). Membrane proteins specified by herpes simplex viruses. V. Identification of an Fc-binding glycoprotein. J. Virol 32, 779-789. BENOIST, C., O’HARE, K., BREATHNACH, R., and CHAMBON, P. (1980). The ovalbumin gene-sequence of putative control regions. NucL Acids Res. 8, 127-142. BIRNBOIM, H. C., and DOLY, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucl Acids Res. 7, 1513-1523. BOLIVAR, F., RODRIGUEZ, R. L., BETLACH, M. C., and BOYER, H. W. (1977). Construction and characterization of new cloning vehicles. I. Ampicillin-re-sistant derivatives of the plasmid pMB9. Gene 2. 75-93. BOND, V. C., PERSON, S., and WARNER, S. C. (1982). The isolation and characterization of mutants of herpes simplex virus type 1 that induce cell fusion .J. Gen. Viral. 61, 245-254. BREATHNACH, R., and CHAMBON, P. (1981). Organi-zation and expression of eukaryotic split genes coding for proteins. Annu. Rev. &o&em. 50,349-383. BLJSSLINGER, M., PORTMAN, R., IRMINGER, J., and BIRNSTEIL, M. (1980). Ubiquitous and gene-specific regulatory 5’ sequences in a sea urchin histone DNA clone coding for histone protein variants. Nucl. Acids Res. 8, 957-978. COHEN, S. N., CHANG, A. C., and Hsu, C. L. (1972). Nonchromosomal antibiotic resistance in bacteria: Genetic transformation of Escherichia cdi by Rfactor DNA. Proc. Nat. Acad Sci. USA 69, 21102114. COSTA, R. H., DEVI, B. G., ANDERSON, K. P., GAYLORD, B. H., and WAGNER, E. K. (1981). Characterization of major late herpes simplex virus type 1 mRNA. J. Viral. 38, 483-496.

312

BZIK

DELUCA, N., BZIK, D. J., BOND, V. C., PERSON, S., and SNIPES, W. (1982). Nucleotide sequences of herpes simplex virus type 1 (HSV-1) affecting virus entry, cell fusion, and production of glycoprotein gB (VP7). Virology 122,411-423. EBERLE, R., and COURTNEY, R. J. (1980). gA and gB glycoproteins of herpes simplex virus type 1: Two forms of a single polypeptide. J. Viral 36,665-675. EFSTRATIADIS, A., POSAKONY, J. W., MANIATIS, T., LAWN, R. M., O’CONNELL, C., SPRITZ, R. A., DERIEL, J. K., FORGET, B. G., WEISSMAN, S. M., SLIGHTOM, J. L., BLECHL, A. E., SMITHIES, O., BARALLE, F. E., SHOULDERS, C. C., and PROUDFOOT, N. J. (1980). The structure and evolution of the human j3-globin gene family. Cell 21, 653-668. FITZGERALD, M., and SHENK, T. (1981). The sequence 5’-AAUAAA-3’ forms part of the recognition site for polyadenylation of late SV40 mRNAs. Cell 24, 251-260. FREESE, E., and STRACK, H. B. (1962). Induction of mutations in transforming DNA by hydroxylamine. Proc. Nat. Acad Sci. USA 43, 1’796-1803. FRINK, R. J., ANDERSON, K. P., and WAGNER, E. K. (1981). Herpes simplex virus type 1 Hind111 fragment L encodes spliced and complementary mRNA species. J. Viral. 39, 559-572. FRINK, R. J., EISENBERG, R., COHEN, G., and WAGNER, E. K. (1983). Detailed analysis of the portion of the herpes simplex virus type I genome encoding glycoprotein C. J. ViroZ. 45, 634-647. GANNON, F., O’HARE, K., PERRIN, F., LEPENNEE, J., BENOIST, C., COCHET, M., BREATHNACH, R., GARAPIN, A., CAMI, B., and CHAMBON, P. (1979). Organisation and sequences at the 5’ end of a cloned complete ovalbumin gene. Nature (London) 278,428-434. GAROFF, H., FRISCHAUF, A.-M., SIMONS, K., LEHRACH, H., and DELIUS, H. (1980). Nucleotide sequence of cDNA coding for Semliki Forest virus membrane glycoproteins. Nature (London) 288, 236-241. GETHING, M.-J., BYE, J., SKEHEL, J., and WATERFIELD, M. (1980). Cloning and DNA sequence of doublestranded copies of haemagglutinin genes from H2 and H3 strains elucidates antigenic shift and drift in human influenza virus. Nature (London) 280,301306. GODOWSKI, P. J., and KNIPE, D. M. (1983). Mutations in the major DNA-binding protein gene of herpes simplex virus type 1 result in increased levels of viral gene expression. J. Viral. 47, 478-486. GOLDIN, A. L., SANDRI-GOLDIN, R. M., LEVINE, M., and GLORIOSO, J. C. (1981). Cloning of herpes simplex virus type 1 sequences representing the whole genome. J. ViroL 38, 50-58. HAGENB~CHLE, O., SANTER, M., STEITZ, J. A., and MANS, R. J. (1978). Conservation of the primary structure at the 3’ end of 18s rRNA from eukaryotic cells. CeU 13, 551-563.

ET AL. HEIDECKER, G., MESSING, J., and GRONENBORN, B. (1980). A versatile primer for DNA sequencing in the M13mp2 cloning system. Gene 10, 69-73. HOLLAND, L. E., ANDERSON, K. P., STRINGER, J. R., and WAGNER, E. K. (1979). Isolation and localization of herpes simplex virus type 1 mRNA abundant before viral DNA synthesis. J. ViroL 31,447-462. HOLLAND, T. C., MARLIN, S. D., LEVINE, M., and GLORIOSO, J. C. (1983a). Antigenic variants of herpes simplex virus selected with glycoprotein-specific monoclonal antibodies. J. Viral. 45, 672-682. HOLLAND, T. C., SANDRI-GOLDIN, R. M., HOLLAND, L. E., MARLIN, S. D., LEVINE, M., and GLORIOSO, J. C. (1983b). Physical mapping of the mutation in an antigenic variant of herpes simplex virus type 1 by use of an immunoreactive plaque assay. J. Viral 46, 649-652. HONESS, R. W., BUCHAN, A., HALLIBURTON, I. W., and WATSON, D. H. (1980). Recombination and linkage between structural and regulatory genes of Herpes Simplex Virus type 1: Study of the functional organization of the genome. J. Viral. 34,716-742. HOWARTH, A. J., GARDNER, R. C., MESSING, J., and SHEPHERD, R. J. (1981). Nucleotide sequence of naturally occurring deletion mutants of cauliflower mosiac virus. Virology 112, 678-685. HUBBARD, S. C., and IVATT, R. J. (1981). Synthesis and processing of asparagine-linked oligosaccharides. Annu. Rev. Biochem. 50, 555-583. JOHNSON, D. C., and SPEAR, P. G. (1983). O-linked oligosaccharides are acquired by herpes simplex virus glycoproteins in the Golgi apparatus. Cell 32, 987-997. KOUSOULAS, K. G., BZIK, D. J., DELUCA, N., and PERSON,S. (1983). The effect of ammonium chloride and tunicamycin on the glycoprotein content and infectivity of herpes simplex virus type 1. Virology 125, 468-474. KOZAK, M. (1978). How do eucaryotic ribosomes select initiation regions in the messenger RNA? Cell 15, 1109-1123. KOZAK, M. (1981). Possible role of flanking nucleotides in recognition of the AUG initiator codon by eukaryotic ribosomes. Nucl. Acids Res. 9,5233-5252. KREIL, G. (1981). Transfer of proteins across membranes. Annu. Rev. B&hem 50,317-348. LARSON, R., and MESSING, J. (1982). Apple II software for Ml3 shotgun DNA sequencing. Nuel Acids Res. 10, 39-49. LEWIN, B. (1980). Gene Expression 2, 2nd ed., John Wiley, New York. LITTLE, S. P., JOFRE, J. T., COURTNEY, R. J., and SCHAFFER, P. A. (1981). A virion-associated glycoprotein essential for infectivity of herpes simplex virus type 1. Virology 115,149-160. MANIATIS, T., JEFFREY, A., and KLEID, D. G. (1975).

NUCLEOTIDE

SEQUENCE

Nucleotide sequence of the rightward operator of phage X. Proc. Nat. Acad. Sci. USA 72,1184-1188. MANIATIS, T., FRITSCH, E. F., and SAMBROOK, J. (1982). “Molecular Cloning, a Laboratory Manual.” Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. MANSERVIGI, R., SPEAR, P. G., and BUCHAN, A. (1977). Cell fusion induced by herpes simplex virus is promoted and suppressed by different viral glycoproteins. Pruc. Nat. Aead Sci. USA 74,3%X3-3917. MARSDEN, H. S., STOW, N. D., PRESTON, V. G., TIMBURY, M. C., and WILKIE, N. M. (1978). Physical mapping of herpes simplex virus-induced polypeptides. J. ViroL 28, 624-642. MCDONELL, M. W. SIMON, M. N., and STUDIER, F. W. (1977). Analysis of restriction fragments of T7 DNA and determination of molecular weights by electrophoresis in neutral and alkaline gels. J. Mol. BioL 110, 119-146. MCKNIGHT, S. L. (1980). The nucleotide sequence and transcript map of the herpes simplex virus thymidine kinase gene. NucL Acids Res. 8, 5949-5964. MCKNIGHT, S. L., and KINGSBURY, R. (1982). Transcriptional control signals of a eukaryotic proteincoding gene. Science (Wo.shington,J 217, 316-324. MESSING, J., CREA, R., and SEEBURG, P. (1981). A system for shotgun DNA sequencing. NucL Acids Res. 9, 309-321. MESSING, J., and VIEIRA, J. (1982). A new pair of Ml3 vectors for selecting either strand of double-digest restriction fragments. Gene 19, 269-276. MILLER, J. H. (1972). “Experiments in Molecular Genetics.” Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. MURCHIE, M.-J., and MCGEOCH, D. J. (1982). DNA sequence analysis of an immediate-early gene region of the herpes simplex virus type 1 genome (map coordinates 0.950 to 0.978). J. Gen. ViroL 62, 1-15. NORRILD, B. (1980). Immunochemistry of herpes simplex virus glycoproteins. Curr. Topics MicrobioL ImmunoL SO, 67-106. NORRILD, B., and PEDERSON, B. (1982). Effect of tunicamycin on the synthesis of herpes simplex virus type 1 glycoproteins and their expression on the cell surface. J. Viral. 43, 395-402. PALMITER, R. D. (1974). Magnesium precipitation of ribonucleoprotein complexes. Expedient techniques for the isolation of undegraded polysomes and messenger ribonucleic acid. Biochemistry 13,3606-3615. PARA, M. F., BAUC‘KE, R. B., and SPEAR, P. G. (1982). Gycoprotein gE of herp& simplex virus type 1: Effects of anti-gE on virion infectivity and on virusinduced Fc-binding receptors. J. ViroL 41,129-136. PEREIRA, L., DONI~ERO, D., NORRILD, B., and ROIZMAN, B. (1981). Differential immunologic reactivity and processing of glycoproteins gA and gB of herpes

OF HSV-1

gB GENE

313

simplex virus types 1 and 2 made in Vero and Hep2 cells. Proc. Nat. Acad. Sci USA 78, 5202-5206. PERSON, S., KNOWLES, R. W., READ, G. S., WARNER, S. C., and BOND, V. C. (1976). Kinetics of cell fusion induced by a syncytia-producing mutant of herpes simplex virus type 1. J. ViroL 17, 183-190. PERSON, S., KOUSOLJLAS,K. G., KNOWLES, R. W., READ, G. S., HOLLAND, T. C., KELLER, P. M., and WARNER, S. C. (1982). Glycoprotein processing in mutants of HSV-1 that induce cell fusion. Virology 117, 2%306. PROUDFOOT,N., and BROWNLEE, G. (1976). 3’ noncoding region sequences in eukaryotic mRNA. N&ure (London) 263, 211-214. ROSE, J. K., WELCH, W. J., SAFTON, B. M., EXII, F. 8, and LINE, N. C. (1980). Vesicular stomatitis virus glycoprotein is anchored in the viral membrane by a hydrophobic domain near the COOH terminus. Proc. Nat. Acad Sci. USA 77, 38843888. ROSE, J. K., and BERGMANN, J. E. (1982). Expression from cloned cDNA of cell-surface secreted forms of the glycoprotein of vesicular stomatitis virus in eukaryotic cells. Cell 30, 753-762. RUYECHAN, W. T., MORSE, L. S., KNIPE, D. M., and ROIZMAN, B. (1979). Molecular genetics of herpes simplex virus. II. Mapping of the major viral glycoproteins and of genetic loci specifying the social behavior of infected cells. J. ViroL 29, 677-697. SANGER, F., NICKLEN, 8, and COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Nat. Acad. Sci. USA 74, 5463-5467. SARMIENTO, M., HAFFEY, M., and SPEAR, P. G. (1979). Membrane proteins specified by herpes simplex virus. III. Role of glycoprotein VP7 (Bz) in virion infectivity. J. ViroL 29, 1149-1158. SCHAFFER, P. A., ARON, G. M., BISWAL, N., and BE~IYESH-MELNICK, M. (1973). Temperature-sensitive mutants of herpes simplex virus type 1: Isolation, complementation and partial characterization. Virology 52, 57-71. SCHAFFER, P. A., CARTER, V. C., and TIMBURY, M. C. (1978). Collaborative complementation study of temperature-sensitive mutants of herpes simplex virus types 1 and 2. J. ViroL 27, 490-504. SERAFINI-CESSI, F., and CAMPADELLI-FIUME, G. (1981). Studies on Benzhydrazone, a specific inhibitor of herpesvirus glycoprotein synthesis. Size distribution of glycopeptides and endo+N-acetyl-glucosaminidase-H treatment. Arch. ViroL 70, 331-343. SHINE, J., and DALGARNO, L. (1974a). The 3’-terminal sequence of Eschetichia coli 16s ribosomal RNA: Complementarity to nonsense triplets and ribosome binding sites. Proc. Nat. Acad. Sci. IJSA 71, 13421346. SHINE, J., and DALGARNO, L. (1974b). Identical 3’-terminal octanucleotide sequence in 1% ribosomal ri-

BZIK

314 bonucleic acid from different .I. 141,609-615.

eukaryotes.

B&hem

SMITH, H. 0. (1980). In “Methods of Enzymology” (L. Grossman and K. Moldave, eds.), Vol. 65, pp. 371380. Academic Press, New York. SPEAR, P. G. (1976). Membrane proteins specified by herpes simplex virus. I. Identification of four glycoprotein precursors and their products in type linfected cells. J. viral 17, 991-1008. THOMAS, P. S. (1980). Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Nat. Acad Sci. USA 77,5201-5205. WAGNER, M. J., SHARP, J. A., and SUMMERS, W. C. (1981). Nucleotide sequence of the thymidine kinase

ET AL. gene of herpes simplex virus type 1. Proc Nat. Acad Sti USA ‘f&1441-1445. WATSON, R. J., WEIS, J. H., SALSTROM, J. S., and ENQUIST, L. W. (1982). Herpes simplex virus type-l glycoprotein D gene: Nucleotide sequence and expression in Eschekhiu cd Sciaee (Washingtm) 218,381~384. WENSKE, E. A., BRATTON, M. W., and COURTNEY, R. J. (1982). Endo-P-N-acetylglucosaminidase H sensitivity of precursors to herpes simplex virus type 1 glycoproteins gB and gC. J. viral. 44, 241248. WENSKE, E. A., and COURTNEY, R. J. (1983). Glycosylation of herpes simplex virus type 1 gC in the presence of tunicamycin. J. Viral. 46,297-301.