- Email: [email protected]
Occurrence and regulation of the multicellular morphotype in Salmonella serovars important in human disease
Int. J. Med. Microbiol. 293, 273 ± 285 (2003) ¹ Urban & Fischer Verlag http: // www.urbanfischer.de/journals/ijmm
Occurrence and regulation of the multicellular morphotype in Salmonella serovars important in human disease Ute Rˆmling a,b, Werner Bokranzb, Wolfgang Rabschc, Xhavit Zogaja, Manfred Nimtzd, Helmut Tsch‰pec a b c
d
Microbiology and Tumorbiology Center (MTC), Karolinska Institute, Stockholm, Sweden Department of Cell Biology and Immunology, GBF, Braunschweig, Germany National Reference Center for Salmonellae and other Enteric Pathogens, Robert Koch-Institut, Wernigerode, Germany Department of Structural Biology, GBF, Braunschweig, Germany
Received March 11, 2003 ¥ Revision received April 17, 2003 ¥ Accepted May 2, 2003
Abstract Multicellular behavior in Salmonella Typhimurium ATCC14028 called the rdar morphotype is characterized by the expression of the extracellular matrix components cellulose and curli fimbriae. Over 90% of S. Typhimurium and S. Enteritidis strains from human disease, food and animals expressed the rdar morphotype at 28 8C. Regulation of the rdar morphotype occurred via the response regulator ompR, which activated transcription of csgD required for production of cellulose and curli fimbriae. Serovar-specific regulation of csgD required rpoS in S. Typhimurium, but was partially independent of rpoS in S. Enteritidis. Rarely, strainspecific temperature-deregulated expression of the rdar morphotype was observed. The hostrestricted serovars S. Typhimurium var. Copenhagen phage type DT2 and DT99, Salmonella Typhi and Salmonella Choleraesuis did not express the rdar morphotype, while in Salmonella Gallinarum cellulose expression at 37 8C was seen in some strains. Therefore, the expression pattern of the rdar morphotype is serovar specific and correlates with a disease phenotype breaching the intestinal epithelial cell lining. Key words: cellulose ± curli fimbriae ± biofilm ± ompR ± rpoS ± thin aggregative fimbriae
Introduction In the two Salmonella species, Salmonella enterica and Salmonella bongori, the occurrence of certain fimbrial operons is usually restricted to a subset of particular subspecies and even particular serovars. An exception is the curli fimbriae (previously called thin aggregative fimbriae (agf)) operon in Salmonella species, which is present in the two Salmonella species and also in Escherichia coli (Baumler et al.,
1997; Doran et al., 1993). Curli fimbriae are one major component of the extracellular matrix involved in multicellular behavior called the rdar morphotype (Rˆmling et al., 1998b). Recently, the second extracellular matrix component was identified to be cellulose (Zogaj et al., 2001). Curli fimbriae and cellulose play a role in bacterial cell-cell interactions. Biofilm formation on abiotic surfaces, bacterial aggregation, pellicle formation, and a bacterial network on agar plates are expres-
Corresponding author: Ute Rˆmling, Microbiology and Tumorbiology Center (MTC), Box 280, Karolinska Institutet, SE-17177 Stockholm, Sweden. Phone: 46 8 5248 7319, Fax: 46 8 330 744, E-mail: [email protected]
1438-4221/03/293/04-273 $ 15.00/0
274
U. Rˆmling et al.
sion modes of the stationary-phase-expressed rdar morphotype (Austin et al., 1998; Rˆmling et al., 1998b). Knock-out of the two extracellular matrix components leads to single cell behavior (the saw morphotype; (Rˆmling et al., 2000)). While several phenotypes associated with virulence can be attributed to curli fimbriae (Bian et al., 2000; Chapman et al., 2002; Dibb-Fuller et al., 1999; Gophna et al., 2001; Olsen et al., 1989; Sukupolvi et al., 1997; Uhlich et al., 2002) the in vivo role of those fibers in Salmonella species in pathogen-host interactions is yet elusive (Rajashekara et al., 2000; Rˆmling et al., 2000; van der Velden et al., 1998). In two commonly used virulent Salmonella enterica serovar Typhimurium (Salmonella Typhimurium) strains, ATCC14028 and SR-11, the rdar morphotype is highly regulated by environmental conditions and only expressed at a certain constellation of medium composition with oxygen tension (Gerstel and Rˆmling, 2001; Rˆmling et al., 1998a). However, iron deficiency was found to relieve temperature regulation (Rˆmling et al., 1998b). The rdar morphotype is regulated by csgD, a transcriptional regulator of the UhpA family (Hammar et al., 1995; Rˆmling et al., 2000). Phase variation of rdar morphotype expression occurred in ATCC14028 and SR-11. Individual csgD promoter mutations were isolated that relieve temperature dependence of rdar morphotype expression (Rˆmling et al., 1998b). Through those mutations, some components of the regulatory network changed. While ompR was still needed for the expression of csgD, the sigma factor required for csgD promoter expression, changed from dS to the housekeeping sigma factor dD (Rˆmling et al., 1998b). Although expression of curli fimbriae has been analysed by molecular methods in Salmonella serotypes (Doran et al., 1993), no systematic study exists which analyses expression of the rdar morphotype, and in particular biosynthesis of cellulose, on a molecular level. We were interested whether the rdar morphotype, as exemplified by S. Typhimurium strains ATCC14028 and SR-11, is a common behavior of Salmonella serovars important for human health.
Materials and methods Bacterial strains All S. Typhimurium and S. Enteritidis strains ( > 800 strains) submitted during four weeks to the National Reference Center for Salmonellae and other Enteric
Pathogens, Wernigerode, Germany, were screened for the multicellular morphotype as described below. The phage typing of the different serovars was performed according to the International Federation of Enteric Phage Typing, Secretary L.R. Ward, Colindale Institute, London. Nineteen S. Typhi strains (disease (d) and carrier status (c )) of various origins and phage types (PT) were: 768/00, d, India, PT E1a; 1630/00, c, Germany, PT E1b; 2714/00, d, India, PT E1a; 2798/00, c, Germany, PT F4; 3434/00, d, introduced from tropical country, PT D1; 3728/00, d, Turkey, PT 28; 8661/00, d, Germany, PT C4; 10392/00, d, Spain, PT T; 51/01, c, Germany, PTE1b; 176/01, d, Indonesia, PT F2; 1506/01, d, Egypt, PT G1; 2300/01, d, Bangladesh, PT ubI; 4943/01, d, Iran, PT A; 5139/01, d, Pakistan, PT ubII; 5989/01, d, Pakistan, PT E1a; 6137/01, d, Italy, PT A; 7794/01, d, Germany, PT ut/ViÆ; 7795/01, d, Turkey, PT D6; 7796/01, d, Pakistan, PT E1a. Seventeen S. Choleraesuis strains were (strain, origin, source): 0003726, Turkey, animal; 00-02998, India, animal; 0002997, India, unknown origin; 00-02948, India, unknown origin; 00-02114, Germany, unknown origin; 0001048, India, pig; 99-07230, Germany, human; 9902397, Germany, human; 98-05543, Germany, unknown origin, 98-04389, Germany, human; 97-07869, Germany, pig; 97-01185, Germany, human; 96-08742, Germany, meat; 96-03644, Germany, pig; 96-02404, Germany, pig; 96-02240, Germany, human; 96-01171, Germany, human. In addition, 23 S. Gallinarum biovar. Pullorum and 11 biovar S. Gallinarum strains isolated between 1957 and 2001 were investigated. Growth conditions and morphotype identification S. Typhimurium and S. Enteritidis strains submitted to the Reference Center were directly streaked on Congo Red (CR) plates, which are Luria Bertani (LB) plates without salt supplemented with CR (40 mg/ml) and Coomassie brilliant blue (20 mg/ml). Colony morphologies were assessed on CR plates after growth at 37 8C for 24 h and at 28 8C for 48 h according to the basic morphotypes detected in S. Typhimurium ATCC14028 mutants: rdar (expresses curli fimbriae and cellulose), pdar (expresses cellulose), bdar (expresses curli fimbriae) and saw (no expression of curli fimbriae nor cellulose). Indication for cellulose production was obtained when fluorescent colonies were observed under a 366-nm UV light source after growth on Calcofluor (fluorescent brightener 28) plates (LB without salt agar plates with 50 mM Calcofluor). If not otherwise indicated, for subsequent analysis bacterial strains were grown in LB broth without salt or on plates made with the same broth at 37 8C for 24 h or at 28 8C for 48 h. Mutant construction Strains S. Typhimurium MAE28 (DcsgD101::Km), JF2757 (ompR43::MudJ), MAE316 (rpoS::Km, Gerstel et al., unpublished) and MAE150 (bcsA101::MudJ) were used to prepare P22 phage lysates, which were subsequently used to construct respective mutants.
Serovar-specific rdar morphotype expression Phage P22 HT105/1 int-201 was used for transduction of S. Typhimurium and S. Enteritidis strains according to the recommended protocol (Maloy et al., 1996). Strains were restreaked on LB or CR plates containing 10 mM ethylene glycol-bis(b-aminoether)N-N-N',N'-tetra-acetic acid (EGTA) to eliminate the phage. Phenotypic screens M9 minimal medium (Ausubel et al., 1994) was used to check for auxotrophy. The presence of an intact rpoS allele was assessed indirectly by assaying catalase activity. Ten ml of a 30% hydrogen peroxide (H2O2) solution were added to plate-grown cells and the dismutation of H2O2 into H2O and O2 was recorded by the observation of extensive bubble formation. To judge motility, a toothpick with adherent cells was stabbed into 0.3% LB agar and the appearance of concentric rings of moving cells was recorded after 24 h. Detection of curli fimbriae Since curli fimbriae tend to aggregate we developed an enrichment procedure for enhanced visualization and detection on protein gels and Western blots. Three mg of bacteria were harvested from plates and resuspended in 1.5 ml TE (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) with 2% SDS. After incubation for 45 min at 95 8C and centrifugation, the pellet was washed three times with water. After resuspension in 100 ml water, the pellet was lyophilized and resuspended in 20 ml 100% formic acid. After removal of the formic acid, the CsgA-enriched pellet was resuspended in 20 ml SDS sample buffer and 7 ml were loaded onto the gel. Visualization of curli fimbriae subunits was achieved by colloidal Coomassie staining and detection by Western blotting using an anti-CsgA antibody at a dilution of 1 : 1000. Alternatively, CsgA subunits were detected by MALDI-TOF analysis. The CsgA-enriched pellet resuspended in 10 ml 100 % formic acid was applied to the target undiluted or in dilutions up to 10 3. A single prominent peak at 13.4 kDa, which represented the acid-resistant part of the protein (Collinson et al., 1999), indicated the presence of CsgA. Detection of cellulose Crystalline cellulose was isolated by the Updegraff method (incubation in 58% acetic acid, 19% nitric acid at 95 8C for 30 min) as described (Updegraff, 1969; Zogaj et al., 2001). After hydrolysation with 4 N tri-fluoric acid (TFA) the sugar monomers were identified by gas chromatography coupled with mass spectrometry (GC-MS). The presence of glucose as the predominant sugar monomer was considered to be an indicator of cellulose production. Molecular biology methods Molecular biology methods were carried out using standard procedures (Ausubel et al., 1994). Two overlapping PCR products were created to amplify the whole csgDEFG-csgBAC operon; csgDEFG and the intergenic region was amplified with primers AGFG: CCAGGATCCGAGCAACATTCAGCGAATAC and Sp24: TAACTCTGCTGCTACAATCC and csgBAC and the
275
intergenic region was amplified with primers AGFB1: GCTCTGCAGCCAGATCATAATTTGTCG and Sp26: GGACATGTTAACTCCTCAATG.
Results Expression of the multicellular morphotype in Salmonella serotypes More than 800 S. Typhimurium and S. Enteritidis strains which arrived at the National Reference Center during a period of four weeks were screened for the expression of the multicellular morphotype, rdar, bdar, pdar and saw colonies, respectively, at 28 8C and 37 8C on CR plates. More than 90% of the S. Typhimurium and S. Enteritidis isolates expressed the rdar morphotype at 28 8C. In most strains, expression was weak, but clearly to distinguish from the saw morphotype (see strain 00-04013 in contrast to strain 00-04012, Fig. lA, B as a typical example). A subfraction of strains showed a stronger expression of the rdar morphotype (see strains 00-04037 and 97-00728, Fig. 1A, B as typical examples). The bdar and the pdar morphotype were never detected when strains were grown at 28 8C. When grown at 28 8C, nine strains displayed, besides the rdar morphotype, single saw colonies on the original CR plate. Those strains were designated lfs (low frequency switch between morphotypes). Six strains showed a heterogeneous phenotype with approximately equal amounts of rdar/pdar and saw colony morphologies. This phenomenon was mainly detected at 37 8C, but also at 28 8C (examples are strains S. Enteritidis phage type 21, 00-04026 and S. Typhimurium phage type DT104, 00-04020; Fig. 1C). When the rdar/pdar morphotype was restreaked, it remained rdar/pdar. However, when the saw morphotype was restreaked it segregated into rdar/pdar and saw morphologies. Those strains were called hfs (high frequency switch between morphotypes). Frequently, the hfs phenotype was unstable upon subculture as observed in strain 0004026. Expression of a pure rdar morphotype or any variation of it was not detected when the strains were grown at 37 8C. In summary, although there are exceptions, a regulated rdar morphotype expressed at 28 8C, but not at 37 8C is the regular phenotype displayed by S. Typhimurium and S. Enteritidis strains isolated from patients, food and animals. Approximately 10% of the strains showed a saw colony morphology at 28 8C and 37 8C. Those strains were S. Typhimurium var. Copenhagen phage type DT2 and DT99 isolated from pigeons.
276
U. Rˆmling et al.
Serovar-specific rdar morphotype expression
277
Table 1. Phenotypes of S. Typhi, S. Choleraesuis and S. Typhimurium var. Copenhagen strains. CsgA expression [28 8C/37 8C]
Cellulose production
Functional rpoS
/b.
/n.d. (01-07794)
/ /
/b. /b.
n.d./n.d. n.d./n.d.
Saw/saw
/
b./b.
/n.d. (90-00659)
Saw/saw Saw/saw
/ /n.d.
/b. /
n.d./n.d. / (00-08774)
Species
Strains
Phenotype CR plates [28 8C/37 8C]
S. Typhi
00-02714, 01-00176, 01-00051, 01-04943, 01-05989, 01-07794 00-07794 00-01048, 98-04389, 96-08742, 96-02404 89-00655, 63-00657, 61-00658, 90-00659 86-00656 all strains as mentioned in Materials and methods
Saw/saw
/
Saw/saw Saw/saw
S. Typhi S. Choleraesuis
S. Choleraesuis
S. Choleraesuis S. Typhimurium var. Copenhagen
Phenotype Calcofluor plates [28 8C/37 8C]
b., background level; n.d., not determined. According to the level of expression/strength of phenotype, a classification scheme from indicated no expression and indicated strongest expression.
In contrast to S. Typhimurium and S. Enteritidis, which usually cause a self-limiting gastroenteritis in humans, S. Typhimurium var. Copenhagen causes an invasive disease with septicemia in pigeons. Therefore, we wondered, whether other Salmonella serovars associated with invasive disease also showed the saw morphotype. The human-adapted serovar S. Typhi causes typhoid fever, the pigadapted serovar S. Choleraesuis causes paratyphoid and the avian-adapted serovar S. Gallinarum causes fowl typhoid (Rabsch et al., 2002; Wilcock and Schwarz, 1992). Infection of humans by S. Choleraesuis is rare, but important, since it produces a severe disease syndrome. Nineteen S. Typhi, 17 S. Choleraesuis and 23 S. Gallinarum strains were checked for the expression of the rdar morphotype. All S. Typhi and S. Choleraesuis strains showed the saw morphotype at 28 8C as well as at 37 8C (Table 1). The situation was not so clearcut with S. Gallinarum. While the strains displayed a saw morphotype on Congo Red plates, several strains showed Calcofluor binding at 37 8C. One isolate
Prototrophy
Motility
()
, ,
, ,
to was introduced, whereby
expressed a temperature-independent rdar morphotype. Expression of curli fimbriae and cellulose correlates with rdar morphotype expression In the reference strain S. Typhimurium ATCC14028 the rdar morphotype is associated with the expression of the extracellular matrix components curli fimbriae and cellulose, while the saw morphotype does not express any of the two components. We wanted to know whether this is also the case in randomly chosen, epidemiologically unrelated Salmonella serotypes from this study. Nine S. Typhimurium and 5 S. Enteritidis strains (plus hfs or lfs morphotype variants of five strains), 10 S. Typhimurium var. Copenhagen, 7 S. Typhi, and 9 S. Choleraesuis strains were chosen (Tables 1, 2). To reproducibly detect CsgA, a selective enrichment of polymerized fimbriae was developed and CsgA was detected by direct staining of protein gels with colloidal Coomassie Brilliant Blue, by Western
3 Fig. 1. Expression range of the rdar morphotype of S. Typhimurium/S. Enteritidis strains. The rdar morphotype of strains incubated on LB agar plates without salt substituted with CR (upper panel) or Calcofluor (lower panel) at 37 8C for 24 h (A) or at 28 8C for 48 h (B). Strain names are indicated in (A). C) Morphotype switch within a strain. Morphotype mutants of one strain (designated a or b) were grown on LB agar plates without salt substituted with CR (upper panel) or Calcofluor (lower panel) at 28 8C for 48 h. Strains 00-04026 and 97-00728 represent hfs strains, which have lost the hfs phenotype. Strain 00-04020-a still shows the hfs phenotype, which is indicated by the sectored colony. Strain 00-03875 is an lfs strain.
278
U. Rˆmling et al.
Table 2. Phenotypes of S. Typhimurium and S. Enteritidis strains. Strain
S. Typhimurium 00-04012 00-04013 00-04037-a 00-04037-b 00-04020-a 00-04020-b 00-03876-a 00-03876-b 00-03874-a 00-03874-b 00-03875-a 00-03875-b 00-03924 00-07081 S. Enteritidis 00-04026-a 00-04026-b 00-04156 00-04560 97-00728-a 97-00728-b 27655-a 27655-b
Phenotype CR CsgA plates expression [28 8C/37 8C] [28 8C/37 8C]
Functional OmpR Phenotype Cellulose bcsA CsgD RpoS dependence dependence dependence Calcofluor plates production knock-out rpoS [28 8C/37 8C]
Saw/saw Rdar/saw Rdar/saw Saw/saw Saw(hfs)/saw Rdar/saw Rdar/saw Rpdar/saw Rdar/saw Saw/saw Rdar/saw Saw/saw Rdar/saw Rdar/saw
/ / / / / / / / / / / / / /
/ / / / / / / / / / / / / /
Rdar/saw Rdar/pdar Rdar/saw Rdar/saw Rdar/rdar Rdar/saw Rdar/rdar Saw/saw
/ /() / / / / / /
/ / / / / / / /
/ / /
/ /
p.r.
p.r.
p.r.
n.d. p.r.
n.d. p.r.
n.d. p.r.
n.d. p.r. n.d. n.d.
n.d. p.r. n.d. n.d.
n.d. p.r. n.d. n.d.
n.d., not determined; p.r., phage resistant. According to the level of expression a classification scheme from expression and indicated strongest expression.
blot analysis of respective gels and by MALDI-TOF analysis (Figs. 2, 3). Western blot and MALDI-TOF analysis were equally sensitive in the detection of CsgA monomers. The amount of CsgA in each strain varied with the expression level of the rdar morphotype, but was always associated with the rdar morphotype (Fig. 2). Saw morphotypes did not show CsgA expression. Those results were confirmed for independent isolates as well as for morphotype variants. Binding of Calcofluor is associated with the production of cellulose in S. Typhimurium. When Calcofluor is added to agar plates, cellulose-producing colonies fluoresce under a 366-nm UV lamp. In the present Salmonella strain collection, fluorescence was exclusively associated with the expression of the rdar morphotype. A saw morphotype did not fluoresce (Fig. 1 and data not shown). Only the polysaccharide cellulose withstands the treatment with strong acidic solutions at high temperature. From selected colonies, which showed either the rdar or the saw morphotype, crystalline cellulose was isolated by the Updegraff method as described in Materials and methods. Cellulose is composed solely of D-glucose. Therefore, after hydrolysis of the polymer, glucose is detected as
to was introduced, whereby
indicated no
the only sugar monomer by GC-MS. Glucose was detected only from colonies, which displayed the rdar morphotype, while the saw morphotypes showed only trace amounts of the sugar (Fig. 4, Table 2). As an additional control, knock-out mutants in bcsA, the cellulose synthase gene, were created in rdar morphotype strains. As expected, bcsA mutant colonies expressed the bdar morphotype and did not bind Calcofluor (Table 2, Fig. 5 and data not shown). In conclusion, in Salmonella serotypes the rdar morphotype is associated with the expression of curli fimbriae and cellulose.
Biofilm formation Expression of the rdar morphotype mediates biofilm formation in S. Typhimurium ATCC14028. To test the correlation of rdar morphotype expression with biofilm formation in our strain panel, strains with different degrees of rdar morphotype expression were selected and tested for biofilm formation on a glass surface at 28 8C and 37 8C. The degree of biofilm formation correlated with the degree of rdar
Serovar-specific rdar morphotype expression
Fig. 2. Correlation of CsgA expression with rdar morphotype expression in S. Typhimurium, S. Enteritidis and S. Typhi strains. A) Differential expression of CsgA in morphotypes from Fig. 1B. Cells were grown at 28 8C for 48 h, CsgA was enriched as described in Materials and methods, and preparations were separated by SDSPAGE. The upper panel shows a Coomassie-stained gel, while the lower panel shows the corresponding Western blot. r expresses rdar morphotype, s saw morphotype. 1, 00-03876-a; 2, 00-03876-b; 3, 00-04026-b; 4, 00-04037-a; 5, 00-04012; 6, 00-04013; 7, 9700728-a; 8, 97-00728-b; 9, control strain MAE52. B) Coomassie stained PAGE gel of CsgA isolated from the same strains as in (A), but grown at 37 8C. Most of the strains do not express CsgA. p pdar morphotype. C) Coomassie-stained PAGE gel of CsgA isolated from S. Typhi strains grown at 28 8C for 48 h. 1, 51/01; 2, 176/01; 3, 2714/01; 4, 4943/01; 5, 5989/01; 6, 7794/01; 7, 7795/01; 8, control strain MAE52.
morphotype expression (compare Fig. 1A and Fig. 6; data not shown). Regulatory network of rdar morphotype expression In the regular expression pattern seen in vitro on plates the rdar morphotype is not expressed at 37 8C. However, in the reference strain UMR1 temperature regulation of CsgA expression can be overcome by iron deficiency. In our strain panel, all S. Typhimurium isolates with regulated rdar morphotype expression, but not the S. Enteritidis isolates were able to overcome temperature regulation of CsgA expression under iron deficiency (Fig. 7). However, CsgA expression could not be activated by iron deficiency in saw morphotypes at 28 8C as examined in six S. Typhimurium isolates (data not shown).
279
In S. typhimurium ATCC14028 expression of the rdar morphotype is embedded in a regulatory network. On top of the hierarchy stands OmpR, which is required for the expression of CsgD (PrigentCombaret et al., 2001; Rˆmling et al., 1998b). CsgD, a positive transcriptional regulator of the UhpA family regulates the expression of curli fimbriae and cellulose (Rˆmling et al., 2000). We wanted to know whether the rdar morphotype required ompR as well as csgD to be expressed in epidemiologically independent isolates of S. Typhimurium and S. Enteritidis. Therefore, ompR and csgD mutants were created by phage transduction of knock-out alleles. The rdar morphotype of all strains examined was dependent on the ompR and csgD gene loci (Table 2, Fig. 5). The exception was S. Enteritidis 00-004026-b, which showed a pdar morphotype indicating that cellulose expression was partially independent of ompR and csgD. In the regulated rdar morphotype of S. Typhimurium ATCC14028, the csgD promoter requires dS for expression. Consequently, in all S. Typhimurium strains examined deletion of rpoS resulted in a saw morphotype. However, all rpoS mutants of S. Enteritidis strains retained the bdar morphotype, indicating that dS is not required for csgD transcription. However, dS is still needed beyond csgD for the biosynthesis of cellulose. Genetic basis of the switch phenomenon Lfs variants showed a switch from the rdar to the saw morphotype at 28 8C. Expression of the regulated rdar morphotype was dependent on rpoS in the S. Typhimurium strains. On the other hand, rpoS is an unstable trait in S. Typhimurium. We tested the strains for a functional rpoS allele by the catalase assay. All lfs variants that had switched to saw contained a non-functional rpoS allele (Table 2). S. Typhi, S. Choleraesuis and S. Typhimurium var. Copenhagen isolates showed the saw morphotype. However, all those strains contained a functional rpoS allele (Table 1). A global distortion of cell physiology can also be responsible for the downregulation of the rdar morphotype. Therefore, we checked the strains for auxotrophy and all S. Typhi strains were auxotroph. All S. Typhi strains also showed reduced motility (Table 1). With one exception S. Choleraesuis and S. Typhimurium var. Copenhagen strains were prototroph. In Shigella spp. biosynthesis of curli fimbriae is abolished primarily by insertion of IS elements or deletions in the csgDEFG-csgBA(C) locus (Sakellaris et al., 2000). However, when S. Typhi, S. Choleraesuis and S. Typhimurium var. Copenhagen
280
U. Rˆmling et al.
Fig. 3. Detection of CsgA by MALDI-TOF. CsgA was prepared by the enrichment procedure from strain 00-04026-a grown at 28 8C for 48 h (A) or at 37 8C for 24 h (B). CsgA enriched from 3 mg of wet cells was resuspended in 10 ml formic acid. The spectra were collected using a 10 2 dilution of CsgA in formic acid. CsgA is detected as a characteristic peak at ca. 13.3 kDa.
isolates were examined by PCR the csg locus was found intact. The csgD gene and the intergenic region were sequenced in 10 S. Typhimurium var. Copenhagen isolates. The only difference in five isolates was a G-to-T transversion which changed the sequence in the 35 box of the csgD promoter from TTGCTT to TTTCTT and in the other five isolates a silent C-to-A exchange at bp 9 in the csgE gene in comparison with S. Typhimurium strains expreessing the rdar morphotype (Rˆmling et al., 1998b). In S. Typhimurium a switch from the regulated rdar morphotype to a semi-constitutive rdar morphotype is mediated by mutations in the csgD promoter region and leads to a dS-independent expression of csgD (Rˆmling et al., 1998b). There-
fore, we checked strain pairs for mutations in the csgD promoter and the intergenic region. In S. Enteritidis strains, 11 bp changes could be detected in the 521-bp intergenic region between the transcriptional start sites of csgD and csgB. Especially, two serotype-specific mutations, a G-to-T transversion at position 52 and a T-to-C transition at position 54 in the OmpR-binding site could contribute to the partially rpoS-independent expression of csgD (Fig. 8). Most interestingly, strain 9700728-a expressing a semi-constitutive rdar morphotype showed an additional G-to-T transversion at position 44 in comparison with strain 9700728-b, which expressed a regulated rdar morphotype. The same G-to-T transversion occurred also in S. Typhimurium SR-11 when it switched from the
Serovar-specific rdar morphotype expression
281
Fig. 4. Detection of glucose monomers after isolation of crystalline cellulose. After isolation of crystalline cellulose by the Updegraff method (Updegraff, 1969), the macromolecule was hydrolyzed. Derivatized glucose monomers were detected by GC/MS with retention times at 13.76 min (a-glucose) and 13.94 min (b-glucose). Standard of 1 mg myo-inositol was detected at 15.74 min. Representative results are shown for strain 00-04037-a grown at 28 8C for 48 h (A) and at 37 8C for 24 h (B).
Fig. 6. Biofilm formation of representative S. Typhimurium and S. Enteritidis isolates. Biofilm formation correlates with the increasing level of rdar morphotype expression (compare with Fig. 1B). 1, 0004026-b; 2, 00-04037-a; 3, 00-04013; 4, 00-03876-b; 5, 00-04012; 6, 97-00728-a; 7, positive control MAE52; 8, negative control, MAE51 (DcsgD).
Fig. 7. Induction of CsgA expression at 37 8C by iron depletion. 1, S. Typhimurium 00-07081; 2, S. Enteritidis 00-04156; 3, S. Enteritidis 00-04560; 4, S. Typhimurium 00-04020-a; 5, S. Typhimurium 00-04020-b; 6, S. Typhimurium 00-03875-a; 7, S. Typhimurium UMR1 Fig. 5. Morphotype of csgD, ompR, rpoS, and bcsA mutants of S. Typhimurium and S. Enteritidis. Left: S. Typhimurium 00-04037 wild type and mutants, right: S. Enteritidis 00-04026 wild type and mutants. Strains were grown at 28 8C for 48 h.
282
U. Rˆmling et al.
Fig. 8. CsgD promoter alleles found in S. Enteritidis isolates. The 10 and 35 boxes are undelined. Base pairs in the OmpR consensus sequence are shown in italics. S. Enteritidis-specific base pair exchanges are indicated by white letters on a gray background, while the strain-specific base pair exchange is displayed in black on a gray background.
regulated to the semi-constitutive rdar morphotype (Rˆmling et al., 1998b). Therefore, only few mutations seem to confer temperature-independent expression of the rdar morphotype.
Discussion In the reference strain S. Typhimurium ATCC14028 the rdar morphotype is characterized by the expression of an abundant extracellular matrix consisting of curli fimbriae and the polysaccharide cellulose (Zogaj et al., 2001). The genes required for expression of the rdar morphotype are present the two Salmonella species and in E. coli. This finding indicates the general importance of the rdar morphotype for the ecology of those Enterobacteriaceae. To test whether the evaluation of the appearance of a colonial phenotype on agar plates is a reliable screening method, we first checked whether the rdar morphotype can be correlated with the expression of the two extracellular matrix components curli fimbriae and cellulose as in the reference strain ATCC14028 (Zogaj et al., 2001). We found that expression of curli fimbriae and the biosynthesis of cellulose were always correlated with rdar morphotype expression, whereas saw colonies never expressed any of the two components. An additional screen for cellulose biosynthesis is Calcofluor binding. Calcofluor does not bind to colanic acid, the other exopolysaccharide produced by S. Typhimurium (our unpublished results). A temperature-regulated rdar morphotype expressed at ambient temperature, but not at 37 8C is the prototype found in S. Typhimurium and S. Enteritidis isolates from human disease origin. This finding indicates that the rdar morphotype is tightly regulated by environmental conditions, but not necessarily that the rdar morphotype is only required outside a host (Mahan et al., 1996), since temperature regulation of the expression of curli fimbriae
can be overcome by iron deficiency (Fig. 7) in S. Typhimurium isolates and expression of cellulose at 37 8C can occur under more severe starvation conditions (Solano et al., 2002). However, an elusive role for the regulated rdar morphotype in pathogen-host interaction is missing, in particular, since most in vitro studies used mutants with the semi-constitutive rdar morphotype for the characterization of phenotypes (Dibb-Fuller et al., 1999; Sukupolvi et al., 1997; Uhlich et al., 2002) Studies on the regulation of the rdar morphotype have already discovered a complex regulatory network (Brown et al., 2001; Dorel et al., 1999; Prigent-Combaret et al., 2001; Rˆmling et al., 1998a, 2000) which was found in all the isolates expressing the rdar morphotype prototype: The positive regulatory cascade of rdar morphotype expression starts with the global transcriptional regulator ompR, which activates expression of csgD, the specific transcriptional regulator of the rdar morphotype (Rˆmling et al., 2000). In this study we found serovar- and strain-specific deviations from the common network structure (Fig. 7). CsgD promoter expression of the regulated rdar morphotype in S. Enteritidis is only partially dependent on rpoS, but rpoS is required for expression of the csgD promoter in the regulated rdar morphotype in S. Typhimurium (Rˆmling et al., 1998a). In a single strain of S. Enteritidis, cellulose biosynthesis was (partially) uncoupled from csgD expression. Uncoupling of cellulose biosynthesis from csgD expression has already been observed when cells were grown in a specific nutrient-poor medium (Solano et al., 2002). The genetic background of saw morphotype expression in serovars S. Typhi, S. Choleraesuis and S. Typhimurium var. Copenhagen phage type DT2 and DT99 could not be fully elucidated in this study. The rpoS gene was found intact in all strains of those serovars (Table 1). In contrast to Shigella (Sakellaris et al., 2000), insertions and deletions
Serovar-specific rdar morphotype expression
283
Table 3. Correlation of disease phenotype with rdar morphotype expression. Organism
Disease phenotype
Predominant morphotype
S. Typhimurium S. Typhimurium var. Copenhagen DT2 and DT99 S. Enteritidis S. Typhi S. Choleraesuis S. Gallinarum Shigella EIEC E. coli E. coli
Gastroenteritis in humans Septicaemia in pigeons
rdar/saw saw/saw
Gastroenteritis in humans Typhoid fever in humans Paratyphoid in Pigs Fowl typhoid in chickens Bacillary dysentery Bacillary dysentery Urinary tract infection Sepsis
rdar/saw saw/saw saw/saw Saw/saw Saw/saw ( Sakellaris et al., 2000) Saw/saw ( Sakellaris et al., 2000) Rdar/saw, saw/saw (our unpublished results) Rdar/Rdar, bdar/bdar ( Bian et al., 2000)
were not responsible for non-functionality of the csg locus. The promoter mutation found in a subgroup of S. Typhimurium var. Copenhagen strains could be responsible for non-expression of the csg locus, since it weakened the sequence similarity to the consensus sequence. A G-to-T transversion at the same site has been shown to significantly reduce transcription (Walker et al., 1999). Otherwise, the possibility remains that other genes, which regulate rdar morphotype expression are non-functional. Alternatively, rdar morphotype expression is only silent on plates, but is induced under appropriate environmental conditions as shown for cellulose biosynthesis in Rhizobiae (Ausmees et al., 1999). However, in the sequenced S. Typhi isolate mutations indicating non-functionality of the rdar morphotype are found in the csg and bcs operons (Parkhill et al., 2001). The csgD gene harbors a preliminary stop codon that results in an eight amino acids shorter protein product. In the bcs operon, several stop codons are found early in the bcsC gene. However, the situation might be different in the different serovars. S. Gallinarum strains still showed expression of cellulose. Despite of that fact, cellulose might still not be expressed at the physiological temperature, since the body temperature of chickens is higher. On the other hand, cellulose biosynthesis might contribute to the survival of S. Gallinarum in the environment. The rdar morphotype was consistently not expressed in S. Typhi, S. Choleraesuis and S. Typhimurium var. Copenhagen strains of phage type DT2 and DT99, which represents variants with a very narrow host range ((Rabsch et al., 2002), Table 3). A common feature of the three serovars is that they cause systemic disease in their respective hosts after ingestion by contaminated food or water. Other pathogens, which cause a non-systemic intestinal disease like enteropathogenic E. coli (EPEC), Shi-
gella and enteroinvasive E. coli (EIEC) do not express curli fimbriae (Olsen et al., 1993; Sakellaris et al., 2000) and most likely not cellulose, the other extracellular matrix component of the rdar morphotype. Is there a common denominator in the disease phenotypes, which could be responsible for the loss of the rdar morphotype? While S. Typhimurium and S. Enteritidis invade enterocytes when causing self-limiting gastroenteritis, they do not cross or disrupt the gut epithelium in contrast to EPEC, EIEC and Shigella isolates (Ohl and Miller, 2001; Vazquez-Torres and Fang, 2000). We hypothesize that the loss of rdar morphotype expression is a pathoadaptive trait effective over species borders particularly associated with the disruption of the intestinal epithelial lining. That factors of the host immune system at this side are primarily responsible for the selection against rdar morphotype expression is supported by the fact that enterotoxigenic E. coli and E. coli from extraintestinal infections like strains isolated from sepsis and urinary tract infections do express the rdar morphotype (Table 3). In fact, sepsis strains frequently express the rdar morphotype or curli fimbriae even at 37 8C (Bian et al., 2000). Therefore the rdar morphotype cannot be considered to be a general virulence or antivirulence factor, but its function might be highly determined by the disease model under study. Acknowledgements. U. Rˆmling was the recipient of a fellowship from the program ™Infektionsbiologie∫ from the Bundesministerium f¸r Forschung und Technologie (BMFT) and is presently supported by the Karolinska Institutet (Elitforskartj‰nst). We acknowledge B. Wonde, M. Wahnfried, H. Ragnit, S. Kulbe, V. Trute, H. Gattermann, B. Tannert, and B. Jordan for skillful screening of Salmonella isolates. We thank Ulrich Gerstel for providing strain MAE316.
284
U. Rˆmling et al.
References Ausmees, N., Jonsson, H., Hoglund, S., Ljunggren, H., Lindberg, M.: Structural and putative regulatory genes involved in cellulose synthesis in Rhizobium leguminosarum bv. trifolii. Microbiology. 145, 1253 ± 1262 (1999). Austin, J. W., Sanders, G., Kay, W. W., Collinson, S. K.: Thin aggregative fimbriae enhance Salmonella enteritidis biofilm formation. FEMS Microbiol. Lett. 162, 295 ± 301 (1998). Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K.: Current Protocols in Molecular Biology. John Wiley & Sons, Washington, DC 1994. Baumler, A. J., Gilde, A. J., Tsolis, R. M., van der Velden, A. W., Ahmer, B. M., Heffron, F.: Contribution of horizontal gene transfer and deletion events to development of distinctive patterns of fimbrial operons during evolution of Salmonella serotypes. J. Bacteriol. 179, 317 ± 322 (1997). Bian, Z., Brauner, A., Li, Y., Normark, S.: Expression of and cytokine activation by Escherichia coli curli fibers in human sepsis. J. Infect. Dis. 181, 602 ± 612 (2000). Brown, P. K., Dozois, C. M., Nickerson, C. A., Zuppardo, A., Terlonge, J., Curtiss, R., 3rd: MlrA, a novel regulator of curli (AgF) and extracellular matrix synthesis by Escherichia coli and Salmonella enterica serovar Typhimurium. Mol. Microbiol. 41, 349 ± 363 (2001). Chapman, M. R., Robinson, L. S., Pinkner, J. S., Roth, R., Heuser, J., Hammar, M., Normark, S., Hultgren, S. J.: Role of Escherichia coli curli operons in directing amyloid fiber formation. Science 295, 851 ± 855 (2002). Collinson, S. K., Parker, J. M., Hodges, R. S., Kay, W. W.: Structural predictions of AgfA, the insoluble fimbrial subunit of Salmonella thin aggregative fimbriae. J. Mol. Biol. 290, 741 ± 756 (1999). Dibb-Fuller, M. P., Allen-Vercoe, E., Thorns, C. J., Woodward, M. J.: Fimbriae- and flagella-mediated association with and invasion of cultured epithelial cells by Salmonella enteritidis. Microbiology 145 ( Pt 5), 1023 ± 1031 (1999). Doran, J. L., Collinson, S. K., Burian, J., Sarlos, G., Todd, E. C., Munro, C. K., Kay, C. M., Banser, P. A., Peterkin, P. I., Kay, W. W.: DNA-based diagnostic tests for Salmonella species targeting agfA, the structural gene for thin, aggregative fimbriae. J. Clin. Microbiol. 31, 2263 ± 2273 (1993). Dorel, C., Vidal, O., Prigent-Combaret, C., Vallet, I., Lejeune, P.: Involvement of the Cpx signal transduction pathway of E. coli in biofilm formation. FEMS Microbiol. Lett. 178, 169 ± 175 (1999). Gerstel, U., Rˆmling, U.: Oxygen tension and nutrient starvation are major signals that regulate agfD promoter activity and expression of the multicellular morphotype in Salmonella typhimurium. Environ Microbiol. 3, 638 ± 648 (2001). Gophna, U., Barlev, M., Seijffers, R., Oelschlager, T. A., Hacker, J., Ron, E. Z.: Curli fibers mediate internal-
ization of Escherichia coli by eukaryotic cells. Infect. Immun. 69, 2659 ± 2665 (2001). Hammar, M., Arnqvist, A., Bian, Z., Olsen, A., Normark, S.: Expression of two csg operons is required for production of fibronectin- and congo red-binding curli polymers in Escherichia coli K-12. Mol. Microbiol. 18, 661 ± 670 (1995). Mahan, M. J., Slauch, J. M., Mekalanos, J. J.: Environmental regulation of virulence gene expression in Escherichia, Salmonella, and Shigella spp. In: Escherichia coli and Salmonella: Cellular and Molecular Biology, Vol. 2 (Umbarger, H. E., ed.), pp. 2256 ± 2276. American Society for Microbiology, Washington, DC 1996. Maloy, S., Stewart, V. J., Taylor, R. K.: Genetic analysis of pathogenic bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1996. Ohl, M. E., Miller, S. I.: Salmonella: a model for bacterial pathogenesis. Annu. Rev. Med. 52, 259 ± 274 (2001). Olsen, A., Jonsson, A., Normark, S.: Fibronectin binding mediated by a novel class of surface organelles on Escherichia coli. Nature 338, 652 ± 655 (1989). Olsen, A., Arnqvist, A., Hammar, M., Sukupolvi, S., Normark, S.: The RpoS sigma factor relieves H-NSmediated transcriptional repression of csgA, the subunit gene of fibronectin-binding curli in Escherichia coli. Mol. Microbiol. 7, 523 ± 536 (1993). Parkhill, J., Dougan, G., James, K. D., Thomson, N. R., Pickard, D., Wain, J., Churcher, C., Mungall, K. L., Bentley, S. D., Holden, M. T., Sebaihia, M., Baker, S., Basham, D., Brooks, K., Chillingworth, T., Connerton, P., Cronin, A., Davis, P., Davies, R. M., Dowd, L., White, N., Farrar, J., Feltwell, T., Hamlin, N., Haque, A., Hien, T. T., Holroyd, S., Jagels, K., Krogh, A., Larsen, T. S., Leather, S., Moule, S., O'Gaora, P., Parry, C., Quail, M., Rutherford, K., Simmonds, M., Skelton, J., Stevens, K., Whitehead, S., Barrell, B. G.: Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413, 848 ± 852 (2001). Prigent-Combaret, C., Brombacher, E., Vidal, O., Ambert, A., Lejeune, P., Landini, P., Dorel, C.: Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene. J. Bacteriol. 183, 7213 ± 7223 (2001). Rabsch, W., Andrews, H. L., Kingsley, R. A., Prager, R., Tsch‰pe, H., Adams, L. G., Baumler, A. J.: Salmonella enterica serotype Typhimurium and its host-adapted variants. Infect. Immun. 70, 2249 ± 2255 (2002). Rajashekara, G., Munir, S., Alexeyev, M. F., Halvorson, D. A., Wells, C. L., Nagaraja, K. V.: Pathogenic role of SEF14, SEF17, and SEF21 fimbriae in Salmonella enterica serovar enteritidis infection of chickens. Appl. Environ. Microbiol. 66, 1759 ± 1763 (2000). Rˆmling, U., Bian, Z., Hammar, M., Sierralta, W. D., Normark, S.: Curli fibers are highly conserved between Salmonella typhimurium and Escherichia coli with respect to operon structure and regulation. J. Bacteriol. 180, 722 ± 731 (1998a).
Serovar-specific rdar morphotype expression Rˆmling, U., Sierralta, W. D., Eriksson, K., Normark, S.: Multicellular and aggregative behaviour of Salmonella typhimurium strains is controlled by mutations in the agfD promoter. Mol. Microbiol. 28, 249 ± 264 (1998b). Rˆmling, U., Rohde, M., Olsen, A., Normark, S., Reinkoster, J.: AgfD, the checkpoint of multicellular and aggregative behaviour in Salmonella typhimurium regulates at least two independent pathways. Mol. Microbiol. 36, 10 ± 23 (2000). Sakellaris, H., Hannink, N. K., Rajakumar, K., Bulach, D., Hunt, M., Sasakawa, C., Adler, B.: Curli loci of Shigella spp. Infect. Immun. 68, 3780 ± 3783 (2000). Solano, C., Garcia, B., Valle, J., Berasain, C., Ghigo, J. M., Gamazo, C., Lasa, I.: Genetic analysis of Salmonella enteritidis biofilm formation: critical role of cellulose. Mol. Microbiol. 43, 793 ± 808 (2002). Sukupolvi, S., Lorenz, R. G., Gordon, J. I., Bian, Z., Pfeifer, J. D., Normark, S. J., Rhen, M.: Expression of thin aggregative fimbriae promotes interaction of Salmonella typhimurium SR-11 with mouse small intestinal epithelial cells. Infect. Immun. 65, 5320 ± 5325 (1997). Uhlich, G. A., Keen, J. E., Elder, R. O.: Variations in the csgD promoter of Escherichia coli O157:H7 associated with increased virulence in mice and increased
285
invasion of HEp-2 cells. Infect. Immun. 70, 395 ± 399 (2002). Updegraff, D. M.: Semimicro determination of cellulose in biological materials. Anal Biochem. 32, 420 ± 424 (1969). Walker, K. A., Atkins, C. L., Osuna, R.: Functional determinants of the Escherichia coli fis promoter: roles of 35, 10, and transcription initiation regions in the response to stringent control and growth phase-dependent regulation. J. Bacteriol. 181, 1269 ± 1280 (1999). van der Velden, A. W., Baumler, A. J., Tsolis, R. M., Heffron, F.: Multiple fimbrial adhesins are required for full virulence of Salmonella typhimurium in mice. Infect. Immun. 66, 2803 ± 2808 (1998). Vazquez-Torres, A., Fang, F. C.: Cellular routes of invasion by enteropathogens. Curr. Opin. Microbiol. 3, 54 ± 59 (2000). Wilcock, P. B., Schwarz, K. J.: Salmonellosis. In: Diseases of Swine (A. D. Leman, B. E. Straw, W. E. Mengeling, S. D'Allaire, D. J. Taylor, eds.), pp. 570 ± 583. Iowa State University Press, Iowa 1992. Zogaj, X., Nimtz, M., Rohde, M., Bokranz, W., Rˆmling, U.: The multicellular morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the second component of the extracellular matrix. Mol. Microbiol. 39, 1452 ± 1463 (2001).
Occurrence and regulation of the multicellular morphotype in Salmonella serovars important in human disease Ute Rˆmling a,b, Werner Bokranzb, Wolfgang Rabschc, Xhavit Zogaja, Manfred Nimtzd, Helmut Tsch‰pec a b c
d
Microbiology and Tumorbiology Center (MTC), Karolinska Institute, Stockholm, Sweden Department of Cell Biology and Immunology, GBF, Braunschweig, Germany National Reference Center for Salmonellae and other Enteric Pathogens, Robert Koch-Institut, Wernigerode, Germany Department of Structural Biology, GBF, Braunschweig, Germany
Received March 11, 2003 ¥ Revision received April 17, 2003 ¥ Accepted May 2, 2003
Abstract Multicellular behavior in Salmonella Typhimurium ATCC14028 called the rdar morphotype is characterized by the expression of the extracellular matrix components cellulose and curli fimbriae. Over 90% of S. Typhimurium and S. Enteritidis strains from human disease, food and animals expressed the rdar morphotype at 28 8C. Regulation of the rdar morphotype occurred via the response regulator ompR, which activated transcription of csgD required for production of cellulose and curli fimbriae. Serovar-specific regulation of csgD required rpoS in S. Typhimurium, but was partially independent of rpoS in S. Enteritidis. Rarely, strainspecific temperature-deregulated expression of the rdar morphotype was observed. The hostrestricted serovars S. Typhimurium var. Copenhagen phage type DT2 and DT99, Salmonella Typhi and Salmonella Choleraesuis did not express the rdar morphotype, while in Salmonella Gallinarum cellulose expression at 37 8C was seen in some strains. Therefore, the expression pattern of the rdar morphotype is serovar specific and correlates with a disease phenotype breaching the intestinal epithelial cell lining. Key words: cellulose ± curli fimbriae ± biofilm ± ompR ± rpoS ± thin aggregative fimbriae
Introduction In the two Salmonella species, Salmonella enterica and Salmonella bongori, the occurrence of certain fimbrial operons is usually restricted to a subset of particular subspecies and even particular serovars. An exception is the curli fimbriae (previously called thin aggregative fimbriae (agf)) operon in Salmonella species, which is present in the two Salmonella species and also in Escherichia coli (Baumler et al.,
1997; Doran et al., 1993). Curli fimbriae are one major component of the extracellular matrix involved in multicellular behavior called the rdar morphotype (Rˆmling et al., 1998b). Recently, the second extracellular matrix component was identified to be cellulose (Zogaj et al., 2001). Curli fimbriae and cellulose play a role in bacterial cell-cell interactions. Biofilm formation on abiotic surfaces, bacterial aggregation, pellicle formation, and a bacterial network on agar plates are expres-
Corresponding author: Ute Rˆmling, Microbiology and Tumorbiology Center (MTC), Box 280, Karolinska Institutet, SE-17177 Stockholm, Sweden. Phone: 46 8 5248 7319, Fax: 46 8 330 744, E-mail: [email protected]
1438-4221/03/293/04-273 $ 15.00/0
274
U. Rˆmling et al.
sion modes of the stationary-phase-expressed rdar morphotype (Austin et al., 1998; Rˆmling et al., 1998b). Knock-out of the two extracellular matrix components leads to single cell behavior (the saw morphotype; (Rˆmling et al., 2000)). While several phenotypes associated with virulence can be attributed to curli fimbriae (Bian et al., 2000; Chapman et al., 2002; Dibb-Fuller et al., 1999; Gophna et al., 2001; Olsen et al., 1989; Sukupolvi et al., 1997; Uhlich et al., 2002) the in vivo role of those fibers in Salmonella species in pathogen-host interactions is yet elusive (Rajashekara et al., 2000; Rˆmling et al., 2000; van der Velden et al., 1998). In two commonly used virulent Salmonella enterica serovar Typhimurium (Salmonella Typhimurium) strains, ATCC14028 and SR-11, the rdar morphotype is highly regulated by environmental conditions and only expressed at a certain constellation of medium composition with oxygen tension (Gerstel and Rˆmling, 2001; Rˆmling et al., 1998a). However, iron deficiency was found to relieve temperature regulation (Rˆmling et al., 1998b). The rdar morphotype is regulated by csgD, a transcriptional regulator of the UhpA family (Hammar et al., 1995; Rˆmling et al., 2000). Phase variation of rdar morphotype expression occurred in ATCC14028 and SR-11. Individual csgD promoter mutations were isolated that relieve temperature dependence of rdar morphotype expression (Rˆmling et al., 1998b). Through those mutations, some components of the regulatory network changed. While ompR was still needed for the expression of csgD, the sigma factor required for csgD promoter expression, changed from dS to the housekeeping sigma factor dD (Rˆmling et al., 1998b). Although expression of curli fimbriae has been analysed by molecular methods in Salmonella serotypes (Doran et al., 1993), no systematic study exists which analyses expression of the rdar morphotype, and in particular biosynthesis of cellulose, on a molecular level. We were interested whether the rdar morphotype, as exemplified by S. Typhimurium strains ATCC14028 and SR-11, is a common behavior of Salmonella serovars important for human health.
Materials and methods Bacterial strains All S. Typhimurium and S. Enteritidis strains ( > 800 strains) submitted during four weeks to the National Reference Center for Salmonellae and other Enteric
Pathogens, Wernigerode, Germany, were screened for the multicellular morphotype as described below. The phage typing of the different serovars was performed according to the International Federation of Enteric Phage Typing, Secretary L.R. Ward, Colindale Institute, London. Nineteen S. Typhi strains (disease (d) and carrier status (c )) of various origins and phage types (PT) were: 768/00, d, India, PT E1a; 1630/00, c, Germany, PT E1b; 2714/00, d, India, PT E1a; 2798/00, c, Germany, PT F4; 3434/00, d, introduced from tropical country, PT D1; 3728/00, d, Turkey, PT 28; 8661/00, d, Germany, PT C4; 10392/00, d, Spain, PT T; 51/01, c, Germany, PTE1b; 176/01, d, Indonesia, PT F2; 1506/01, d, Egypt, PT G1; 2300/01, d, Bangladesh, PT ubI; 4943/01, d, Iran, PT A; 5139/01, d, Pakistan, PT ubII; 5989/01, d, Pakistan, PT E1a; 6137/01, d, Italy, PT A; 7794/01, d, Germany, PT ut/ViÆ; 7795/01, d, Turkey, PT D6; 7796/01, d, Pakistan, PT E1a. Seventeen S. Choleraesuis strains were (strain, origin, source): 0003726, Turkey, animal; 00-02998, India, animal; 0002997, India, unknown origin; 00-02948, India, unknown origin; 00-02114, Germany, unknown origin; 0001048, India, pig; 99-07230, Germany, human; 9902397, Germany, human; 98-05543, Germany, unknown origin, 98-04389, Germany, human; 97-07869, Germany, pig; 97-01185, Germany, human; 96-08742, Germany, meat; 96-03644, Germany, pig; 96-02404, Germany, pig; 96-02240, Germany, human; 96-01171, Germany, human. In addition, 23 S. Gallinarum biovar. Pullorum and 11 biovar S. Gallinarum strains isolated between 1957 and 2001 were investigated. Growth conditions and morphotype identification S. Typhimurium and S. Enteritidis strains submitted to the Reference Center were directly streaked on Congo Red (CR) plates, which are Luria Bertani (LB) plates without salt supplemented with CR (40 mg/ml) and Coomassie brilliant blue (20 mg/ml). Colony morphologies were assessed on CR plates after growth at 37 8C for 24 h and at 28 8C for 48 h according to the basic morphotypes detected in S. Typhimurium ATCC14028 mutants: rdar (expresses curli fimbriae and cellulose), pdar (expresses cellulose), bdar (expresses curli fimbriae) and saw (no expression of curli fimbriae nor cellulose). Indication for cellulose production was obtained when fluorescent colonies were observed under a 366-nm UV light source after growth on Calcofluor (fluorescent brightener 28) plates (LB without salt agar plates with 50 mM Calcofluor). If not otherwise indicated, for subsequent analysis bacterial strains were grown in LB broth without salt or on plates made with the same broth at 37 8C for 24 h or at 28 8C for 48 h. Mutant construction Strains S. Typhimurium MAE28 (DcsgD101::Km), JF2757 (ompR43::MudJ), MAE316 (rpoS::Km, Gerstel et al., unpublished) and MAE150 (bcsA101::MudJ) were used to prepare P22 phage lysates, which were subsequently used to construct respective mutants.
Serovar-specific rdar morphotype expression Phage P22 HT105/1 int-201 was used for transduction of S. Typhimurium and S. Enteritidis strains according to the recommended protocol (Maloy et al., 1996). Strains were restreaked on LB or CR plates containing 10 mM ethylene glycol-bis(b-aminoether)N-N-N',N'-tetra-acetic acid (EGTA) to eliminate the phage. Phenotypic screens M9 minimal medium (Ausubel et al., 1994) was used to check for auxotrophy. The presence of an intact rpoS allele was assessed indirectly by assaying catalase activity. Ten ml of a 30% hydrogen peroxide (H2O2) solution were added to plate-grown cells and the dismutation of H2O2 into H2O and O2 was recorded by the observation of extensive bubble formation. To judge motility, a toothpick with adherent cells was stabbed into 0.3% LB agar and the appearance of concentric rings of moving cells was recorded after 24 h. Detection of curli fimbriae Since curli fimbriae tend to aggregate we developed an enrichment procedure for enhanced visualization and detection on protein gels and Western blots. Three mg of bacteria were harvested from plates and resuspended in 1.5 ml TE (10 mM Tris-HCl, 1 mM EDTA, pH 7.5) with 2% SDS. After incubation for 45 min at 95 8C and centrifugation, the pellet was washed three times with water. After resuspension in 100 ml water, the pellet was lyophilized and resuspended in 20 ml 100% formic acid. After removal of the formic acid, the CsgA-enriched pellet was resuspended in 20 ml SDS sample buffer and 7 ml were loaded onto the gel. Visualization of curli fimbriae subunits was achieved by colloidal Coomassie staining and detection by Western blotting using an anti-CsgA antibody at a dilution of 1 : 1000. Alternatively, CsgA subunits were detected by MALDI-TOF analysis. The CsgA-enriched pellet resuspended in 10 ml 100 % formic acid was applied to the target undiluted or in dilutions up to 10 3. A single prominent peak at 13.4 kDa, which represented the acid-resistant part of the protein (Collinson et al., 1999), indicated the presence of CsgA. Detection of cellulose Crystalline cellulose was isolated by the Updegraff method (incubation in 58% acetic acid, 19% nitric acid at 95 8C for 30 min) as described (Updegraff, 1969; Zogaj et al., 2001). After hydrolysation with 4 N tri-fluoric acid (TFA) the sugar monomers were identified by gas chromatography coupled with mass spectrometry (GC-MS). The presence of glucose as the predominant sugar monomer was considered to be an indicator of cellulose production. Molecular biology methods Molecular biology methods were carried out using standard procedures (Ausubel et al., 1994). Two overlapping PCR products were created to amplify the whole csgDEFG-csgBAC operon; csgDEFG and the intergenic region was amplified with primers AGFG: CCAGGATCCGAGCAACATTCAGCGAATAC and Sp24: TAACTCTGCTGCTACAATCC and csgBAC and the
275
intergenic region was amplified with primers AGFB1: GCTCTGCAGCCAGATCATAATTTGTCG and Sp26: GGACATGTTAACTCCTCAATG.
Results Expression of the multicellular morphotype in Salmonella serotypes More than 800 S. Typhimurium and S. Enteritidis strains which arrived at the National Reference Center during a period of four weeks were screened for the expression of the multicellular morphotype, rdar, bdar, pdar and saw colonies, respectively, at 28 8C and 37 8C on CR plates. More than 90% of the S. Typhimurium and S. Enteritidis isolates expressed the rdar morphotype at 28 8C. In most strains, expression was weak, but clearly to distinguish from the saw morphotype (see strain 00-04013 in contrast to strain 00-04012, Fig. lA, B as a typical example). A subfraction of strains showed a stronger expression of the rdar morphotype (see strains 00-04037 and 97-00728, Fig. 1A, B as typical examples). The bdar and the pdar morphotype were never detected when strains were grown at 28 8C. When grown at 28 8C, nine strains displayed, besides the rdar morphotype, single saw colonies on the original CR plate. Those strains were designated lfs (low frequency switch between morphotypes). Six strains showed a heterogeneous phenotype with approximately equal amounts of rdar/pdar and saw colony morphologies. This phenomenon was mainly detected at 37 8C, but also at 28 8C (examples are strains S. Enteritidis phage type 21, 00-04026 and S. Typhimurium phage type DT104, 00-04020; Fig. 1C). When the rdar/pdar morphotype was restreaked, it remained rdar/pdar. However, when the saw morphotype was restreaked it segregated into rdar/pdar and saw morphologies. Those strains were called hfs (high frequency switch between morphotypes). Frequently, the hfs phenotype was unstable upon subculture as observed in strain 0004026. Expression of a pure rdar morphotype or any variation of it was not detected when the strains were grown at 37 8C. In summary, although there are exceptions, a regulated rdar morphotype expressed at 28 8C, but not at 37 8C is the regular phenotype displayed by S. Typhimurium and S. Enteritidis strains isolated from patients, food and animals. Approximately 10% of the strains showed a saw colony morphology at 28 8C and 37 8C. Those strains were S. Typhimurium var. Copenhagen phage type DT2 and DT99 isolated from pigeons.
276
U. Rˆmling et al.
Serovar-specific rdar morphotype expression
277
Table 1. Phenotypes of S. Typhi, S. Choleraesuis and S. Typhimurium var. Copenhagen strains. CsgA expression [28 8C/37 8C]
Cellulose production
Functional rpoS
/b.
/n.d. (01-07794)
/ /
/b. /b.
n.d./n.d. n.d./n.d.
Saw/saw
/
b./b.
/n.d. (90-00659)
Saw/saw Saw/saw
/ /n.d.
/b. /
n.d./n.d. / (00-08774)
Species
Strains
Phenotype CR plates [28 8C/37 8C]
S. Typhi
00-02714, 01-00176, 01-00051, 01-04943, 01-05989, 01-07794 00-07794 00-01048, 98-04389, 96-08742, 96-02404 89-00655, 63-00657, 61-00658, 90-00659 86-00656 all strains as mentioned in Materials and methods
Saw/saw
/
Saw/saw Saw/saw
S. Typhi S. Choleraesuis
S. Choleraesuis
S. Choleraesuis S. Typhimurium var. Copenhagen
Phenotype Calcofluor plates [28 8C/37 8C]
b., background level; n.d., not determined. According to the level of expression/strength of phenotype, a classification scheme from indicated no expression and indicated strongest expression.
In contrast to S. Typhimurium and S. Enteritidis, which usually cause a self-limiting gastroenteritis in humans, S. Typhimurium var. Copenhagen causes an invasive disease with septicemia in pigeons. Therefore, we wondered, whether other Salmonella serovars associated with invasive disease also showed the saw morphotype. The human-adapted serovar S. Typhi causes typhoid fever, the pigadapted serovar S. Choleraesuis causes paratyphoid and the avian-adapted serovar S. Gallinarum causes fowl typhoid (Rabsch et al., 2002; Wilcock and Schwarz, 1992). Infection of humans by S. Choleraesuis is rare, but important, since it produces a severe disease syndrome. Nineteen S. Typhi, 17 S. Choleraesuis and 23 S. Gallinarum strains were checked for the expression of the rdar morphotype. All S. Typhi and S. Choleraesuis strains showed the saw morphotype at 28 8C as well as at 37 8C (Table 1). The situation was not so clearcut with S. Gallinarum. While the strains displayed a saw morphotype on Congo Red plates, several strains showed Calcofluor binding at 37 8C. One isolate
Prototrophy
Motility
()
, ,
, ,
to was introduced, whereby
expressed a temperature-independent rdar morphotype. Expression of curli fimbriae and cellulose correlates with rdar morphotype expression In the reference strain S. Typhimurium ATCC14028 the rdar morphotype is associated with the expression of the extracellular matrix components curli fimbriae and cellulose, while the saw morphotype does not express any of the two components. We wanted to know whether this is also the case in randomly chosen, epidemiologically unrelated Salmonella serotypes from this study. Nine S. Typhimurium and 5 S. Enteritidis strains (plus hfs or lfs morphotype variants of five strains), 10 S. Typhimurium var. Copenhagen, 7 S. Typhi, and 9 S. Choleraesuis strains were chosen (Tables 1, 2). To reproducibly detect CsgA, a selective enrichment of polymerized fimbriae was developed and CsgA was detected by direct staining of protein gels with colloidal Coomassie Brilliant Blue, by Western
3 Fig. 1. Expression range of the rdar morphotype of S. Typhimurium/S. Enteritidis strains. The rdar morphotype of strains incubated on LB agar plates without salt substituted with CR (upper panel) or Calcofluor (lower panel) at 37 8C for 24 h (A) or at 28 8C for 48 h (B). Strain names are indicated in (A). C) Morphotype switch within a strain. Morphotype mutants of one strain (designated a or b) were grown on LB agar plates without salt substituted with CR (upper panel) or Calcofluor (lower panel) at 28 8C for 48 h. Strains 00-04026 and 97-00728 represent hfs strains, which have lost the hfs phenotype. Strain 00-04020-a still shows the hfs phenotype, which is indicated by the sectored colony. Strain 00-03875 is an lfs strain.
278
U. Rˆmling et al.
Table 2. Phenotypes of S. Typhimurium and S. Enteritidis strains. Strain
S. Typhimurium 00-04012 00-04013 00-04037-a 00-04037-b 00-04020-a 00-04020-b 00-03876-a 00-03876-b 00-03874-a 00-03874-b 00-03875-a 00-03875-b 00-03924 00-07081 S. Enteritidis 00-04026-a 00-04026-b 00-04156 00-04560 97-00728-a 97-00728-b 27655-a 27655-b
Phenotype CR CsgA plates expression [28 8C/37 8C] [28 8C/37 8C]
Functional OmpR Phenotype Cellulose bcsA CsgD RpoS dependence dependence dependence Calcofluor plates production knock-out rpoS [28 8C/37 8C]
Saw/saw Rdar/saw Rdar/saw Saw/saw Saw(hfs)/saw Rdar/saw Rdar/saw Rpdar/saw Rdar/saw Saw/saw Rdar/saw Saw/saw Rdar/saw Rdar/saw
/ / / / / / / / / / / / / /
/ / / / / / / / / / / / / /
Rdar/saw Rdar/pdar Rdar/saw Rdar/saw Rdar/rdar Rdar/saw Rdar/rdar Saw/saw
/ /() / / / / / /
/ / / / / / / /
/ / /
/ /
p.r.
p.r.
p.r.
n.d. p.r.
n.d. p.r.
n.d. p.r.
n.d. p.r. n.d. n.d.
n.d. p.r. n.d. n.d.
n.d. p.r. n.d. n.d.
n.d., not determined; p.r., phage resistant. According to the level of expression a classification scheme from expression and indicated strongest expression.
blot analysis of respective gels and by MALDI-TOF analysis (Figs. 2, 3). Western blot and MALDI-TOF analysis were equally sensitive in the detection of CsgA monomers. The amount of CsgA in each strain varied with the expression level of the rdar morphotype, but was always associated with the rdar morphotype (Fig. 2). Saw morphotypes did not show CsgA expression. Those results were confirmed for independent isolates as well as for morphotype variants. Binding of Calcofluor is associated with the production of cellulose in S. Typhimurium. When Calcofluor is added to agar plates, cellulose-producing colonies fluoresce under a 366-nm UV lamp. In the present Salmonella strain collection, fluorescence was exclusively associated with the expression of the rdar morphotype. A saw morphotype did not fluoresce (Fig. 1 and data not shown). Only the polysaccharide cellulose withstands the treatment with strong acidic solutions at high temperature. From selected colonies, which showed either the rdar or the saw morphotype, crystalline cellulose was isolated by the Updegraff method as described in Materials and methods. Cellulose is composed solely of D-glucose. Therefore, after hydrolysis of the polymer, glucose is detected as
to was introduced, whereby
indicated no
the only sugar monomer by GC-MS. Glucose was detected only from colonies, which displayed the rdar morphotype, while the saw morphotypes showed only trace amounts of the sugar (Fig. 4, Table 2). As an additional control, knock-out mutants in bcsA, the cellulose synthase gene, were created in rdar morphotype strains. As expected, bcsA mutant colonies expressed the bdar morphotype and did not bind Calcofluor (Table 2, Fig. 5 and data not shown). In conclusion, in Salmonella serotypes the rdar morphotype is associated with the expression of curli fimbriae and cellulose.
Biofilm formation Expression of the rdar morphotype mediates biofilm formation in S. Typhimurium ATCC14028. To test the correlation of rdar morphotype expression with biofilm formation in our strain panel, strains with different degrees of rdar morphotype expression were selected and tested for biofilm formation on a glass surface at 28 8C and 37 8C. The degree of biofilm formation correlated with the degree of rdar
Serovar-specific rdar morphotype expression
Fig. 2. Correlation of CsgA expression with rdar morphotype expression in S. Typhimurium, S. Enteritidis and S. Typhi strains. A) Differential expression of CsgA in morphotypes from Fig. 1B. Cells were grown at 28 8C for 48 h, CsgA was enriched as described in Materials and methods, and preparations were separated by SDSPAGE. The upper panel shows a Coomassie-stained gel, while the lower panel shows the corresponding Western blot. r expresses rdar morphotype, s saw morphotype. 1, 00-03876-a; 2, 00-03876-b; 3, 00-04026-b; 4, 00-04037-a; 5, 00-04012; 6, 00-04013; 7, 9700728-a; 8, 97-00728-b; 9, control strain MAE52. B) Coomassie stained PAGE gel of CsgA isolated from the same strains as in (A), but grown at 37 8C. Most of the strains do not express CsgA. p pdar morphotype. C) Coomassie-stained PAGE gel of CsgA isolated from S. Typhi strains grown at 28 8C for 48 h. 1, 51/01; 2, 176/01; 3, 2714/01; 4, 4943/01; 5, 5989/01; 6, 7794/01; 7, 7795/01; 8, control strain MAE52.
morphotype expression (compare Fig. 1A and Fig. 6; data not shown). Regulatory network of rdar morphotype expression In the regular expression pattern seen in vitro on plates the rdar morphotype is not expressed at 37 8C. However, in the reference strain UMR1 temperature regulation of CsgA expression can be overcome by iron deficiency. In our strain panel, all S. Typhimurium isolates with regulated rdar morphotype expression, but not the S. Enteritidis isolates were able to overcome temperature regulation of CsgA expression under iron deficiency (Fig. 7). However, CsgA expression could not be activated by iron deficiency in saw morphotypes at 28 8C as examined in six S. Typhimurium isolates (data not shown).
279
In S. typhimurium ATCC14028 expression of the rdar morphotype is embedded in a regulatory network. On top of the hierarchy stands OmpR, which is required for the expression of CsgD (PrigentCombaret et al., 2001; Rˆmling et al., 1998b). CsgD, a positive transcriptional regulator of the UhpA family regulates the expression of curli fimbriae and cellulose (Rˆmling et al., 2000). We wanted to know whether the rdar morphotype required ompR as well as csgD to be expressed in epidemiologically independent isolates of S. Typhimurium and S. Enteritidis. Therefore, ompR and csgD mutants were created by phage transduction of knock-out alleles. The rdar morphotype of all strains examined was dependent on the ompR and csgD gene loci (Table 2, Fig. 5). The exception was S. Enteritidis 00-004026-b, which showed a pdar morphotype indicating that cellulose expression was partially independent of ompR and csgD. In the regulated rdar morphotype of S. Typhimurium ATCC14028, the csgD promoter requires dS for expression. Consequently, in all S. Typhimurium strains examined deletion of rpoS resulted in a saw morphotype. However, all rpoS mutants of S. Enteritidis strains retained the bdar morphotype, indicating that dS is not required for csgD transcription. However, dS is still needed beyond csgD for the biosynthesis of cellulose. Genetic basis of the switch phenomenon Lfs variants showed a switch from the rdar to the saw morphotype at 28 8C. Expression of the regulated rdar morphotype was dependent on rpoS in the S. Typhimurium strains. On the other hand, rpoS is an unstable trait in S. Typhimurium. We tested the strains for a functional rpoS allele by the catalase assay. All lfs variants that had switched to saw contained a non-functional rpoS allele (Table 2). S. Typhi, S. Choleraesuis and S. Typhimurium var. Copenhagen isolates showed the saw morphotype. However, all those strains contained a functional rpoS allele (Table 1). A global distortion of cell physiology can also be responsible for the downregulation of the rdar morphotype. Therefore, we checked the strains for auxotrophy and all S. Typhi strains were auxotroph. All S. Typhi strains also showed reduced motility (Table 1). With one exception S. Choleraesuis and S. Typhimurium var. Copenhagen strains were prototroph. In Shigella spp. biosynthesis of curli fimbriae is abolished primarily by insertion of IS elements or deletions in the csgDEFG-csgBA(C) locus (Sakellaris et al., 2000). However, when S. Typhi, S. Choleraesuis and S. Typhimurium var. Copenhagen
280
U. Rˆmling et al.
Fig. 3. Detection of CsgA by MALDI-TOF. CsgA was prepared by the enrichment procedure from strain 00-04026-a grown at 28 8C for 48 h (A) or at 37 8C for 24 h (B). CsgA enriched from 3 mg of wet cells was resuspended in 10 ml formic acid. The spectra were collected using a 10 2 dilution of CsgA in formic acid. CsgA is detected as a characteristic peak at ca. 13.3 kDa.
isolates were examined by PCR the csg locus was found intact. The csgD gene and the intergenic region were sequenced in 10 S. Typhimurium var. Copenhagen isolates. The only difference in five isolates was a G-to-T transversion which changed the sequence in the 35 box of the csgD promoter from TTGCTT to TTTCTT and in the other five isolates a silent C-to-A exchange at bp 9 in the csgE gene in comparison with S. Typhimurium strains expreessing the rdar morphotype (Rˆmling et al., 1998b). In S. Typhimurium a switch from the regulated rdar morphotype to a semi-constitutive rdar morphotype is mediated by mutations in the csgD promoter region and leads to a dS-independent expression of csgD (Rˆmling et al., 1998b). There-
fore, we checked strain pairs for mutations in the csgD promoter and the intergenic region. In S. Enteritidis strains, 11 bp changes could be detected in the 521-bp intergenic region between the transcriptional start sites of csgD and csgB. Especially, two serotype-specific mutations, a G-to-T transversion at position 52 and a T-to-C transition at position 54 in the OmpR-binding site could contribute to the partially rpoS-independent expression of csgD (Fig. 8). Most interestingly, strain 9700728-a expressing a semi-constitutive rdar morphotype showed an additional G-to-T transversion at position 44 in comparison with strain 9700728-b, which expressed a regulated rdar morphotype. The same G-to-T transversion occurred also in S. Typhimurium SR-11 when it switched from the
Serovar-specific rdar morphotype expression
281
Fig. 4. Detection of glucose monomers after isolation of crystalline cellulose. After isolation of crystalline cellulose by the Updegraff method (Updegraff, 1969), the macromolecule was hydrolyzed. Derivatized glucose monomers were detected by GC/MS with retention times at 13.76 min (a-glucose) and 13.94 min (b-glucose). Standard of 1 mg myo-inositol was detected at 15.74 min. Representative results are shown for strain 00-04037-a grown at 28 8C for 48 h (A) and at 37 8C for 24 h (B).
Fig. 6. Biofilm formation of representative S. Typhimurium and S. Enteritidis isolates. Biofilm formation correlates with the increasing level of rdar morphotype expression (compare with Fig. 1B). 1, 0004026-b; 2, 00-04037-a; 3, 00-04013; 4, 00-03876-b; 5, 00-04012; 6, 97-00728-a; 7, positive control MAE52; 8, negative control, MAE51 (DcsgD).
Fig. 7. Induction of CsgA expression at 37 8C by iron depletion. 1, S. Typhimurium 00-07081; 2, S. Enteritidis 00-04156; 3, S. Enteritidis 00-04560; 4, S. Typhimurium 00-04020-a; 5, S. Typhimurium 00-04020-b; 6, S. Typhimurium 00-03875-a; 7, S. Typhimurium UMR1 Fig. 5. Morphotype of csgD, ompR, rpoS, and bcsA mutants of S. Typhimurium and S. Enteritidis. Left: S. Typhimurium 00-04037 wild type and mutants, right: S. Enteritidis 00-04026 wild type and mutants. Strains were grown at 28 8C for 48 h.
282
U. Rˆmling et al.
Fig. 8. CsgD promoter alleles found in S. Enteritidis isolates. The 10 and 35 boxes are undelined. Base pairs in the OmpR consensus sequence are shown in italics. S. Enteritidis-specific base pair exchanges are indicated by white letters on a gray background, while the strain-specific base pair exchange is displayed in black on a gray background.
regulated to the semi-constitutive rdar morphotype (Rˆmling et al., 1998b). Therefore, only few mutations seem to confer temperature-independent expression of the rdar morphotype.
Discussion In the reference strain S. Typhimurium ATCC14028 the rdar morphotype is characterized by the expression of an abundant extracellular matrix consisting of curli fimbriae and the polysaccharide cellulose (Zogaj et al., 2001). The genes required for expression of the rdar morphotype are present the two Salmonella species and in E. coli. This finding indicates the general importance of the rdar morphotype for the ecology of those Enterobacteriaceae. To test whether the evaluation of the appearance of a colonial phenotype on agar plates is a reliable screening method, we first checked whether the rdar morphotype can be correlated with the expression of the two extracellular matrix components curli fimbriae and cellulose as in the reference strain ATCC14028 (Zogaj et al., 2001). We found that expression of curli fimbriae and the biosynthesis of cellulose were always correlated with rdar morphotype expression, whereas saw colonies never expressed any of the two components. An additional screen for cellulose biosynthesis is Calcofluor binding. Calcofluor does not bind to colanic acid, the other exopolysaccharide produced by S. Typhimurium (our unpublished results). A temperature-regulated rdar morphotype expressed at ambient temperature, but not at 37 8C is the prototype found in S. Typhimurium and S. Enteritidis isolates from human disease origin. This finding indicates that the rdar morphotype is tightly regulated by environmental conditions, but not necessarily that the rdar morphotype is only required outside a host (Mahan et al., 1996), since temperature regulation of the expression of curli fimbriae
can be overcome by iron deficiency (Fig. 7) in S. Typhimurium isolates and expression of cellulose at 37 8C can occur under more severe starvation conditions (Solano et al., 2002). However, an elusive role for the regulated rdar morphotype in pathogen-host interaction is missing, in particular, since most in vitro studies used mutants with the semi-constitutive rdar morphotype for the characterization of phenotypes (Dibb-Fuller et al., 1999; Sukupolvi et al., 1997; Uhlich et al., 2002) Studies on the regulation of the rdar morphotype have already discovered a complex regulatory network (Brown et al., 2001; Dorel et al., 1999; Prigent-Combaret et al., 2001; Rˆmling et al., 1998a, 2000) which was found in all the isolates expressing the rdar morphotype prototype: The positive regulatory cascade of rdar morphotype expression starts with the global transcriptional regulator ompR, which activates expression of csgD, the specific transcriptional regulator of the rdar morphotype (Rˆmling et al., 2000). In this study we found serovar- and strain-specific deviations from the common network structure (Fig. 7). CsgD promoter expression of the regulated rdar morphotype in S. Enteritidis is only partially dependent on rpoS, but rpoS is required for expression of the csgD promoter in the regulated rdar morphotype in S. Typhimurium (Rˆmling et al., 1998a). In a single strain of S. Enteritidis, cellulose biosynthesis was (partially) uncoupled from csgD expression. Uncoupling of cellulose biosynthesis from csgD expression has already been observed when cells were grown in a specific nutrient-poor medium (Solano et al., 2002). The genetic background of saw morphotype expression in serovars S. Typhi, S. Choleraesuis and S. Typhimurium var. Copenhagen phage type DT2 and DT99 could not be fully elucidated in this study. The rpoS gene was found intact in all strains of those serovars (Table 1). In contrast to Shigella (Sakellaris et al., 2000), insertions and deletions
Serovar-specific rdar morphotype expression
283
Table 3. Correlation of disease phenotype with rdar morphotype expression. Organism
Disease phenotype
Predominant morphotype
S. Typhimurium S. Typhimurium var. Copenhagen DT2 and DT99 S. Enteritidis S. Typhi S. Choleraesuis S. Gallinarum Shigella EIEC E. coli E. coli
Gastroenteritis in humans Septicaemia in pigeons
rdar/saw saw/saw
Gastroenteritis in humans Typhoid fever in humans Paratyphoid in Pigs Fowl typhoid in chickens Bacillary dysentery Bacillary dysentery Urinary tract infection Sepsis
rdar/saw saw/saw saw/saw Saw/saw Saw/saw ( Sakellaris et al., 2000) Saw/saw ( Sakellaris et al., 2000) Rdar/saw, saw/saw (our unpublished results) Rdar/Rdar, bdar/bdar ( Bian et al., 2000)
were not responsible for non-functionality of the csg locus. The promoter mutation found in a subgroup of S. Typhimurium var. Copenhagen strains could be responsible for non-expression of the csg locus, since it weakened the sequence similarity to the consensus sequence. A G-to-T transversion at the same site has been shown to significantly reduce transcription (Walker et al., 1999). Otherwise, the possibility remains that other genes, which regulate rdar morphotype expression are non-functional. Alternatively, rdar morphotype expression is only silent on plates, but is induced under appropriate environmental conditions as shown for cellulose biosynthesis in Rhizobiae (Ausmees et al., 1999). However, in the sequenced S. Typhi isolate mutations indicating non-functionality of the rdar morphotype are found in the csg and bcs operons (Parkhill et al., 2001). The csgD gene harbors a preliminary stop codon that results in an eight amino acids shorter protein product. In the bcs operon, several stop codons are found early in the bcsC gene. However, the situation might be different in the different serovars. S. Gallinarum strains still showed expression of cellulose. Despite of that fact, cellulose might still not be expressed at the physiological temperature, since the body temperature of chickens is higher. On the other hand, cellulose biosynthesis might contribute to the survival of S. Gallinarum in the environment. The rdar morphotype was consistently not expressed in S. Typhi, S. Choleraesuis and S. Typhimurium var. Copenhagen strains of phage type DT2 and DT99, which represents variants with a very narrow host range ((Rabsch et al., 2002), Table 3). A common feature of the three serovars is that they cause systemic disease in their respective hosts after ingestion by contaminated food or water. Other pathogens, which cause a non-systemic intestinal disease like enteropathogenic E. coli (EPEC), Shi-
gella and enteroinvasive E. coli (EIEC) do not express curli fimbriae (Olsen et al., 1993; Sakellaris et al., 2000) and most likely not cellulose, the other extracellular matrix component of the rdar morphotype. Is there a common denominator in the disease phenotypes, which could be responsible for the loss of the rdar morphotype? While S. Typhimurium and S. Enteritidis invade enterocytes when causing self-limiting gastroenteritis, they do not cross or disrupt the gut epithelium in contrast to EPEC, EIEC and Shigella isolates (Ohl and Miller, 2001; Vazquez-Torres and Fang, 2000). We hypothesize that the loss of rdar morphotype expression is a pathoadaptive trait effective over species borders particularly associated with the disruption of the intestinal epithelial lining. That factors of the host immune system at this side are primarily responsible for the selection against rdar morphotype expression is supported by the fact that enterotoxigenic E. coli and E. coli from extraintestinal infections like strains isolated from sepsis and urinary tract infections do express the rdar morphotype (Table 3). In fact, sepsis strains frequently express the rdar morphotype or curli fimbriae even at 37 8C (Bian et al., 2000). Therefore the rdar morphotype cannot be considered to be a general virulence or antivirulence factor, but its function might be highly determined by the disease model under study. Acknowledgements. U. Rˆmling was the recipient of a fellowship from the program ™Infektionsbiologie∫ from the Bundesministerium f¸r Forschung und Technologie (BMFT) and is presently supported by the Karolinska Institutet (Elitforskartj‰nst). We acknowledge B. Wonde, M. Wahnfried, H. Ragnit, S. Kulbe, V. Trute, H. Gattermann, B. Tannert, and B. Jordan for skillful screening of Salmonella isolates. We thank Ulrich Gerstel for providing strain MAE316.
284
U. Rˆmling et al.
References Ausmees, N., Jonsson, H., Hoglund, S., Ljunggren, H., Lindberg, M.: Structural and putative regulatory genes involved in cellulose synthesis in Rhizobium leguminosarum bv. trifolii. Microbiology. 145, 1253 ± 1262 (1999). Austin, J. W., Sanders, G., Kay, W. W., Collinson, S. K.: Thin aggregative fimbriae enhance Salmonella enteritidis biofilm formation. FEMS Microbiol. Lett. 162, 295 ± 301 (1998). Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K.: Current Protocols in Molecular Biology. John Wiley & Sons, Washington, DC 1994. Baumler, A. J., Gilde, A. J., Tsolis, R. M., van der Velden, A. W., Ahmer, B. M., Heffron, F.: Contribution of horizontal gene transfer and deletion events to development of distinctive patterns of fimbrial operons during evolution of Salmonella serotypes. J. Bacteriol. 179, 317 ± 322 (1997). Bian, Z., Brauner, A., Li, Y., Normark, S.: Expression of and cytokine activation by Escherichia coli curli fibers in human sepsis. J. Infect. Dis. 181, 602 ± 612 (2000). Brown, P. K., Dozois, C. M., Nickerson, C. A., Zuppardo, A., Terlonge, J., Curtiss, R., 3rd: MlrA, a novel regulator of curli (AgF) and extracellular matrix synthesis by Escherichia coli and Salmonella enterica serovar Typhimurium. Mol. Microbiol. 41, 349 ± 363 (2001). Chapman, M. R., Robinson, L. S., Pinkner, J. S., Roth, R., Heuser, J., Hammar, M., Normark, S., Hultgren, S. J.: Role of Escherichia coli curli operons in directing amyloid fiber formation. Science 295, 851 ± 855 (2002). Collinson, S. K., Parker, J. M., Hodges, R. S., Kay, W. W.: Structural predictions of AgfA, the insoluble fimbrial subunit of Salmonella thin aggregative fimbriae. J. Mol. Biol. 290, 741 ± 756 (1999). Dibb-Fuller, M. P., Allen-Vercoe, E., Thorns, C. J., Woodward, M. J.: Fimbriae- and flagella-mediated association with and invasion of cultured epithelial cells by Salmonella enteritidis. Microbiology 145 ( Pt 5), 1023 ± 1031 (1999). Doran, J. L., Collinson, S. K., Burian, J., Sarlos, G., Todd, E. C., Munro, C. K., Kay, C. M., Banser, P. A., Peterkin, P. I., Kay, W. W.: DNA-based diagnostic tests for Salmonella species targeting agfA, the structural gene for thin, aggregative fimbriae. J. Clin. Microbiol. 31, 2263 ± 2273 (1993). Dorel, C., Vidal, O., Prigent-Combaret, C., Vallet, I., Lejeune, P.: Involvement of the Cpx signal transduction pathway of E. coli in biofilm formation. FEMS Microbiol. Lett. 178, 169 ± 175 (1999). Gerstel, U., Rˆmling, U.: Oxygen tension and nutrient starvation are major signals that regulate agfD promoter activity and expression of the multicellular morphotype in Salmonella typhimurium. Environ Microbiol. 3, 638 ± 648 (2001). Gophna, U., Barlev, M., Seijffers, R., Oelschlager, T. A., Hacker, J., Ron, E. Z.: Curli fibers mediate internal-
ization of Escherichia coli by eukaryotic cells. Infect. Immun. 69, 2659 ± 2665 (2001). Hammar, M., Arnqvist, A., Bian, Z., Olsen, A., Normark, S.: Expression of two csg operons is required for production of fibronectin- and congo red-binding curli polymers in Escherichia coli K-12. Mol. Microbiol. 18, 661 ± 670 (1995). Mahan, M. J., Slauch, J. M., Mekalanos, J. J.: Environmental regulation of virulence gene expression in Escherichia, Salmonella, and Shigella spp. In: Escherichia coli and Salmonella: Cellular and Molecular Biology, Vol. 2 (Umbarger, H. E., ed.), pp. 2256 ± 2276. American Society for Microbiology, Washington, DC 1996. Maloy, S., Stewart, V. J., Taylor, R. K.: Genetic analysis of pathogenic bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 1996. Ohl, M. E., Miller, S. I.: Salmonella: a model for bacterial pathogenesis. Annu. Rev. Med. 52, 259 ± 274 (2001). Olsen, A., Jonsson, A., Normark, S.: Fibronectin binding mediated by a novel class of surface organelles on Escherichia coli. Nature 338, 652 ± 655 (1989). Olsen, A., Arnqvist, A., Hammar, M., Sukupolvi, S., Normark, S.: The RpoS sigma factor relieves H-NSmediated transcriptional repression of csgA, the subunit gene of fibronectin-binding curli in Escherichia coli. Mol. Microbiol. 7, 523 ± 536 (1993). Parkhill, J., Dougan, G., James, K. D., Thomson, N. R., Pickard, D., Wain, J., Churcher, C., Mungall, K. L., Bentley, S. D., Holden, M. T., Sebaihia, M., Baker, S., Basham, D., Brooks, K., Chillingworth, T., Connerton, P., Cronin, A., Davis, P., Davies, R. M., Dowd, L., White, N., Farrar, J., Feltwell, T., Hamlin, N., Haque, A., Hien, T. T., Holroyd, S., Jagels, K., Krogh, A., Larsen, T. S., Leather, S., Moule, S., O'Gaora, P., Parry, C., Quail, M., Rutherford, K., Simmonds, M., Skelton, J., Stevens, K., Whitehead, S., Barrell, B. G.: Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413, 848 ± 852 (2001). Prigent-Combaret, C., Brombacher, E., Vidal, O., Ambert, A., Lejeune, P., Landini, P., Dorel, C.: Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene. J. Bacteriol. 183, 7213 ± 7223 (2001). Rabsch, W., Andrews, H. L., Kingsley, R. A., Prager, R., Tsch‰pe, H., Adams, L. G., Baumler, A. J.: Salmonella enterica serotype Typhimurium and its host-adapted variants. Infect. Immun. 70, 2249 ± 2255 (2002). Rajashekara, G., Munir, S., Alexeyev, M. F., Halvorson, D. A., Wells, C. L., Nagaraja, K. V.: Pathogenic role of SEF14, SEF17, and SEF21 fimbriae in Salmonella enterica serovar enteritidis infection of chickens. Appl. Environ. Microbiol. 66, 1759 ± 1763 (2000). Rˆmling, U., Bian, Z., Hammar, M., Sierralta, W. D., Normark, S.: Curli fibers are highly conserved between Salmonella typhimurium and Escherichia coli with respect to operon structure and regulation. J. Bacteriol. 180, 722 ± 731 (1998a).
Serovar-specific rdar morphotype expression Rˆmling, U., Sierralta, W. D., Eriksson, K., Normark, S.: Multicellular and aggregative behaviour of Salmonella typhimurium strains is controlled by mutations in the agfD promoter. Mol. Microbiol. 28, 249 ± 264 (1998b). Rˆmling, U., Rohde, M., Olsen, A., Normark, S., Reinkoster, J.: AgfD, the checkpoint of multicellular and aggregative behaviour in Salmonella typhimurium regulates at least two independent pathways. Mol. Microbiol. 36, 10 ± 23 (2000). Sakellaris, H., Hannink, N. K., Rajakumar, K., Bulach, D., Hunt, M., Sasakawa, C., Adler, B.: Curli loci of Shigella spp. Infect. Immun. 68, 3780 ± 3783 (2000). Solano, C., Garcia, B., Valle, J., Berasain, C., Ghigo, J. M., Gamazo, C., Lasa, I.: Genetic analysis of Salmonella enteritidis biofilm formation: critical role of cellulose. Mol. Microbiol. 43, 793 ± 808 (2002). Sukupolvi, S., Lorenz, R. G., Gordon, J. I., Bian, Z., Pfeifer, J. D., Normark, S. J., Rhen, M.: Expression of thin aggregative fimbriae promotes interaction of Salmonella typhimurium SR-11 with mouse small intestinal epithelial cells. Infect. Immun. 65, 5320 ± 5325 (1997). Uhlich, G. A., Keen, J. E., Elder, R. O.: Variations in the csgD promoter of Escherichia coli O157:H7 associated with increased virulence in mice and increased
285
invasion of HEp-2 cells. Infect. Immun. 70, 395 ± 399 (2002). Updegraff, D. M.: Semimicro determination of cellulose in biological materials. Anal Biochem. 32, 420 ± 424 (1969). Walker, K. A., Atkins, C. L., Osuna, R.: Functional determinants of the Escherichia coli fis promoter: roles of 35, 10, and transcription initiation regions in the response to stringent control and growth phase-dependent regulation. J. Bacteriol. 181, 1269 ± 1280 (1999). van der Velden, A. W., Baumler, A. J., Tsolis, R. M., Heffron, F.: Multiple fimbrial adhesins are required for full virulence of Salmonella typhimurium in mice. Infect. Immun. 66, 2803 ± 2808 (1998). Vazquez-Torres, A., Fang, F. C.: Cellular routes of invasion by enteropathogens. Curr. Opin. Microbiol. 3, 54 ± 59 (2000). Wilcock, P. B., Schwarz, K. J.: Salmonellosis. In: Diseases of Swine (A. D. Leman, B. E. Straw, W. E. Mengeling, S. D'Allaire, D. J. Taylor, eds.), pp. 570 ± 583. Iowa State University Press, Iowa 1992. Zogaj, X., Nimtz, M., Rohde, M., Bokranz, W., Rˆmling, U.: The multicellular morphotypes of Salmonella typhimurium and Escherichia coli produce cellulose as the second component of the extracellular matrix. Mol. Microbiol. 39, 1452 ± 1463 (2001).