Occurrence and antibiotic susceptibility of Helicobacter pullorum from broiler chickens and commercial laying hens in Italy

International Journal of Food Microbiology 116 (2007) 168 – 173 www.elsevier.com/locate/ijfoodmicro

Occurrence and antibiotic susceptibility of Helicobacter pullorum from broiler chickens and commercial laying hens in Italy R.G. Zanoni a,⁎, M. Rossi a , D. Giacomucci a , V. Sanguinetti a , G. Manfreda b a

b

Department of Veterinary Public Health and Animal Pathology, Alma Mater Studiorum, University of Bologna, Via Tolara di Sopra 50, 40064 Ozzano dell'Emilia, Bologna, Italy Department of Food Science, Alma Mater Studiorum, University of Bologna, Via S. Giacomo 9, 40126 Bologna, Italy Received 10 May 2006; received in revised form 17 November 2006; accepted 28 December 2006

Abstract In 2005, in order to investigate the occurrence of Helicobacter pullorum in poultry, the caecal contents collected from a total of 60 animals intensively reared in Italy on 15 different farms (9 farms of broiler chicken and 6 of laying hens) were examined at the slaughterhouse. A modified Steele–McDermott membrane filter method was used. Small, greyish-white colonies of Gram-negative, gently curved, slender rod bacteria were preliminarily identified as H. pullorum by a Polymerase Chain Reaction (PCR) assay based on 16S rRNA and were then subjected to an ApaLI digestion assay to distinguish H. pullorum from Helicobacter canadensis. One isolate from each farm was phenotypically characterized by biochemical methods and 1D SDS-PAGE analysis of whole cell proteins; antibiotic susceptibility was also tested. According to the PCR and PCRRFLP results, all the animals examined were positive for H. pullorum. The 1D SDS-PAGE whole protein profile analysis showed high similarity among the 15 isolates tested. A monomodal distribution for the Minimum Inhibitory Concentrations (MICs) was found for ampicillin, chloramphenicol, gentamicin and tetracycline. For erythromycin and ciprofloxacin, a bimodal trend having a second peak at N 128 μg ml− 1 and 32 μg ml− 1 was found. The isolation method used in this study seems to be highly suitable for isolating H. pullorum from chicken caecal contents. Moreover, the detection of a high number of colonies phenotypically similar to H. pullorum suggests that this microorganism, when present, colonizes the caecum at high concentration. © 2007 Elsevier B.V. All rights reserved. Keywords: Helicobacter pullorum; Broiler chicken; Laying hen; Isolation; Minimum Inhibitory Concentration

1. Introduction The genus Helicobacter, belonging to the class Epsilonproteobacteria, was created in 1989 and it currently comprises 23 validly published species of microaerobic, Gram-negative, curved, spiral or fusiform bacteria. Helicobacter species have been found in the intestinal tract, oral cavity and internal organs of man and animals and may be associated with different diseases, generally related to their natural ecological niche. Gastric species, such as Helicobacter pylori, are well-established as the leading microbiological cause of gastric and duodenal ulcers and gastric cancer in humans. On the contrary, several species, commonly present in the lower gastrointestinal tract, are infre⁎ Corresponding author. Tel.: +39 0512097066; fax: +39 0512097039. E-mail address: [email protected] (R.G. Zanoni). 0168-1605/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2006.12.007

quently reported as primary agents of disease in humans even if they have been isolated from different cases of gastroenteritis, hepatitis, cholangiofibrosis or pancreatitis lesions (On et al., 2005). Helicobacter pullorum, a urease-negative organism with unsheathed flagella, was classified as a new species of Helicobacter by Stanley et al. (1994) on the basis of 16S rRNA phylogenetic analysis. This organism has been isolated from the livers and intestinal contents of laying hens with vibrionic hepatitis and from the caeca of broiler chickens (Stanley et al., 1994; Burnens et al., 1996; Atabay et al., 1998). H. pullorum has been also isolated from faeces of humans with gastroenteritis (Burnens et al., 1994; Steinbrueckner et al., 1997; Melito et al., 2000; Ceelen et al., 2005a) and its DNA has been detected in livers from patients with primary sclerosing cholangitis, cirrhosis and hepatocellular carcinoma (Ponzetto et al., 2000; Pellicano et al., 2004; Rocha

R.G. Zanoni et al. / International Journal of Food Microbiology 116 (2007) 168–173

et al., 2005), although it was unclear if the organism had a causal role in these infections (Gibson et al., 1999). As poultry carcasses can be contaminated by H. pullorum (Atabay et al., 1998) during slaughtering, the potential role of this bacteria as an emerging foodborne human pathogen needs to be considered. There is no ideal method for the isolation of all Helicobacter species (On et al., 2005) and an accurate identification of these bacteria is known to be a difficult task (On, 1996). In particular, the two traits which can be used as phenotypic markers for Helicobacter spp., i.e. the presence of sheathed flagella and resistance to polymyxin B, are absent in H. pullorum. Therefore, H. pullorum strains may be easily misidentified as Campylobacter spp., in particular C. coli and C. lari with which several key phenotypic traits are shared (Atabay et al., 1998; Kuijper et al., 2003). At present, it is well-known that the recovery of H. pullorum can be optimized by examining the freshest possible samples (On et al., 2005) and by the use of non-selective methods or of selective media without polymyxin B (Atabay et al., 1998). Moreover, the best strategy for identifying this organism, as well as for all epsilon bacteria, seems to be the use of a combination of different phenotypic and genotypic methods (On, 1996). Since studies on the prevalence of H. pullorum in poultry are rare (Burnens et al., 1996; Atabay et al., 1998; Ceelen et al., 2006), the aims of this study were to investigate the occurrence of H. pullorum using the cultural method in the caecal contents of poultry collected at the slaughterhouse in Italy, and to provide more phenotypic data about the species. In addition, as there is little information in the literature about H. pullorum antibiotic resistance (Ceelen et al., 2005b), an objective of this study was also to investigate the susceptibility of the isolates to different antimicrobial agents using the agar dilution method. 2. Materials and methods

169

serum and 7.5 g of glucose (Sigma Chemical Co, St. Louis, MO 63178, USA) (Ceelen 2005, personal communication). Samples were then inoculated on BBL-Brucella Agar (BD) supplemented with 5% sheep blood using the modified filter technique of Steele and McDermott (1984). In brief, 300 μl of each diluted sample was spread on a 47 mm, 0.65 μm pore size sterile filter (DAWP04700, Millipore Corporation, Bedford, MA 01730, USA) previously placed on the agar surface. The plate was incubated upright at 37 °C for 1 h in a microaerobic atmosphere with hydrogen in a jar (Oxoid, LTD., Basingstoke, Hampshire, UK). The microaerobic atmosphere with hydrogen was obtained by the gas replacement method (Bolton et al., 1992) with an anaerobic gas mixture (10% H2, 10% CO2, 80% N2). After incubation, the filter was removed and the agar surface streaked with a loop. The plate was then incubated again under the same conditions as described above for a week and examined daily for growth. Five small, greyish-white colonies of Gram-negative, gently curved, slender rod bacteria were subcultured from each plate. 2.2. Identification One suspected colony from each sample was preliminarily identified as H. pullorum by the Polymerase Chain Reaction (PCR) assay described by Stanley et al. (1994) using the REDExtract-N-Amp Tissue PCR Kit (Sigma) and the following primers: 5′ ATGAATGCTAGTTGTTGTCAG 3′ and 5′ GATTGGCTCCACTTCACA 3′. Moreover, in order to distinguish H. pullorum from Helicobacter canadensis, the PCR product amplified using primers C97 (5′ GCTATGACGGGTATCC 3′) and C05 (5′ ACTTCACCCCAGTCGCTG 3′) was subjected to the ApaLI (Fermentas, International INC, Burlington, ON, Canada) digestion assay as described by Fox et al. (2000). Finally, to provide more phenotypic data about H. pullorum, one isolate randomly collected from each farm was subjected to biochemical tests and 1D SDS-PAGE analysis of whole cell proteins and tested for antibiotic susceptibility.

2.1. Sampling and isolation 2.3. Biochemical tests The caecal contents collected from a total of 60 animals reared on 15 different poultry farms (4 animals per farm) were examined at the slaughterhouse between January and May 2005. The samples were taken from 9 commercial laying hens and 6 broiler chicken farms, all located in northern Italy. Samples were collected and processed avoiding cross-contamination. The complete intestinal tract from each bird was obtained directly after evisceration and packed into a separate sterile plastic bag using fresh disposable gloves, kept cool and examined within 5 h after sampling. The caeca were then aseptically severed and their surfaces were decontaminated using ethylic alcohol. Approximately 5 g of caecal contents were squeezed into 5 ml of sterile saline and shaken using a vortex mixer in order to obtain a homogenous suspension. An aliquot of 100 μl of each sample was diluted in 400 μl of a sterile mixture containing 25 ml of Bacto-Brain Heart Infusion (BD-Becton, Dickinson and Company, Sparks, MD 21152, USA), 75 ml of inactivated horse

The biochemical characterization of the isolates was performed using the following tests: cytochrome oxidase, urease, catalase, γ-glutamyltranspeptidase and alkaline phosphatase production, hippurate and indoxyl acetate hydrolysis, hydrogen sulphide production in triple sugar iron (Oxoid), nitrate reduction, growth under an increased-H2 microaerobic atmosphere in the presence of 1% (w/v) glycine and 1% (w/v) bile, at 25 °C, 42 °C and on Difco-MacConkey Agar (BD), growth at 37 °C in aerobic and anaerobic conditions and under microaerobic atmosphere with and without hydrogen, susceptibility to nalidixic acid and cephalotin determined by standard disk diffusion method with a 30 μg disk (BBL, Becton, Dickinson and Company). γ-Glutamyltranspeptidase production was carried out as recommended by Chevalier et al. (1999) using Helicobacter canis ATCC 51401 and H. pullorum ATCC 51801 as quality control strains. The growth under a microaerobic atmosphere without

170

R.G. Zanoni et al. / International Journal of Food Microbiology 116 (2007) 168–173

Table 1 Phenotypic characteristics of the 15 isolates of Helicobacter pullorum compared with those of field strains isolated by Atabay et al. (1998) and with those of type and reference strains (On et al., 1996) using the same test methods Phenotypic tests

Percentage positive for strains from This The study of Atabay The study of On study et al. (1998) et al. (1996)a

Number of strains

15

18

10

Gram-negative Oxidase Catalase Urease Hippurate hydrolysis γ-Glutamyltranspeptidase Alkaline phosphatase Indoxyl acetate hydrolysis Trace H2S in TSI Nitrate reduction Growth on special media MacConkey Growth on media containing 1% (w/v) glycine 1% (w/v) bile Growth at 37 °C (mO2) 37 °C (mO2 without H2) 37 °C (O2) 37 °C (AnO2) 42 °C (mO2) 25 °C (mO2) Resistant to Nalidixic acid (30 μg) Cephalotin (30 μg)

100 100 93 0 0 0 40 0 87 100

100 100 89 0 0 0b 11 0 100 83

99 99 88 01 01 NA 01 01 50 99

0

0

01

0 100

0 72

01 88

100 93 0 100 100 0

100 0 0 94 78 0

99 NA 01 99 99 01

7 100

28 c 89 c

06 c 99 c

NA, not available; mO2, microaerobically plus H2; O2, aerobically; AnO2, anaerobically; TSI, triple sugar iron agar. a Values of 0 and 100 were adjusted to 01 and 99 respectively to enable numeric comparison (see On et al., 1996 for details). b Data obtained by API CAMP system (BioMèriuex). c Data obtained as described by On and Holmes (1991a).

culated by the Pearson product moment correlation coefficient using UPGMA as a clustering method (Costas, 1992). 2.5. Antibiotic susceptibility testing The Minimum Inhibitory Concentration (MIC) value of ampicillin, ciprofloxacin, chloramphenicol, erythromycin, gentamicin and tetracycline was determined according to the agar dilution method described by the Clinical and Laboratory Standard Institute (CLSI, formerly NCCLS) for Campylobacter jejuni and related species (NCCLS, 2002). The method was modified as follows: (i) the medium used was represented by Nutrient Broth N.2 (Oxoid) supplemented with 1.5% Bacto Agar (BD) and 5% defibrinated sheep blood, (ii) the plates were incubated at 37 °C under microaerobic atmosphere with hydrogen and read after 48 h. All antimicrobial agents were purchased from Sigma, except for ciprofloxacin which was obtained from Bayer AG (Leverkusen, Germany). The antibiotic concentrations ranged from 0.015 to 128 μg ml− 1. For all isolates, a final inoculum of 2 μl containing about 4–5 log CFU was seeded as a spot on agar plates. C. jejuni ATCC 33560 was used as a quality control strain for ciprofloxacin, erythromycin, gentamicin and tetracycline (NCCLS, 2002) whereas Escherichia coli ATCC 25922 and Staphylococcus aureus ATCC 29213 were used as quality control strains for ampicillin and chloramphenicol (NCCLS, 2004). 3. Results According to the PCR and PCR-RFLP results, all the 60 animals examined, reared on 15 different farms, were positive for H. pullorum. After 72–96 h of incubation, all the first

hydrogen was performed as described by Atabay et al. (1998). All the other tests were carried out as recommended by On and Holmes (1991a,b, 1992), On et al. (1996) and by Dewhirst et al. (2000). 2.4. 1D SDS-PAGE analysis of whole cell proteins Whole cell proteins of two day old bacterial cultures were extracted at 95 °C for 10 min in NuPAGE™ LDS Sample Buffer (Invitrogen Life Technologies, Carlsbad, CA 92008 USA) supplemented with NuPAGE™ Sample Reducing Agent (Invitrogen) and separated by electrophoresis in polyacrylamide gel. In brief, 7–8 μg of each extract was loaded on NuPAGE™ Novex 4–12% Bis Tris Gelformat 1.0 mm 10 wells (Invitrogen) and was run for 140 min at constant current (30 mA) and temperature (5 °C). Protein bands were stained by Simply Blue Safestain™ (Invitrogen); the profile was digitized by FLUOR-S MultiImager (Bio-rad Laboratories, Hercules, CA 94547 USA) and subjected to comparative numerical analysis using Diversity Database (Bio-rad). Similarity among protein profiles was cal-

Fig. 1. Protein profile in 1D SDS-PAGE of 6 isolates of Helicobacter pullorum. Lanes 1 and 10, molecular mass markers; lane 2, strain 208/05; lane 3, strain 209/05; lane 4, strain 210/05; lane 5, strain 211/05; lane 6, strain 212/05; lane 7, strain 213/05; lane 8, Helicobacter pullorum ATCC 51801; lane 9, Helicobacter canis ATCC 51401.

R.G. Zanoni et al. / International Journal of Food Microbiology 116 (2007) 168–173

171

Fig. 2. Dendrogram of 15 Helicobacter pullorum isolates based on UPGMA cluster analysis 1D SDS-PAGE whole cell protein profiles. ⁎ATCC 51101T, Helicobacter acinonychis; CCUG 33637T, Helicobacter hepaticus; ATCC 35684T Helicobacter fennelliae; ATCC 51401T Helicobacter canis; ATCC 51630T Helicobacter bilis; ATCC 49308 “Helicobacter (Flexispira) rappini”; CCUG 18818T, Helicobacter cinaedi; ATCC 51801T, Helicobacter pullorum.

isolation plates showed a large number of pinpoint greyishwhite colonies (N 50 CFU) of Gram-negative slender curved rods referable to H. pullorum. The results of the biochemical tests of the 15 isolates of H. pullorum are shown in Table 1 and are compared with the data obtained by other authors. All isolates were positive for oxidase activity, nitrate reduction, growth at 42 °C, under anaerobic conditions and in the presence of 1% bile. Moreover, they were negative for urease and γ-glutamyltranspeptidase production, hippurate and indoxyl acetate hydrolysis, growth at 25 °C, in aerobic conditions, on MacConkey medium and in the presence of 1% glycine. Growth under a microaerobic atmosphere without hydrogen was observed in 14 out of 15 isolates and catalase, H2S and alkaline phosphatase were produced by 14, 13 and 6 isolates, respectively. All isolates were resistant to cephalotin and all but one susceptible to nalidixic acid.

The protein profiles of the isolates tested did not show any significant difference in comparison with the protein profile of the type strain H. pullorum ATCC 51801 (Fig. 1). Overall, the similarity level among the protein profiles of the isolates tested was 88% (Fig. 2). Comparison between the protein profiles of the isolates tested and those of the reference strains Helicobacter acinonychis ATCC 51101, Helicobacter hepaticus CCUG 33637T, Helicobacter fennelliae ATCC 35684, H. canis ATCC 51401, Helicobacter bilis ATCC 51630, “Helicobacter (Flexispira) rappini” ATCC 49308 and Helicobacter cinaedi CCUG 18818 showed that the nearest neighbour is represented by H. cinaedi CCUG 18818 which exhibited an 81% similarity with the poultry isolates. The distribution of the MIC values of the 15 isolates tested is shown in Table 2. A monomodal distribution for the MICs was found for all the antibiotics tested except for erythromycin and

Table 2 Distribution of MICs for 15 Helicobacter pullorum isolates Antimicrobials

Ampicillin Ciprofloxacin Chloramphenicol Erythromycin Gentamicin Tetracycline

Number of H. pullorum isolates with MIC of (μg ml− 1): ≤ 0.015

0.03

0.06

0.12

0.25

0.5

1

2

4

4

8

1

1

6

2

1 1

2

1

2 1

2

5 1

1

1

1

8 3

4 5 4

5 1 6

8

16

5

1

32

64

128

N128

3 4

172

R.G. Zanoni et al. / International Journal of Food Microbiology 116 (2007) 168–173

ciprofloxacin which showed a bimodal appearance with a second peak at N 128 μg ml− 1 and 32 μg ml− 1, respectively. 4. Discussion There is a paucity of data in the literature regarding the occurrence of H. pullorum in poultry. Burnens et al. (1996) found a prevalence rate of 4% upon sampling the caecal contents of 150 healthy broiler chickens and isolated H. pullorum from 9 out of 18 caeca of laying hens affected by vibrionic hepatitis. Atabay and Corry (1997) isolated Campylobacter-like organisms, successively identified as H. pullorum (Atabay et al., 1998), from 9 out of 15 frozen caeca (60%) and from 9 out of 15 fresh carcasses (60%) collected from two different farms. More recently, Ceelen et al. (2006) carried out a study on the gastrointestinal tract and liver tissue of 110 broiler chickens coming from 11 different flocks. Using PCR for H. pullorum, they found samples belonging to 7 out of the 11 flocks tested to be positive. In particular, using the caecal tissue, they found 37 out of 110 animals to be positive. Moreover, they obtained positive results from 31.8% of the colon, 10.9% of the jejunum and 4.6% of the liver tissue samples. On the contrary, using the cultural method, they found only 16 animals positive for H. pullorum from 2 out of the 7 PCR positive flocks. Our results point out a high prevalence of H. pullorum in poultry: 100% of the laying hen and broiler chicken farms as well as 100% of the 60 animals examined were positive. Recently, a similar level of prevalence has been reported in France by Pilon et al. (2005) who found 100% positivity in the caecal contents of 10 chickens using real-time PCR. The reason we found 100% of the caecal contents to be positive in comparison to the 60% described by Atabay and Corry (1997) could be attributed to the processing of fresh and not frozen caeca. The lower isolation rate obtained by Ceelen et al. (2006) from caecal tissue could depend on the use of a 0.45 μm pore size filter instead of the 0.65 μm filter we used. Unlike Atabay and Corry (1997) and Ceelen et al. (2006) who incubated the plates before removing the filter in an aerobic atmosphere, we used a microaerobic atmosphere with hydrogen to keep the microorganisms more viable and motile during this phase. As far as biochemical tests are concerned, our results are in accordance with the data of Atabay et al. (1998) and On et al. (1996) except for growth in a microaerobic atmosphere without hydrogen. All the strains of Atabay et al. (1998) were negative for this test while 14 out of 15 isolates of our study were positive. The isolation of strains which are not dependent on hydrogen has already been described by Steinbrueckner et al. (1997) who isolated H. pullorum after 48 h of incubation under microaerobic conditions without hydrogen. The 1D SDS-PAGE whole protein profile analysis showed very high similarity among the 15 isolates tested which formed a tight cluster with the H. pullorum type strain substantiating genotypic identification by PCR and PCR-RFLP. Nutrient Agar, the medium recommended by On and Holmes (1991a) for tolerance tests for campylobacters, was utilized to define the MIC value instead of Muller Hinton Agar because 10

out of 13 of our isolates did not grow on this medium. The MIC values of C. jejuni ATCC 33560 on Nutrient Agar were always within the quality control limits indicated by the CSLI (NCCLS, 2002). A bimodal frequency distribution of MICs for ciprofloxacin and erythromycin indicates an acquired resistance for these antimicrobial agents with a high level of MIC in the second peak at 32 μg ml− 1 and N 128 μg ml− 1, respectively. For the other antibiotics tested, a monomodal distribution of MIC values was observed and, on the basis of the breakpoints indicated by the CSLI for Enterobacteriaceae (NCCLS, 2004), we may assume that all H. pullorum isolates are sensitive. The MIC values of gentamicin and tetracycline are similar to those obtained by Ceelen et al. (2005b) who employed an agar dilution method on 23 strains of H. pullorum coming from 3 different flocks. However, these authors did not find any resistance to erythromycin and fluoroquinolones, and detected a MIC90 (256 μg ml− 1) for ampicillin higher than what we found (4 μg ml− 1). In conclusion, the isolation method used in this study seems to be highly suitable for isolating H. pullorum from chicken caecal contents. The dilution of the fresh samples with horse serum mixture allows the distribution of a greater quantity of inoculum on the membrane and seems to reduce the swarming of Campylobacter spp. on the agar media. The detection of an elevated number of colonies phenotypically similar to H. pullorum in the media of the first isolation of all samples suggests that this microorganism, when present, colonizes the caecum at a high concentration. If the role of H. pullorum as a disease-causing agent transmitted by food is confirmed, the high frequency of isolation accompanied by the elevated intestinal concentration could represent a serious contamination risk of the carcasses as has already been observed by Atabay et al. (1998). Acknowledgement This research was financed by the European Project FOOD-CT-200X-007076 named POULTRYFLORGUT (www. poultryflorgut.org). References Atabay, H.I., Corry, J.E., 1997. The prevalence of campylobacters and arcobacters in broiler chickens. Journal of Applied Microbiology 83 (5), 619–626. Atabay, H.I., Corry, J.E., On, S.L.W., 1998. Identification of unusual Campylobacter-like isolates from poultry products as Helicobacter pullorum. Journal of Applied Microbiology 84 (6), 1017–1024. Bolton, F.J., Wareing, D.R.A., Skirrow, M.B., Hutchinson, D.N., 1992. Identification and biotyping of campylobacters. In: Board, R.G., Jones, D., Skinner, F.A. (Eds.), Identification Methods in Applied and Environmental Microbiology. Blackwell Scientific Publications, Oxford, pp. 151–161. Burnens, A.P., Stanley, J., Morgenstern, R., Nicolet, J., 1994. Gastroenteritis associated with Helicobacter pullorum. Lancet 344 (8936), 1569–1570. Burnens, A.P., Stanley, J., Nicolet, J., 1996. Possible association of Helicobacter pullorum with lesions of vibrionic hepatitis in poultry. In: Newell, D.G., Ketley, J.M., Feldman, R.A. (Eds.), Campylobacters, Helicobacters and Related Organisms. Plenum Press, New York, pp. 291–294. Ceelen, L.M., Decostere, A., Verschraegen, G., Ducatelle, R., Haesebrouck, F., 2005a. Prevalence of Helicobacter pullorum among patients with

R.G. Zanoni et al. / International Journal of Food Microbiology 116 (2007) 168–173 gastrointestinal disease and clinically healthy persons. Journal of Clinical Microbiology 43 (6), 2984–2986. Ceelen, L., Decostere, A., Devriese, L.A., Ducatelle, R., Haesebrouck, F., 2005b. In vitro susceptibility of Helicobacter pullorum strains to different antimicrobial agents. Microbial Drug Resistance 11 (2), 122–126. Ceelen, L.M., Decostere, A., Van den Bulck, K., On, S.L., Baele, M., Ducatelle, R., Haesebrouck, F., 2006. Helicobacter pullorum in chickens, Belgium. Emerging Infectious Diseases 12 (2), 263–267. Chevalier, C., Thiberge, J.M., Ferrero, R.L., Labigne, A., 1999. Essential role of Helicobacter pylori gamma-glutamyltranspeptidase for the colonization of the gastric mucosa of mice. Molecular Microbiology 31 (5), 1359–1372. Costas, M., 1992. Classification, identification, and typing of bacteria by the analysis of their one-dimensional polyacrylamide gel electrophoretic protein patterns. In: Chambrach, A., Dunn, M.J., Rodola, B.J. (Eds.), Advances in Electrophoresis, vol. 5. VCH Verlagsgesellschaft, Weinheim, pp. 351–408. Dewhirst, F.E., Fox, J.G., On, S.L., 2000. Recommended minimal standards for describing new species of the genus Helicobacter. International Journal of Systematic and Evolutionary Microbiology 50 (Pt 6), 2231–2237. Fox, J.G., Chien, C.C., Dewhirst, F.E., Paster, B.J., Shen, Z., Melito, P.L., Woodward, D.L., Rogers, F.G., 2000. Helicobacter canadensis sp. nov. isolated from humans with diarrhea as an example of an emerging pathogen. Journal of Clinical Microbiology 38 (7), 2546–2549. Gibson, J.R., Ferrus, M.A., Woodward, D., Xerry, J., Owen, R.J., 1999. Genetic diversity in Helicobacter pullorum from human and poultry sources identified by an amplified fragment length polymorphism technique and pulsed-field gel electrophoresis. Journal of Applied Microbiology 87, 602–610. Kuijper, E.J., Stevens, S., Imamura, T., de Wever, B., Claas, E.C.J., 2003. Genotypic identification of erythromycin-resistant Campylobacter isolates as Helicobacter species and analysis of resistance mechanism. Journal of Clinical Microbiology 41 (8), 3732–3736. Melito, P.L., Woodward, D.L., Bernard, K.A., Price, L., Khakhria, R., Johnson, W.M., Rodgers, F.G., 2000. Differentiation of clinical Helicobacter pullorum isolates from related Helicobacter and Campylobacter species. Helicobacter 5 (3), 142–147. National Committee for Clinical Laboratory Standards (NCCLS), 2002. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, Second edition. NCCLS, Wayne, PA, p. 80. Approved Standard M31-A2. National Committee for Clinical Laboratory Standards (NCCLS), 2004. Performance Standards for Antimicrobial Susceptibility Testing. Fourteenth Informational Supplement: Approved Standard M100-S14. NCCLS, Wayne, PA, p. 156. On, S.L., 1996. Identification methods for campylobacters, helicobacters, and related organisms. Clinical Microbiology Reviews 9 (4), 405–422.

173

On, S.L., Holmes, B., 1991a. Reproducibility of tolerance tests that are useful in the identification of campylobacteria. Journal of Clinical Microbiology 29 (9), 1785–1788. On, S.L., Holmes, B., 1991b. Effect of inoculum size on the phenotypic characterization of Campylobacter species. Journal of Clinical Microbiology 29 (5), 923–926. On, S.L., Holmes, B., 1992. Assessment of enzyme detection tests useful in identification of campylobacteria. Journal of Clinical Microbiology 30 (3), 746–749. On, S.L., Holmes, B., Sackin, M.J., 1996. A probability matrix for the identification of campylobacters, helicobacters and allied taxa. The Journal of Applied Bacteriology 81 (4), 425–432. On, S.L., Lee, A., O'Rourke, J.L., Dewhirst, F.E., Paster, B.J., Fox, J.G., Vandamme, P., 2005. Genus I. Helicobacter. In: Brenner, D.J., Krieg, N.R., Staley, J.T., Garrity G.M. (Eds.), Bergey's Manual of Systematic Bacteriology, Vol. 2, Part C. Springer Science and Business Media, Inc, 233, New York, USA. 1169–1189. Pellicano, R., Mazzaferro, V., Grigioni, W.F., Cutufia, M.A., Fagoonee, S., Silengo, L., Pizzetto, M., Ponzetto, A., 2004. Helicobacter species sequences in liver samples from patients with and without hepatocellular carcinoma. World Journal of Gastroenterology 10 (4), 598–601. Pilon, C., Prouzel-Mauléon, V., Ménard, A., Mégraud, F., 2005. Development of a real-time quantitative PCR specific to Helicobacter pullorum. Thirteenth International Workshop on Campylobacter, Helicobacter and Related Organisms (CHRO): Abstracts of Scientific Presentations, September 4– 8th, Gold Coast, Queensland, Australia, p. 62. Ponzetto, A., Pellicano, R., Leone, N., Cutufia, M.A., Turrini, F., Grigioni, W.F., D'Errico, A., Mortimer, P., Pizzetto, M., Silengo, L., 2000. Helicobacter infection and cirrhosis in hepatitis C virus carriage: is it an innocent bystander or a troublemaker? Medical Hypotheses 54 (2), 275–277. Rocha, M., Avenaud, P., Menard, A., Le Bail, B., Balabaud, C., Bioulac-Sage, P., de Magalhaes Queiroz, D.M., Megraud, F., 2005. Association of Helicobacter species with hepatitis C cirrhosis with or without hepatocellular carcinoma. Gut 54 (3), 396–401. Stanley, J., Linton, D., Burnens, A.P., Dewhirst, F.E., On, S.L.W., Porter, A., Owen, R.J., Costas, M., 1994. Helicobacter pullorum sp. nov. — genotype and phenotype of new species isolated from poultry and from human patients with gastroenteritis. Microbiology 140, 3441–3449. Steele, T.W., McDermott, S.N., 1984. The use of membrane filters applied directly to the surface of agar plates for the isolation of Campylobacter jejuni from feces. Pathology 16 (3), 263–265. Steinbrueckner, B., Haerter, G., Pelz, K., Weiner, S., Rump, J.A., Deissler, W., Bereswill, S., Kist, M., 1997. Isolation of Helicobacter pullorum from patients with enteritis. Scandinavian Journal of Infectious Diseases 29 (3), 315–318.