Occurrence of canine hemotropic mycoplasmas in domestic dogs from urban and rural areas of the Valdivia Province, southern Chile

Accepted Manuscript Title: OCCURRENCE OF CANINE HEMOTROPIC MYCOPLASMAS IN DOMESTIC DOGS FROM URBAN AND RURAL AREAS OF THE VALDIVIA PROVINCE, SOUTHERN CHILE Author: Francisco Soto Romina Walker Maximiliano Sepulveda Pedro Bittencourt Gerardo Acosta-Jamett Ananda Muller ¨ PII: DOI: Reference:

S0147-9571(16)30120-5 http://dx.doi.org/doi:10.1016/j.cimid.2016.11.013 CIMID 1115

To appear in: Received date: Revised date: Accepted date:

10-8-2016 18-11-2016 23-11-2016

Please cite this article as: Soto Francisco, Walker Romina, Sepulveda Maximiliano, Bittencourt Pedro, Acosta-Jamett Gerardo, Muller ¨ Ananda.OCCURRENCE OF CANINE HEMOTROPIC MYCOPLASMAS IN DOMESTIC DOGS FROM URBAN AND RURAL AREAS OF THE VALDIVIA PROVINCE, SOUTHERN CHILE.Comparative Immunology, Microbiology and Infectious Diseases http://dx.doi.org/10.1016/j.cimid.2016.11.013 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

OCCURRENCE OF CANINE HEMOTROPIC MYCOPLASMAS IN DOMESTIC DOGS FROM URBAN AND RURAL AREAS OF THE VALDIVIA PROVINCE, SOUTHERN CHILE.

Francisco Soto1, Romina Walker1, Maximiliano Sepulveda2, Pedro Bittencourt1, Gerardo Acosta-Jamett3, Ananda Müller1* 1

Institute of Veterinary Clinical Sciences, Faculty of Veterinary Sciences, Universidad

Austral de Chile, Valdivia, Chile 2

Gerencia de Áreas Silvestres Protegidas, Corporación Nacional Forestal, Santiago de

Chile, Chile. 3

Institute of Veterinary Preventive Medicine and Applied Research Program on Wildlife,

Faculty of Veterinary Sciences, Universidad Austral de Chile, Valdivia, Chile.

Corresponding author: *Ananda Müller DVM, PhD. Veterinary Hospital UACh, Fundo Teja Norte S/N, PO Box 567, Valdivia, Chile. Email:[email protected], Tel: 56 63 2221075.

 

1

Highlights Mhc, CMhp and CMt are firstly described in dogs from Chile Higher occurrence of hemoplasmas was found in rural dogs compared to urban ones Older male dogs from rural localities were at higher risk for hemoplasma positivity  

Abstract

This is the first study to investigate the occurrence, risk factors and hematological findings of hemoplasmas in dogs from Chile. Complete blood count and 16S rRNA conventional PCR for Mycoplasma spp. were performed in 278 blood samples from rural (n=139) and urban (n=139) dogs in Valdivia. Real time 16S rRNA PCR (qPCR) allowed species identification. Mycoplasma spp. occurrence was 24.8%. ´Candidatus M. haematoparvum´ (CMhp) was identified in 12.2% and Mycoplasma haemocanis (Mhc) in 11.9% dogs. It was not possible to identify species in two Mycoplasma spp. samples by qPCR. Sequencing allowed identifying one of them as ´Candidatus M. turicensis´ (CMt). Frequency in rural localities was higher (41.7%) than in urban (7.9%). Rural locality, maleness and older age were risk factors for hemoplasmosis. Hemoplasma-positive dogs had a higher total protein. This is the first report of Mhc, CMhp and CMt in dogs from Chile, with a high occurrence in rural localities.

Key words: Hemoplasma; PCR; qPCR; Risk Factors; hematological findings; Mycoplasma haemocanis; ´Candidatus Mycoplasma haematoparvum´; ´Candidatus M. turicensis´; South America  

2

1. Introduction

Hemotropic mycoplasmas, also known as hemoplasmas, are small, pleomorphic, cell wallfree bacteria that have been detected in the blood of various mammals, including domestic dogs [1]. Two species of hemoplasmas that infect dogs have been described worldwide: Mycoplasma haemocanis (Mhc) [2] and ´Candidatus Mycoplasma haematoparvum´ (CMhp) [3,4]. The natural route of transmission to the dog remains unknown, but it might occur by arthropod vectors [5]. Only Mhc has been proven to be experimentally transmitted by the brown dog tick (Rhipicephalus sanguineus sensu latu) [6]. Several risk factors are associated to canine hemoplasma infections, such as age [7,8], breed (crossbreeds), origin (kennel-raised dogs), mange infection [8], sex (males) [9], vector infestation [10] and coinfection with other vector-borne pathogens [11]. However, the clinical manifestations are related to stress conditions, concomitant diseases, immunosuppression or after splenectomy [1,8]. Hematological findings may vary depending on the stage of hemoplasma infection. During the acute phase of the disease common findings are: anemia [12–18], anisocytosis [12,13,17,18], polychromasia [12,13,17], nucleated red blood cells [12–16], spherocytes [12], reticulocytosis [13–16], Howell-Jolly bodies [13,14,17,18], echinocytes [19] and a positive Coombs test [12,20]. Also, leukopenia [15,18,21,22], neutropenia [12,15,23] or leukocytosis [16,18,24], with an initial temporary left shift [18] and delayed lymphocytosis, can occur [22]. There is no consensus on an alteration in the platelet count associated with canine hemoplasmas, both thrombocytopenia and thrombocytosis were described

 

3

[12,14,15]. During chronic infections, hematologic abnormalities may be associated with moderate anemia and leukopenia [1,23]. Over the last years, molecular detection of hemoplasmas is the preferred diagnostic tool [9,25–30], the polymerase chain reaction (PCR) being the best alternative due to its high sensitivity and specificity [1,5,9,23,25,28]. It is a useful tool for Mycoplasma DNA detection in acute cases with massive bacteremia and also in cases with minimal bacterial loads, when microscopic methods would be insensitive [31,32]. Hemoplasmas have a worldwide distribution [5]. Molecular prevalence in dogs ranges from 0.48% to 44.7% for Mhc and 0.3% to 33.3% for CMhp as shown in studies from France [33], Greece [34], Italy, Portugal [8], Spain [8,11], Switzerland [25], Romania, Hungary [35], Germany [20], Albania [36], Tanzania, Trinidad [9], Brazil [7,10,37–39], USA [40], Iran [29], India [41], Japan [42], Sudan [43], Gabon [44], Nigeria [45], Cambodia [46], Thailand [47] and Australia [48–50]. Coinfection rates range from 0.5 % to 2.6% [8,11,33,34]. Only one study worldwide, performed in Brazil, compared the prevalence of hemoplasmas in dogs from urban and rural areas, being higher in rural zones [37]. In Chile a high prevalence (56.7%) of Mycoplasma spp. infection was detected by PCR in Darwin foxes (Lycalopex fulvipes) from Chiloé Island (southern Chile) [51]. Also, Hemotropic mycoplasmas were detected by PCR in naturally infected cats from Chillán city (central Chile), with a prevalence of 13.3% [52], and in Valdivia city (southern Chile) with a prevalence of 15.1% [53]. Nevertheless, little information concerning hemoplasmosis in dogs from Chile is available. The first and unique case of hemoplasma infecting a dog from Chile was reported in a five-year-old male German Mastiff, from Curicó city (central Chile), that presented non-regenerative anemia and rod shape structures

 

4

in a blood smear consistent with Mycoplasma spp., parasitizing approximately 37.8% of the erythrocytes [54]. The aim of the present study was to investigate the molecular occurrence of hemoplasmas in domestic dogs from urban and rural areas of the Valdivia Province, southern Chile and to assess risk factors and hematological parameters associated with hemoplasma PCR-positive dogs.

2. Materials and Methods

2.1 Animals

A total of 139 domestic dogs from Valdivia city (urban area) (39°48'30" S, 73°14'30" W) and 139 from the Chaihuín locality (39°56'15“ S, 73°35'19“W), Cadillal Alto locality (39°59'18“ S, 73°31'11“ W), Huiro locality (39°57'59“ S, 73°38'52“ W) and Huape locality (39°54'51“ S, 73°30'55“ W) (rural area) from the Valdivia Province, Los Ríos region, southern Chile (Figure 1) were included in the present study. During an 11-month period (December 2014 to November 2015), blood samples of 278 client-owned dogs were taken by a veterinary team. Dogs were sampled regardless of age, sex, health, and reproductive status. Data such as locality, age, gender, origin and veterinary care were recorded for potential risk factors. This study was approved by the Universidad Austral de Chile (UACh) Bioethics Committee; protocol number UACh 250/2016. Each dog owner signed a consent form before samples were taken. Dogs from the urban area (Valdivia city) were from eight Valdivia locations throughout the city in order to acquire a balanced and representative sampling. Samples were taken from  

5

(1) home visits to pet-owning households by a veterinary team; (2) dogs that arrived to the UACh Veterinary Hospital, Valdivia and (3) dogs attending the city spraying program. In rural areas samples were taken in conjunction with a distemper vaccination program taking place at Chaihuín, Cadillal Alto, Huiro and Huape, covering most dog populations in private and state protected areas.

2.2 Hematological analysis

Blood samples were collected aseptically by cephalic venipuncture, aliquoted into two EDTA collecting plastic tubes (Vacutainer®) with 500µL each, and sent to the UACh Veterinary Clinical Pathology Laboratory. One EDTA anticoagulated blood sample was stored at -20ºC until PCR testing. The other EDTA anticoagulated blood was used to perform a complete blood count (CBC). The following parameters were analyzed: red blood cell (RBC), white blood cell (WBC), and platelet (PLT) counts; hemoglobin concentration (HB); packed red cell volume (PCV); mean corpuscular volume (MCV); and mean corpuscular hemoglobin concentration (MCHC). An automated hematology analyzer, KX-21N (Sysmex©, Kobe, Japan), was used. The blood smears were stained with rapid staining Hemacolor® (Merck, Massachusetts, USA) for a differential WBC count. Plasmatic total proteins (TP) were measured by refractometry (Atago®, Tokio, Japan).

2.3 DNA extraction/purification

Frozen EDTA blood samples were thawed at room temperature and vortexed. DNA extraction and purification from 200µL of blood was performed using an "E.Z.N.A. Tissue  

6

DNA Kit" (Omega®, Georgia, USA), according to the manufacturer's instructions, to obtain 100µL of purified DNA. DNA concentration (ng/µL) was measured by fluorometry (Quantus ™ Fluorometer, Promega®, Madisson, USA). Samples with less than 5ng/µL of DNA, were submitted to the extraction/purification step again. DNA was stored at -20°C prior to performing PCR assays.

2.4 PCR assays

2.4.1 Conventional (c) PCR for Mycoplasma spp. screening

The RPS19 gene was used as an internal control assay for canine genomic DNA by using the primers RPS19-F y RPS19-R [55]. The reaction mixture for RPS19 was composed of 12.5µL Gotaq® Green Master Mix (Promega®, Madisson, USA), 400nM of each primer (RPS19-F and RPS19-R), 0.5mM of MgCL2 and 5µL of template DNA brought to a total volume of 25µL with nuclease free water (Thermo Scientific©, USA). The thermic protocol was: 95°C for 2 min followed by 40 cycles of 95°C for 20 s, 61°C for 30 s, 72°C for 30 s and a final extension of 72°C for 5 min. All 278 samples were subjected to a conventional (c) PCR protocol previously described [27], to amplify a 1000 bp region of the 16S rRNA Mycoplasma spp gene. The reaction mixture was composed of 12.5µL Gotaq® Green Master Mix (Promega®, Madisson, USA), 300nM of each primer (HemMycop16S-322s and HemMycop16S-1420as) and 5µL of template DNA brought to a total volume of 25µL with nuclease free water (Thermo Scientific©, USA). The thermal cycling protocol was as follows: 95°C for 2 min followed by 55 cycles of 94°C for 15 s, 68°C for 18 s and 72°C for 18 s. Amplification was completed with a final extension of 72°C for 30 s. All cPCR runs  

7

were performed with nuclease-free water as a negative control. The positive control was generated by gBlock® (Integrated DNA Technologies©, USA) using sequences obtained from the GenBank genetic database from different hemoplasma 16S rRNA gene (AM691834.1, GQ129113.1, DQ157149.1, DQ157160.1,  DQ464421.1, EF416568.1, EF416569.1, EU442639.1, EU789559.1, AY529641.1). The limit of detection (LOD) was expressed as the number of copies/µL and calculated according to the formula: (Xg/µL DNA/ [gBlock length in bp x 660]) x 6.022 x1023 x gblock copies/µL, and estimated using 10-fold serial dilutions from 2x100 to 2x107 of the same gBlock. All reactions were performed in a T100TM Thermal Cycler (Bio-Rad, USA). cPCR products were separated by 2% agarose gel electrophoresis (LE Agarose Seakem®, Lonza) stained with SYBR© Safe DNA gel stain (Thermo Scientific©, USA). DNA extraction/purification, cPCR amplification and electrophoresis were performed in three separate rooms to avoid cross contamination. The primer sequences used in the cPCR assays are shown in Table 1.

2.4.2 Real Time quantitative PCR (qPCR) for species differentiation

All cPCR positive samples were submitted to a modified real-time PCR (qPCR) protocol targeting the 16S rRNA gene as previously described [28] based on the SYBR green PCR principle, to identify the infecting hemoplasma species according to their melting temperature (Mhc:74.04-75.3°C or CMhp: 73.1–74.0°C). The reaction was composed of 5µL of Maxima® SYBR Green/Rox Master Mix (Thermo Scientific©, USA), 700nM of each forward and reverse primer (MY16SF, MY16SR1, MY16SR2) and 2µL of DNA, brought to a total volume of 10µL with nuclease free water (Thermo Scientific©, USA). qPCR amplifications were conducted in MicroAmp® Fast Reaction Tubes (Applied  

8

Biosystems), with a StepOne™ thermocycler (Applied Biosystems). The protocol consisted of: 50ºC for 2 min and 95ºC for 10 min, followed by 40 cycles of 95ºC for 15 s and 60ºC for 1 min. The thermal profile of the dissociation curve was: 95ºC for 15 s, 60ºC for 20 s and an increase from 60ºC to 95ºC for 20 min and finally 95ºC for 15 s. The qPCR was performed following the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) [56]. All real-time PCR reactions were performed in triplicate. Amplification efficiency (E) was calculated from the slope of the DNA-positive control diluted using 10-fold serial dilutions in each run, using the formula: E = 10–1/slope. Genomic blood DNA from dogs naturally infected withby Mhc and CMhp were provided by Dr. Severine Tasker (Bristol University) and used as positive controls. The LOD was expressed, calculated and estimated with the same methods and gBlock used in the cPCR. All PCR runs were performed with nuclease-free water as a negative control. The primer sequences and assays temperatures are shown in Table 2.

2.4.3 Sequencing Samples in which species differentiation was not possible in qPCR due to a higher Tm were resubmitted to a cPCR protocol and sequenced. A modified cPCR protocol [27] was performed to amplify a 1300 bp region of the 16S rRNA Mycoplasma spp. gene with two pairs of primers (Table 1). The reaction mixture was composed of 0.1μL Platinum DNA Polymerase, 2.5μL 10X PCR Buffer, 2μM MgCl2, 0.2μM of each dNTP (dATP, dCTP, dGTP y dTTP) (Thermo Scientific©, USA) 0.5μM of each primer (HemMycop16S-41s and HemMyco16S-938as; HemMycop16S-322s and HemMycop16S-1420as) and 5µL of template DNA brought to a total volume of 25µL with nuclease free water (Thermo Scientific©, USA). The thermal  

9

cycling protocol was as follows: 95°C for 5 min followed by 40 cycles of 94°C for 30 s, 62°C for 30 s and 72°C for 60 s. Amplification was with a final extension of 72°C for 3 min. Obtained cPCR products were purified with the commercial Silica Bead DNA Gel Extraction Kit (Thermo Scientific®, USA) following the manufacturer's instructions and sent to Macrogen® (Korea) for sequencing by the Sanger method [57] in both directions. Consensus sequences were obtained through analysis of the sequenced products, from both the

forward

and

the

reverse

oligonucleotides,

(http://mobyle.pasteur.fr/cgi-bin/MobylePortal/portal.py).

using

the

Sequences

CAP3

program

were

manually

adjusted in Bioedit v. 7.0.5.3 (Carlsbad, CA, USA), submitted to gene GenBank and aligned with published sequences using local alignment search tool (BLASTn).

2.5.

Data analysis

In order to determine overall hemoplasma occurence in dogs from sampling area, the PCRpositive dogs were expressed in percentage (%) of the total number of animals tested, and also separated by origin (urban/rural).

The relationships between risk factors and cPCR positivity were examined using fixedeffect univariable logistic regression. Factors with a likelihood-ratio test p-value < 0.25 were considered for entry into a multivariable logistic regression analysis [58]. The potential risk factors evaluated were locality (urban vs. rural), age (>2 years vs. ≤ 2 years), gender (female vs. male), place of origin (house vs. street/unknown) and veterinary care (yes vs. no). Initially, all selected variables were forced into the multivariable logistic  

10

regression model. Manual backwards elimination was used for model building, excluding variables with a p-value > 0.05 in the likelihood ratio test. The fit of the fixed-effect in the final model was assessed using Hosmer–Lemeshow goodness-of-fit test [59] and the area under the curve of the receiver-operating characteristic (ROC). Odds ratios (OR) were calculated with a 95% confidence interval (CI). To identify hematological parameters associated with hemoplasma infection, descriptive statistics were used. Animals were divided into two groups according to their hemoplasma status at the initial screening (cPCR-positive vs. cPCR-negative). The normal distribution of data was evaluated by Shapiro-Willk. Kruskal-Wallis test was used for data with a nonnormal distribution, to determine if there were any significant differences among the hemoplasma status groups for each hematological variable. A p value ≤ 0.05 was considered statistically significant. Data were analyzed using statistical software R version 2.13.1.

3. Results

3.1 Hemoplasma occurrence

All of the 278 tested samples (mean () and standard deviation (SD) of DNA concentration =33±22.3 ng/µL) were positive for the RPS-19 reference gene and there was no amplification of negative controls. The LOD calculated for Mycoplasma spp. 16s rRNA cPCR was 1x103 copies/µL. According to the cPCR protocol, 69 of 278 samples (24.8%, 95% CI: 19.9-30.4%) were positive for Mycoplasma spp., 11 from 139 samples (7.9% 95%

 

11

CI: 4.2-14.0%) in the urban area and 58 from 139 samples (41.7%, 95% CI: 33.5-50.4%) in the rural area (Table 3). The number of plates used in all qPCR assays was 9. The LOD calculated for Mycoplasma spp. 16s rRNA qPCR was 1x101 copies/µL. Of the 69 positives samples tested by qPCR ( ± SD efficiency of reactions: 93.4 ± 2.67%, r2 = 0.9978 ± 0.0026), 33 (11.9%, 95% CI: 8.416.4%) were identified as Mhc (Tm: 74.04–75.3°C, ±SD Cq: 24.9 ± 2.3) and 34 (12.2%, 95% CI: 8.7-16.8%) as CMhp (Tm: 73.1–74°C, ±SD Cq: 25 ± 1.9) (Table 3). Two samples (A4 and F21) had higher Tm values than expected for Mhc (75.59 and 75.85°C, respectively) and identification of the species was not possible with qPCR (Table 4). Consistent sequencing results were obtained only for a 900bp fragment of the 16S rRNA gene from sample F21 (Genbank accession number: KY117663). Blastn analysis showed 97% identicalness with ´Candidatus M. turicensis` (CMt) (GenBank accession numbers: DQ464420, DQ157151, AY831867). Due to low signal strength in sample A4 electropherogram, it was not possible to identify species.

3.2 Risk factor analysis

Of the five risk factors analyzed in the univariable fixed logistic model, only four passed to the multivariable test: location, age, gender and veterinary care. The number of animals per category, their respective OR and p value are shown in Table 5. When including the four variables in a multivariate logistic analysis, only location, age and gender were considered risk factors for hemoplasma positivity in dogs (Table 6).

 

12

3.3 Hematological analysis

Six samples were excluded from this analysis as they were coagulated and the platelet count was performed in 242 samples. All variables were found to have a non-normal distribution. Only TP was significantly higher (p<0.01) in hemoplasma positive dogs. No other parameter was significantly different between positive and negative dogs (Table 7).

4. Discussion

Mhc, CMhp and CMt are identified for the first time in domestic dogs from Chile. Candidatus M. turicensis` is a felid hemoplasma species and is reported for the second time worldwide in a domestic dog [37]. Since CMhp and CMt were previously described in cats [53] and Mhc and CMt in foxes [51] from the country, it was expected that dogs would also be infected as confirmed in this study. Also, a spill-over between domestic and wildlife canids and felids in the country was previously suspected [51]. The overall occurrence (24.8%) in our study was higher than most others performed worldwide, such as in Switzerland (1.2%) [25], France (15.4%) [33], Italy (9.5%) [8], Spain (14.9%) [11], Greece (10.6%) [34], Hungary (1.2%), Romania (12,3%) [35], Nigeria (7.7%) [45], Brazil (6.9%) [10], Trinidad (8.7%) [9], USA (1.3%) [40], India (12.2%) [41], Cambodia (12.8%) [46] Thailand (19.9%) [47], Australia (1.3%) [49], Tanzania (20%) and Iran (23%) [29]; being only lower than that found in Portugal (40%) [8], Sudan (42.3%) [43], Gabon (44.7%) [44] and Brazil (44.7%) [7]. Nevertheless, a comparison is difficult, mainly because of the low  

13

number of dogs (n=40) and inclusion criteria used in previous studies from Portugal [8] and Sudan (n=78) [43]. Also, in the study from Gabon [44], despite the higher number of sampled animals (n=255), dogs were all infested with fleas or ticks, increasing the possibilities of being Mycoplasma spp. positive. Similar to the situation described in Brazil [7], where the population of dogs (n=132) was highly exposed to tick bites. However, the high prevalence observed in Valdivia is clearly influenced by the positivity of rural dogs. It is important to notice that the LOD in the qPCR was lower than cPCR, so the prevalence could be underestimated. The frequency of Mhc positivity in Valdivia was similar to that reported for CMhp, as in other studies in dogs [8,25,34,40,60], and no coinfections were detected. The mean hemoplasma frequency (7.1%) detected in domestic dogs from the urban area (Valdivia city) is lower than previously described in cats (15%) from exactly the same region and sampling conditions [53]. This differs to reports from previous studies [11] in which the prevalence of hemoplasmas in dogs (14.9%) was similar to those found in cats (14.1%), both treated in the same veterinary hospital. The higher occurrence of hemoplasma in dogs from rural (41.7%) compared to urban (7,1%) environments, also considered as a risk factor for hemoplasmosis in this study, was only observed in dogs from Brazil [37]. Furthermore, high prevalence of hemotropic mycoplasmas was described in domestic dogs from a rural settlement in southern Brazil (44,7%) [7], and free roaming dogs from Australia´s rural aboriginal communities (44%) [48], similar to that observed in rural dogs of the present study. A similar frequency of hemoplasma (56%) was described in wild canids (Darwin´s foxes) from Chile [51], when compared to dogs from rural areas of the Valdivia province (41.7%).

 

14

The localities of Chaihuin, Cadillal Alto, Huiro and Huape are close to the Valdivian forest which is the natural habitat of endangered Darwin´s foxes [61]. Animals from rural localities of the Valdivia province have free-roaming habits and therefore are more likely to have contact with other animals, both domestic and wild, then dogs from the urban area (personal observation). Transmission of hemoplasmas was previously suspected due to the possible ingestion of infected blood during aggressive contact, which is commonly observed in fighting dogs breeds (Tosa and Pit bull) [42,62]. Transmission of infectious agents and parasites between foxes and dogs was previously described [63–65]

and

explained due to their direct contact, generating a negative impact on the conservation of the foxes [61,63]. Considering this aspect, epidemiology of hemoplasma infections in domestic dogs, in particular those from rural areas should be further investigated to understand the potential impact to domestic dogs and wild animal populations. It is noteworthy that the potential hemoplasma vector, the tick R. sanguineus s.l., has only been reported as far as Angol city (37°48′0″ S, 72°43′0″) [66], which is north of Valdivia. This does not exclude the fact that animals can also be PCR positive in areas where the vector was not reported, as shown in Hungary [35] and Switzerland [25]. However, prevalence in those countries are very low (1,2% in both) [25,35]. It seems that dogs from some rural areas were more prone to tick and flea infestation than urban ones [67,68]. It should be noted that at the time of sampling the dogs from rural areas were only parasitized with fleas, and no ticks were found. This lead to the hypothesis that different transmission routes such as contact with other animal species or other vectors (such as fleas), could play an important role in the transmission of the agent in rural areas of the Valdivia province. Concerning the risk factors, hemoplasmosis was more common in male dogs as described in other studies [9,42]. Eighty-four percent of PCR-positive dogs from the present study  

15

were male. The infection prevalence in male dogs may be due to their behavior patterns such as biting and fighting [9,42,62], which was also described in Tanzanian male dogs [9] and cats [69–73]. Therefore, the increased risk for male dogs and outdoor access supports the hypothesis of horizontal transmission via fighting between dogs [42,62] which appears to be a major infection route of dog hemoplasmas. Increasing positivity in older dogs as opposed to juvenile ones was alsoobserved in Brazil [7]. This may be explained by increased exposure to infection throughout life and/or it could also reflect a chronic clinical picture due to their long-term carrier state [15,21,25]. Two follow-up infection studies [15,25] were not able to show a clearance of infection, with positive qPCR results over the whole duration of the experiment. Similar results were found in cats, were some studies indicated that older individuals had an increased risk of exposure over time, producing a chronic asymptomatic carrier state [74–77]. Nevertheless, a previous report in Europe described the opposite, reporting a higher prevalence in younger dogs [8]. Clinical reports of dog hemoplasmosis describe that an acute illness associated with regenerative anemia is the most common finding [12–18], despite other alterations that are rarely observed. However, in our study, no significant differences were found in CBC parameters between a negative and positive hemoplasma status, nor were any described by others [8–11,25,34]. Higher plasmatic total protein in hemoplasma positive dogs, within the reference interval, was the only observed abnormality. Higher plasmatic total protein concentrations could be due to higher immunoglobulin production as part of an antibody response against the agent [18,78–80]. The lack of other hematological findings may be a result of a chronic stage of infection in which no clinical signs or hematologic abnormalities are present [5,20], or it may indicate a low pathogenicity [8] of these agents  

16

in dogs from the Valdivia province. The clinical manifestation of the disease in dogs needs additional factors such as immunosuppression, stress, co infections with more virulent pathogen or splenectomy [1,3,12,18,21,23,81,82]. 5. Conclusions

The overall occurrence of hemoplasmas in our study site is one of the highest reported worldwide. Risk factors are related to older male dogs inhabiting rural sites. Hematological parameters varied minimally in hemoplasma-positive dogs, witch presented a higher total plasmatic protein concentration, within the reference interval. Three hemoplasma species circulate in the studied dog population of Valdivia, being Mhc, CMhp and CMt reported for the first time in domestic dogs from Chile.

Conflict of interest

The authors declare that there are no conflicts of interest regarding the publication of this paper.

Funding We acknowledge the financial support of Postgraduate program, Magister en Ciencias Mención Salud Animal, Universidad Austral de Chile, which enabled this work.

Acknowledgements

 

17

We like to thank DMV Paulina Grob, DMV Erika Silva, the veterinary team of the UACh Veterinary Hospital, park rangers from the Alerce Costero National Park (CONAF) and the Valdivian Coastal Reserve (TNC) for their logistical support and contribution in collecting samples; and CMT Verónica Arnés for the technical support with the CBCs. To Dr. Severine Tasker, Bristol University, for providing the genomic DNA control samples; and finally we wish to thank Dr. Alex Romero and his team at the UACh Biotechnology and Aquatic Immunology Laboratory for their contribution and equipment.

References

[1] [2]

[3]

[4] [5]

[6] [7]

 

J.B. Messick, Hemotrophic mycoplasmas (hemoplasmas): a review and new insights into pathogenic potential., Vet. Clin. Pathol. 33 (2004) 2–13. doi:10.1111/j.1939165X.2004.tb00342.x. J. Messick, P. Walker, parasites from a naturally infected opossum (Didelphis virginiana), alpaca (Lama pacos) and dog (Canis familiaris): phylogenetic and secondary structural, Int. J. Syst. Evol. Microbiol. 52 (2002) 693–698. http://ijs.sgmjournals.org/content/52/3/693.short. J.E. Sykes, N.L. Bailiff, L.M. Ball, O. Foreman, J.W. George, M.M. Fry, Identification of a novel hemotropic mycoplasma in a splenectomized dog with hemic neoplasia., J. Am. Vet. Med. Assoc. 224 (2004) 1946–1951, 1930–1931. doi:10.2460/javma.2004.224.1946. J.E. Sykes, L.M. Ball, N.L. Bailiff, M.M. Fry, “Candidatus Mycoplasma haematoparvum”, a novel small haemotropic mycoplasma from a dog, Int. J. Syst. Evol. Microbiol. 55 (2005) 27–30. doi:10.1099/ijs.0.02989-0. B. Willi, M. Novacco, M.L. Meli, G.A. Wolf-Jäckel, F.S. Boretti, N. Wengi, H. Lutz, R. Hofmann-Lehmann, Haemotropic mycoplasmas of cats and dogs: transmission, diagnosis, prevalence and importance in Europe, Schweiz. Arch. Tierheilk. 152 (2010) 237 – 244. P. Seneviratna, N. Weerasinghe, S. Ariyadasa, Transmission of Haemobartonella canis by the dog tick, Rhipicephalus sanguineus, Res. Vet. Sci. 24 (1973) 112–114. R.F. da C.V.O. Vidotto, T.S.W.J. Vieira, A.M.S. Guimaraes, A.P. dos Santos, N.C. Nascimento, N.J.R. dos Santos, T.F. Martins, M.B. Labruna, M. Marcondes, A.W. Biondo, J.B. Messick, Molecular Investigation of Hemotropic Mycoplasmas in Human Beings, Dogs and Horses in a Rural Settlement in Southern Brazil., Rev Inst Med Trop Sao Paulo. 57 (2015) 353–357. doi:10.1590/S0036. 18

[8]

[9]

[10]

[11]

[12] [13]

[14] [15]

[16] [17] [18]

[19] [20] [21]

 

M. Novacco, M.L. Meli, F. Gentilini, F. Marsilio, C. Ceci, M.G. Pennisi, G. Lombardo, A. Lloret, L. Santos, T. Carrapiço, B. Willi, G. Wolf, H. Lutz, R. Hofmann-Lehmann, Prevalence and geographical distribution of canine hemotropic mycoplasma infections in Mediterranean countries and analysis of risk factors for infection, Vet. Microbiol. 142 (2010) 276–284. doi:10.1016/j.vetmic.2009.09.069. E.N. Barker, S. Tasker, M.J. Day, S.M. Warman, K. Woolley, R. Birtles, K.C. Georges, C.D. Ezeokoli, a. Newaj-Fyzul, M.D. Campbell, O. a E. Sparagano, S. Cleaveland, C.R. Helps, Development and use of real-time PCR to detect and quantify Mycoplasma haemocanis and “Candidatus Mycoplasma haematoparvum” in dogs, Vet. Microbiol. 140 (2010) 167–170. doi:10.1016/j.vetmic.2009.07.006. S.D.F. Valle, J.B. Messick, A.P. dos Santos, L.C. Kreutz, N.C.B. Duda, G. Machado, L.G. Corbellini, A.W. Biondo, F.H.D. González, Identification, occurrence and clinical findings of canine hemoplasmas in southern Brazil, Comp. Immunol. Microbiol. Infect. Dis. 37 (2014) 259–265. doi:10.1016/j.cimid.2014.08.001. X. Roura, I.R. Peters, L. Altet, M.-D. Tabar, E.N. Barker, M. Planellas, C.R. Helps, O. Francino, S.E. Shaw, S. Tasker, Prevalence of hemotropic mycoplasmas in healthy and unhealthy cats and dogs in Spain., J. Vet. Diagn. Invest. 22 (2010) 270– 274. doi:10.1177/104063871002200219. A. Bundza, J.H. Lumsden, B.J. McSherry, V.E. 0 Valli, E.A. Janzen, Haemobartonellosis in a dog in association with coombs’ positive anemia, Can. Vet. J. 17 (1976) 1–4. F. Pitorri, M. Dell’Orco, N. Carmichael, E.N. Barker, M. Hollywood, S. Tasker, Use of real-time quantitative PCR to document successful treatment of Mycoplasma haemocanis infection with doxycycline in a dog, Vet. Clin. Pathol. 41 (2012) 493– 496. doi:10.1111/vcp.12002. H. Sharifiyazdi, M.A. Hasiri, A.H. Amini, Intravascular hemolysis associated with Candidatus Mycoplasma hematoparvum in a non-splenectomized dog in the south region of Iran, 5 (2014) 243–246. K.L. Hulme-Moir, E.N. Barker, A. Stonelake, C.R. Helps, S. Tasker, Use of realtime quantitative polymerase chain reaction to monitor antibiotic therapy in a dog with naturally acquired Mycoplasma haemocanis infection., J. Vet. Diagn. Invest. 22 (2010) 582–587. doi:10.1177/104063871002200413. S.J. Lester, B.J. Hume, B. Phipps, Haemobartonella canis infection following splenectomy and transfusion, Can. Vet. J. 36 (1995) 444–445. H.J. West, Haemobartonellosis in the dog., J. Small Anim. Pract. 20 (1979) 543–549. G. Kemming, J.B. Messick, W. Mueller, G. Enders, F. Meisner, S. Muenzing, H. Kisch-Wedel, a. Schropp, C. Wojtczyk, K. Packert, K. Messmer, E. Thein, Can we continue research in splenectomized dogs? Mycoplasma haemocanis: Old problem New insight, Eur. Surg. Res. 36 (2004) 198–205. doi:10.1159/000078853. B. Lako, A. Potkonjak, J. Balzer, D. Grozdana, Čanak Radoslava, B. Topalski, M. Stevančević, O. Stevančević, First report about canine infections with Candidatus Mycoplasma haematoparvum in Serbia, Acta Vet. Brno. 60 (2010) 507–512. J. Huebner, T. Vahlenkamp, E. Müller, I. Langbein-Detsch, Mycoplasma infection in anaemic and non anaemic dogs in Germany [abstract], in: J. Vet. Intern. Med., 2006: p. 712. M. Benjamin, W. Lumb, Haemobartonella canis infection in a dog, J. Am. Vet. Med. Assoc. 135 (1959) 388–390. 19

[22] E. Donovan, W. Loeb, Hemobartonellosis in the dog, Vet. Med. 55 (1960) 57–62. [23] J.J. Brinson, J.B. Messick, Use of a polymerase chain reaction assay for detection of Haemobartonella canis in a dog., J. Am. Vet. Med. Assoc. 218 (2001) 1943–1945, 1936. [24] R. Brodey, O. Schalm, Hemobartonellosis and thrombocytopenic in a dog, J. Am. Vet. Mediccine Assoc. 143 (1963) 1231–1236. [25] N. Wengi, B. Willi, F.S. Boretti, V. Cattori, B. Riond, M.L. Meli, C.E. Reusch, H. Lutz, R. Hofmann-Lehmann, Real-time PCR-based prevalence study, infection follow-up and molecular characterization of canine hemotropic mycoplasmas, Vet. Microbiol. 126 (2008) 132–141. doi:10.1016/j.vetmic.2007.06.018. [26] M. Varanat, R.G. Maggi, K.E. Linder, E.B. Breitschwerdt, Molecular Prevalence of Bartonella, Babesia, and Hemotropic Mycoplasma sp. in Dogs with Splenic Disease, J. Vet. Intern. Med. 25 (2011) 1284–1291. doi:10.1111/j.1939-1676.2011.00811.x. [27] R.G. Maggi, M.C. Chitwood, S. Kennedy-Stoskopf, C.S. DePerno, Novel hemotropic Mycoplasma species in white-tailed deer (Odocoileus virginianus), Comp. Immunol. Microbiol. Infect. Dis. 36 (2013) 607–611. doi:10.1016/j.cimid.2013.08.001. [28] B. Willi, M.L. Meli, R. Luthy, H. Honegger, N. Wengi, L.E. Hoelzle, C.E. Reusch, H. Lutz, R. Hofmann-Lehmann, Development and Application of a Universal Hemoplasma Screening Assay Based on the SYBR Green PCR Principle, J. Clin. Microbiol. 47 (2009) 4049–4054. doi:10.1128/JCM.01478-09. [29] S. Torkan, S.J. Aldavood, A. Sekhavatmandi, S. Moshkelani, Detection of haemotropic Mycoplasma (Haemobartonella) using multiplex PCR and its relationship with epidemiological factors in dogs, Comp. Clin. Path. 23 (2012) 669– 672. doi:10.1007/s00580-012-1668-2. [30] H. Sharifiyazdi, M. Abbaszadeh Hasiri, M. Radmanesh, Development of RFLP-PCR and simple multiplex PCR assays for detection and differentiation of two species of hemotropic mycoplasmas in naturally infected dogs, Comp. Clin. Path. 25 (2016) 847–853. doi:10.1007/s00580-016-2272-7. [31] S. Tasker, M. Lappin, Haemobartonella felis: recent developments in diagnosis and treatment, J. Feline Med. Surg. 4 (2002) 3–11. doi:10.1053/jfms.2001.0155. [32] K. Berent, J. Messick, S. Cooper, Detection of Haemobartonella felis in cats with experimentally induced acute and chronic infections, using a polymerase chain reaction assay, Am J Vet Res. 59 (1998) 1215–1220. [33] M.J. Kenny, S.E. Shaw, Demonstration of Two Distinct Hemotropic Mycoplasmas in French Dogs, J. Clin. Microbiol. 42 (2004) 5397–5399. doi:10.1128/JCM.42.11.5397. [34] K. V. Tennant, E.N. Barker, Z. Polizopoulou, C.R. Helps, S. Tasker, Real-time quantitative polymerase chain reaction detection of haemoplasmas in healthy and unhealthy dogs from Central Macedonia, Greece, J. Small Anim. Pract. 52 (2011) 645–649. doi:10.1111/j.1748-5827.2011.01126.x. [35] D. Hamel, C. Silaghi, D. Lescai, K. Pfister, Epidemiological aspects on vector-borne infections in stray and pet dogs from Romania and Hungary with focus on Babesia spp., Parasitol. Res. 110 (2012) 1537–1545. doi:10.1007/s00436-011-2659-y. [36] D. Hamel, E. Shukullari, D. Rapti, C. Silaghi, K. Pfister, S. Rehbein, Parasites and vector-borne pathogens in client-owned dogs in Albania. Blood pathogens and seroprevalences of parasitic and other infectious agents, Parasitol. Res. 115 (2016)  

20

[37]

[38]

[39]

[40]

[41] [42] [43]

[44]

[45] [46] [47]

[48] [49]  

489–499. doi:10.1007/s00436-015-4765-8. A.W. Biondo, A.P. Dos Santos, A.M.S. Guimarães, R.F.D.C. Vieira, O. Vidotto, D.D.B. Macieira, N.R.P. Almosny, M.B. Molento, J. Timenetsky, H.A. de Morais, F.H.D. González, J.B. Messick, A review of the occurrence of hemoplasmas (hemotrophic mycoplasmas) in Brazil., Rev. Bras. Parasitol. Vet. 18 (2009) 1–7. doi:10.4322/rbpv.01803001. R. Ramos, C. Ramos, F. Araújo, R. Oliveira, I. Souza, D. Pimentel, M. Galindo, M. Santana, E. Rosas, M. Faustino, L. Alves, Molecular survey and genetic characterization of tick-borne pathogens in dogs in metropolitan Recife (northeastern Brazil), Parasitol. Res. 107 (2010) 1115–1120. doi:10.1007/s00436-0101979-7. T.B. Alves, S.A. Faggion, E. V Santos, P.G. Roberto, S.C. França, A.L. Fachin, M. Marins, Real-time PCR-based study of haemotrophic mycoplasmas in dogs from Ribeirão Preto, Brazil Estudio de micoplasmas hemotróficos en perros de Ribeirão Preto, Brasil, basado en la PCR en tiempo real, Arch Med Vet. 336 (2014) 333–336. S.M. Compton, R.G. Maggi, E.B. Breitschwerdt, Candidatus Mycoplasma haematoparvum and Mycoplasma haemocanis infections in dogs from the United States, Comp. Immunol. Microbiol. Infect. Dis. 35 (2012) 557–562. doi:10.1016/j.cimid.2012.06.004. P.A.M. Abd Rani, P.J. Irwin, G.T. Coleman, M. Gatne, R.J. Traub, A survey of canine tick-borne diseases in India., Parasit. Vectors. 4 (2011) 141. doi:10.1186/1756-3305-4-141. M. Sasaki, K. Ohta, A. Matsuu, H. Hirata, H. Ikadai, T. Oyamada, A molecular survey of Mycoplasma haemocanis in dogs and foxes in Aomori Prefecture, Japan, J. Protozool. Res. 18 (2008) 57–60. H. Inokuma, M. Oyamada, B. Davoust, M. Boni, J. Dereure, B. Bucheton, A. Hammad, M. Watanabe, K. Itamoto, M. Okuda, P. Brouqui, Epidemiological survey of Ehrlichia canis and related species infection in dogs in Eastern Sudan, Ann. N. Y. Acad. Sci. 1078 (2006) 461–463. doi:10.1196/annals.1374.085. J.L. Marié, S.E. Shaw, D. a. Langton, O. Bourry, J. Gomez, B. Davoust, Sub-clinical infection of dogs from the Ivory Coast and Gabon with Ehrlichia, Anaplasma, Mycoplasma and Rickettsia species, Clin. Microbiol. Infect. 15 (2009) 284–285. doi:10.1111/j.1469-0691.2008.02237.x. L.C. Aquino, J. Kamani, A.M. Haruna, G.R. Paludo, C.A. Hicks, C.R. Helps, S. Tasker, Analysis of risk factors and prevalence of haemoplasma infection in dogs, Vet. Parasitol. 221 (2016) 111–117. doi:10.1016/j.vetpar.2016.03.014. T. Inpankaew, S.F. Hii, W. Chimnoi, R.J. Traub, Canine vector-borne pathogens in semi-domesticated dogs residing in northern Cambodia, Parasit. Vectors. 9 (2016) 1. doi:10.1186/s13071-016-1552-z. M. Liu, N. Ruttayaporn, V. Saechan, C. Jirapattharasate, P. Vudriko, P.F.A. Moumouni, S. Cao, T. Inpankaew, A.P. Ybañez, H. Suzuki, X. Xuan, Molecular survey of canine vector-borne diseases in stray dogs in Thailand, Parasitol. Int. 65 (2016) 357–361. doi:10.1016/j.parint.2016.04.011. E.N. Barker, D. a Langton, C.R. Helps, G. Brown, R. Malik, S.E. Shaw, S. Tasker, Haemoparasites of free-roaming dogs associated with several remote Aboriginal communities in Australia, BMC Vet. Res. 8 (2012) 55. doi:10.1186/1746-6148-8-55. S.F. Hii, S.R. Kopp, M.F. Thompson, C. a. O’Leary, R.L. Rees, R.J. Traub, Canine 21

[50]

[51]

[52] [53]

[54] [55] [56]

[57] [58] [59] [60]

[61]

[62]

 

vector-borne disease pathogens in dogs from south-east Queensland and north-east Northern Territory, Aust. Vet. J. 90 (2012) 130–135. doi:10.1111/j.17510813.2012.00898.x. S. Hii, R. Traub, M. Thompson, J. Henning, C. O’Leary, a Burleigh, S. McMahon, R. Rees, S. Kopp, Canine tick-borne pathogens and associated risk factors in dogs presenting with and without clinical signs consistent with tick-borne diseases in northern Australia, Aust. Vet. J. 93 (2015) 58–66. doi:10.1111/avj.12293. J. Cabello, L. Altet, C. Napolitano, N. Sastre, E. Hidalgo, J.A. Dávila, J. Millán, Survey of infectious agents in the endangered Darwin’s fox (Lycalopex fulvipes): High prevalence and diversity of hemotrophic mycoplasmas, Vet. Microbiol. 167 (2013) 448–454. doi:10.1016/j.vetmic.2013.09.034. V. Merino, A. Islas, P. Rivera, A. Cruz, R. Tardón, Mycoplasma haemofelis and “Candidatus Mycoplasma haemominutum” detection by PCR assay in cats of Chillán commune . Preliminar study ., 3 (2011) 49–56. R. Walker, F. Morera, M. Gómez, N. Pereira, P. Arauna, P. Grob, G. Acosta-Jamett, A. Müller, Prevalence, risk factor analysis and hematological findings of hemoplasma infection in domestic cats from Valdivia, southern Chile, Comp. Immunol. Microbiol. Infect. Dis. 46 (2016) 20–26. doi:10.1017/CBO9781107415324.004. W. Rudolph, L. Mora, P. Segovia, Haemobartonella canis en un caso clínico, (1989) 75–76. B. Brinkhof, B. Spee, J. Rothuizen, L.C. Penning, Development and evaluation of canine reference genes for accurate quantification of gene expression, Anal. Biochem. 356 (2006) 36–43. doi:10.1016/j.ab.2006.06.001. S.A. Bustin, V. Benes, J.A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M.W. Pfaffl, G.L. Shipley, J. Vandesompele, C.T. Wittwer, The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments, Clin. Chem. 55 (2009) 611–622. doi:10.1373/clinchem.2008.112797. F. Sanger, S. Nicklen, a R. Coulson, DNA sequencing with chain-terminating inhibitors., Proc. Natl. Acad. Sci. U. S. A. 74 (1977) 5463–7. doi:10.1073/pnas.74.12.5463. I. Dohoo, W. Martin, H. Stryhn, Veterinary Epidemiologic Research, 2nd editio, Edward Island, 2003. D.W. Hosmer, S. Lemeshow, R.X. Sturdivant, Applied Logistic Regression, 3rd ed, New York, USA, 2000. T.B. Alves, S.A. Faggion, E. V Santos, P.G. Roberto, S.C. França, A.L. Fachin, M. Marins, Real-time PCR-based study of haemotrophic mycoplasmas in dogs from Ribeirão Preto , Brazil Estudio de micoplasmas hemotróficos en perros de Ribeirão Preto , Brasil , basado en la PCR en tiempo real, 336 (2014) 333–336. A. Farias, M. Sepúlveda, E. Silva-rodríguez, A. Eguren, D. González, N.I. Jordán, E. Ovando, P. Stowhas, G.L. Svensson, A new population of Darwin’s fox (Lycalopex fulvipes) in the Valdivian Coastal Range, Rev. Chil. Hist. Nat. (2014) 1–3. doi:10.1186/0717-6317-1-3. S.H. Cannon, J.K. Levy, S.K. Kirk, P.C. Crawford, C.M. Leutenegger, J.J. Shuster, J. Liu, R. Chandrashekar, Infectious diseases in dogs rescued during dog fighting investigations, Vet. J. (2016). doi:10.1016/j.tvjl.2016.02.012. 22

[63] [64]

[65]

[66] [67] [68] [69]

[70] [71]

[72]

[73]

[74] [75]

 

K. Pelican, Domestic dogs in rural communities around protected areas: conservation problem or conflict solution?, PLoS One. 9 (2014) e86152. doi:10.1371/journal.pone.0086152. J. Jiménez, C. Briceño, H. Alcáino, S. Funk, D. Gonzalez-Acuña, Coprologic survey of endoparasites from Darwin’s fox (Pseudalopex fulvipes) in Chiloé , Chile Muestreo coprológico de endoparásitos del zorro de Darwin (Pseudalopex fulvipes) en Chiloé , Chile, Arch Med Ve. 97 (2012) 93–97. D. González-Acuña, C. Briceño, A. Cicchino, S.M. Funk, J. Jiménez, First records of Trichodectes canis (Insecta: Phthiraptera: Trichodectidae) from Darwin’s fox, Pseudalopex fulvipes (Mammalia: Carnivora: Canidae), Eur. J. Wildl. Res. 53 (2007) 76–79. doi:10.1007/s10344-006-0066-y. K. Abarca, Flea and ticks species from dogs in urban and rural areas in four districts in Chile Pulgas y garrapatas en perros urbanos y rurales en cuatro regiones en Chile, 115 (2016) 109–115. M. State, A.P. Costa, A.B. Silva, F.B. Costa, S. Gabriel, T.F. Martins, M.B. Labruna, R.M.S.N.C. Guerra, G.S. Xavier, A Survey of Ectoparasites Infesting Urban and Rural Dogs of short communication, 50 (2013) 674–678. F. Dantas-Torres, L. Figueredo, M. Faustino, Ectoparasitos de cães provenientes de alguns municípios da Região Metropolitana do Recife, Pernambuco, Brasil, Rev. Bras. Parasitol. Vet. 13 (2004) 151–154. A. De Santis, H. Miraglia, K. Cartens, L.R. Gonçalves, N. Denardi, I. Domingos, J. Campos, R. Machado, M. André, Molecular detection of hemotrophic mycoplasmas among domiciled and free-roaming cats in Campo Grande , state of Mato Grosso do Sul , Brazil, Braz. J. Vet. Parasitol. 23 (2014) 231–236. J.B. Messick, A.P. Santos, A.M.S. Guimaraes, Complete genome sequences of two hemotropic mycoplasmas, Mycoplasma haemofelis strain Ohio2 and Mycoplasma suis strain Illinois, J. Bacteriol. 193 (2011) 2068–2069. doi:10.1128/JB.00133-11. N.G. Miceli, F.A. Gavioli, L.R. Gonçalves, M.A. Rogério, V.R.F. Sousa, K.C.M. de S. Machado, R. Zacarias, Molecular detection of feline arthropod-borne pathogens in cats in Cuiabá , state of Mato Grosso , central-western region of Brazil, Rev. Bras. Parasitol. Vet. 22 (2013) 385–390. A. Duarte, V. Marques, J.H.D. Correia, I. Neto, B.S. Bráz, C. Rodrigues, T. Martins, R. Rosado, J.P. Ferreira, M. Santos-Reis, L. Tavares, Molecular detection of haemotropic Mycoplasma species in urban and rural cats from Portugal., J. Feline Med. Surg. (2014) 1098612X14550172-. doi:10.1177/1098612X14550172. A.P. Dos Santos, Francisco de Oliveira Conrado, Messick Joanne Belle, A.W. Biondo, S.T. De Oliveira, A.M.S. Guimaraes, N.C. Nascimento, V. Pedralli, C.S. Lasta, Félix Hilário Diaz González, Hemoplasma prevalence and hematological abnormalities associated with infection in three different cat populations from Southern Brazil, Braz. J. Vet. Parasitol. 23 (2014) 428–434. doi:http://dx.doi.org/10.1590/S1984-29612014079. J.E. Sykes, J.C. Terry, L.L. Lindsay, S.D. Owens, Prevalences of various hemoplasma species among cats in the United States with possible hemoplasmosis., J. Am. Vet. Med. Assoc. 232 (2008) 372–379. doi:10.2460/javma.232.3.372. K.S. Jenkins, K.E. Dittmer, J.C. Marshall, S. Tasker, Prevalence and risk factor analysis of feline haemoplasma infection in New Zealand domestic cats using a realtime PCR assay., J. Feline Med. Surg. 15 (2013) 1063–9. 23

doi:10.1177/1098612X13488384. [76] S. Tasker, S.M.A. Caney, M.J. Day, R.S. Dean, C.R. Helps, T.G. Knowles, P.J.P. Lait, M.D.G. Pinches, T.J. Gruffydd-Jones, Effect of chronic FIV infection, and efficacy of marbofloxacin treatment, on Mycoplasma haemofelis infection, Vet. Microbiol. 117 (2006) 169–179. doi:10.1016/j.vetmic.2006.06.015. [77] S. Tasker, S.M.A. Caney, M.J. Day, R.S. Dean, C.R. Helps, T.G. Knowles, P.J.P. Lait, M.D.G. Pinches, T.J. Gruffydd-Jones, Effect of chronic feline immunodeficiency infection, and efficacy of marbofloxacin treatment, on “Candidatus Mycoplasma haemominutum” infection, Microbes Infect. 8 (2006) 653–661. doi:10.1016/j.micinf.2005.08.015. [78] K. Museux, F.S. Boretti, B. Willi, B. Riond, K. Hoelzle, L.E. Hoelzle, M.M. Wittenbrink, S. Tasker, N. Wengi, C.E. Reusch, H. Lutz, R. Hofmann-Lehmann, In vivo transmission studies of “Candidatus Mycoplasma turicensis” in the domestic cat, Vet. Res. 40 (2009). doi:10.1051/vetres/2009028. [79] E.N. Barker, C.R. Helps, K.J. Heesom, C.J. Arthur, I.R. Peters, R. HofmannLehmann, S. Tasker, Detection of Humoral Response Using a Recombinant Heat Shock Protein 70, DnaK, of Mycoplasma haemofelis in Experimentally and Naturally Hemoplasma-Infected Cats, Clin. Vaccine Immunol. 17 (2010) 1926– 1932. doi:10.1128/CVI.00320-10. [80] M. Novacco, G. Wolf-Jäckel, B. Riond, R. Hofmann-Lehmann, Humoral immune response to a recombinant hemoplasma antigen in experimental “Candidatus Mycoplasma turicensis” infection, Vet. Microbiol. 157 (2012) 464–470. doi:10.1016/j.vetmic.2011.12.036. [81] S. Gretillat, Haemobartonella canis ( Kikuth , 1928 ) in the blood of dogs with parvovirus disease, (1981). [82] I.G. Wright, The isolation of Haemobartonella canis in association with Babesia canis in a splenectomised dog., Aust. Vet. J. 47 (1971) 157–159.

 

24

Figure 1. Map of the Los Rios Region, Chile, and Valdivia province with Valdivia city and the localities of Huape (A), Chaihuín (B), Huiro (C) and Cadillal Alto (D); where the study was conducted.

 

 

25

Table 1 Summary information of the conventional PCR primer sets and their product sizes used in the study. Primer

Target

Sequence (5´-3´)

RPS19-F

Canine ribosomal protein S19

CCTTCCTCAAAAA/GTCTGGG

RPS19-R HemMycop16S-322s

Mycoplasma spp.

HemMycop16S-1420as HemMycop16S-41s

Product Size (bp) 100

GTTCTCATCGTAGGGAGCAAG GCCCATATTCCTACGGGAAGCAGCAGT

1000

GTTTGACGGGCGGTGTGTACAAGACC Mycoplasma spp.

HemMycop16S-938as

GYATGCMTAAYACATGCAAGTCGARCG

900

CTCCACCACTTGTTCAGGTCCCCGTC

 

Table 2 Summary information of the qPCR primer sets and melting temperatures used in the study. Primer

Target

Secuence (5´-3´)

Tm(°C)

MY16SF

Mycoplasma spp.

AGCAATRCCATGTGAACGATGAA

73.1-75.3

MY16SR1

TGGCACATAGTTTGCTGTCACTT

MY16SR2

GCTGGCACATAGTTAGCTGTCACT

 

 

26

Table 3 PCR results for Hemotropic mycoplasmas in domestic dogs from urban (n=139) and rural (n=139) localities of the Valdivia province, southern Chile.

PCR Results Mycoplasma spp. Mycoplasma haemocanis ´Candidatus Mycoplasma haematoparvum`

Location Urban Rural 11/139 (7.9%) 58/139 (41.7%) 6/139 (4.3%) 27/139 (19.4%) 5/139 (3.6%) 29/139 (20.9%)

Total 69/278 (24.8%) 33/278 (11.9%) 34/278 (12.2%)

 

 

27

Table 4 qPCR positive samples (n=69) with their respective Tm and Cq values; and the infecting species. Sample ID 99 389 663 943 1118 1271 1312 1323 1434 1470 1924 A1 A2 A3 A4 A7 A9 A25 A26 A31 A34 A36 B1 B2 B14 C6 C7 C11 D2 D3 E7 E14 E15 E17 E20

Mean Tm 74.29 74.49 74.14 74.04 73.10 74.19 73.14 74.58 73.54 73.54 73.17 74.29 73.62 73.84 75.59 74.97 74.29 74.81 73.99 74.29 74.44 73.40 74.66 73.92 74.14 73.39 74.29 73.24 73.69 74.71 74.29 74.43 74.28 73.99 73.46

Species Mhc Mhc Mhc Mhc CMhp Mhc CMhp Mhc CMhp CMhp CMhp Mhc CMhp CMhp NI Mhc Mhc Mhc CMhp Mhc Mhc CMhp Mhc CMhp Mhc CMhp Mhc CMhp CMhp Mhc Mhc Mhc Mhc CMhp CMhp

Mean Cq 29.64 24.46 26.86 23.62 23.53 21.36 24.78 25.14 23.71 21.99 29.71 26.58 23.44 27.67 26.99 23.82 26.30 22.93 25.92 29.14 22.56 26.81 23.62 26.24 30.52 28.71 27.51 25.95 23.93 23.02 26.38 22.82 23.90 23.07 25.07

Sample ID E21 E23 E24 F3 F4 F7 F9 F11 F12 F14 F15 F17 F18 F19 F20 F21 F22 F24 G6 G10 G20 G21 1519 1520 1521 1522 1523 1525 1530 1533 1534 1539 1540 1542

Mean Tm 74.43 73.62 74.44 74.43 73.76 73.46 73.99 73.76 74.06 73.89 73.54 73.91 73.69 74.43 73.84 75.85 73.39 74.44 73.62 74.21 74.29 73.24 74.36 74.07 74.28 74.30 73.71 73.31 73.39 73.54 74.21 73.91 74.36 73.91

Species Mhc CMhp Mhc Mhc CMhp CMhp CMhp CMhp Mhc CMhp CMhp CMhp CMhp Mhc CMhp NI CMhp Mhc CMhp Mhc Mhc CMhp Mhc Mhc Mhc Mhc CMhp CMhp CMhp CMhp Mhc CMhp Mhc CMhp

Mean Cq 25.29 25.91 25.77 19.72 23.92 26.08 24.62 23.41 21.95 22.50 23.69 25.09 23.66 20.97 23.81 27.41 28.64 25.77 25.78 24.94 26.19 24.81 27.59 22.90 26.79 24.82 25.91 25.89 25.02 22.56 25.20 22.98 23.00 22.89

ID =Identification; Tm= Melting Temperature; Cq= Quantification cycle; NI = species not identified; Mhc: Mycoplasma haemocanis; CMhp: ´Candidatus Mycoplasma haematoparvum´

   

28

Table 5 Univariable logistic regression model of risk factors associated to hemoplasma infection in domestic dogs (n=278) from the Valdivia province, southern Chile.

Total

Hemoplasma PCR Positive Negative

Variable Location Urban Rural

278 139 139

OR

95% CI

p Value

11 58

128 81

1.00 8.08

3.99-16.35

<<0.001*

Age ≤2 years >2 years

271 119 152

9 60

110 92

1.00 5.24

2.46- 11.14

<<0.001*

Gender Female Male

275 114 161

10 59

104 102

1.00 6.56

3.09-13.95

<<0.001*

Origin House Street/unknown

271 28 243

7 62

21 181

1.00 1.27

0.53-3.03

0.592

Veterinary care Yes No *Statistically significant

275 146 129

27 42

119 87

1.00 2.55

1.44-4.52

0.002*

 

Table 6 Multivariable logistic regression model for risk factors associated with hemoplasma infection in domestic dogs (n=278) from the Valdivia province, southern Chile.

Risk Factor Location Urban Rural

OR

95% CI

p value

1.00 5.73

2.65-13.29

<<0,001*

Age ≤2 years >2 years

1.00 5.58

2.69-13.21

<<0,001*

Gender Female 1.00 Male 2.64 1.13-6.56 *Statistically significant. AUC= 0.82; Hosmer-Lemeshow x2= 0.91 (p=0.822). 

 

0.028*

29

Table 7 Hematological values in domestic dogs from southern Chile grouped according to hemoplasma status.   Parameter

PCR - negative Median Min Max

Median

PCR – positive Min Max

Reference Intervala

p value*

RBC PCV

6.73 46

2.68 21

9.65 63

7.03 46

4.43 34

9.69 58

5.5-8.5x106µL 37-50%

0.107 0.083

HB

154

56

226

158

103

205

120-180g/L

0.055

MCV

67

47

94

67

56

88

60-77fL

0.827

MCHC

337

186

491

338

292

403

320-370g/L

0.276

WBC Segmented Neutrophils

15236

5700

68000

14796

4600

26700

8000-14000cells/µL

0.872

8308

3450

108364

8360

1978

24831

3300-10000cells/µL

0.071

Band Neutrophils Lymphocytes

0 2970

0 294

8 17680

0 2948

0 188

4 7548

0-300 cells/µL 1000-4500cells/µL

0.949 0.542

Monocytes

699

0

10880

546

0

2240

100-700cells/µL

0.731

Eosinophils

1236

0

10881

1470

0

8892

0

0

0

0

0

0

291082

54

1940000

276298

15000

650000

66

40

90

69

54

88

Basophils PLTb TP

100-1500cells/µL

0.222

0-200cells/µL 200000500000cells/µL

NA

55-75g/L

0.009*

0.640

RBC = red blood cell, PCV = Packed red blood cell, HB = hemoglobin, MCV = mean corpuscular volume, MCHC = mean corpuscular hemoglobin volume, WBC= white blood cell, PLT= platelet count, TP=Plasmatic Total Protein. * Statistically Significant P-value <0.05. aFrom Veterinary Clinical Pathology Laboratory UACh bOnly used 242 date of platelet count. 6 samples were coagulated.

 

 

30