- Email: [email protected]
Ocimum sanctum essential oil inhibits virulence attributes in Candida albicans
Phytomedicine 21 (2014) 448–452
Contents lists available at ScienceDirect
Phytomedicine journal homepage: www.elsevier.de/phymed
Short communication
Ocimum sanctum essential oil inhibits virulence attributes in Candida albicans Amber Khan a , Aijaz Ahmad c,1 , Immaculata Xess b , Luqman A. Khan a , Nikhat Manzoor a,∗ a b c
Medical Mycology Lab, Department of Biosciences, Jamia Millia Islamia, New Delhi, India Department of Microbiology, All India Institute of Medical Sciences, New Delhi, India Department of Pharmaceutical Sciences, Tshwane University of Technology, Arcadia Campus, Pretoria 0001, South Africa
a r t i c l e
i n f o
Article history: Received 27 May 2013 Received in revised form 18 September 2013 Accepted 17 October 2013 Keywords: Ocimum sanctum Essential oil Candida albicans Virulence Morphological transition Proteinase Phospholipase
a b s t r a c t Candida albicans is an opportunistic human fungal pathogen which causes disease mainly in immunocompromised patients. Activity of hydrolytic enzymes is essential for virulence of C. albicans and so is the capacity of these cells to undergo transition from yeast to mycelial form of growth. Ocimum sanctum is cultivated worldwide for its essential oil which exhibits medicinal properties. This work evaluates the anti-virulence activity of O. sanctum essential oil (OSEO) on 22 strains of C. albicans (including a standard strain ATCC 90028) isolated from both HIV positive and HIV negative patients. Candida isolates were exposed to sub-MICs of OSEO. In vitro secretion of proteinases and phospholipases was evaluated by plate assay containing BSA and egg yolk respectively. Morphological transition from yeast to filamentous form was monitored microscopically in LSM. For genetic analysis, respective genes associated with morphological transition (HWP1), proteinase (SAP1) and phospholipase (PLB2) were also investigated by Real Time PCR (qRT-PCR). Results were analyzed using Student’s t-test. OSEO inhibits morphological transition in C. albicans and had a significant inhibitory effect on extracellular secretion of proteinases and phospholipases. Expression profile of respective selected genes associated with C. albicans virulence by qRT-PCR showed a reduced expression of HWP1, SAP1 and PLB2 genes in cells treated with sub-inhibitory concentrations of OSEO. This work suggests that OSEO inhibits morphological transition in C. albicans and decreases the secretion of hydrolytic enzymes involved in the early stage of infection as well as down regulates the associated genes. Further studies will assess the clinical application of OSEO and its constituents in the treatment of fungal infections. © 2013 Elsevier GmbH. All rights reserved.
Introduction Candida albicans is an opportunistic fungal pathogen whose ability to become virulent is primarily determined by the immune status of the host. Major determinants of virulence are dimorphic switching (Yang, 2003), secretion of hydrolytic enzymes such as proteinases and phospholipases. These enzymes are responsible for adhesion, tissue damage and invasion of host tissues. Therefore, screening for compounds that inhibit hyphal growth and secretion of hydrolytic enzymes will lead to the development of new antifungal therapies. Plant-derived substances have recently gained tremendous attention due to their versatile applications. However, scientific information still falls short of their influences on microbial
∗ Corresponding author at: Department of Biosciences, Jamia Millia Islamia, New Delhi 110025, India. Tel.: +91 11 2698 1717x3410; fax: +91 11 2698 0229. E-mail address: [email protected] (N. Manzoor). 1 Present address. 0944-7113/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.phymed.2013.10.028
physiology and pathogenicity. Ocimum sanctum is widely used in the management of various diseases and its antifungal effects have been reported (Devkatte et al., 2005; Kumar et al., 2010). We have reported the chemical composition and antifungal efficacy of Ocimum sanctum essential oil (OSEO) against various Candida isolates (Khan et al., 2010a,b). In the present work we have investigated the effect of sub-inhibitory concentrations of previously used OSEO (methyl chavicol as lead component, Khan et al., 2010b,c) on virulence attributes of C. albicans. We studied the effect of OSEO on morphological transition and hydrolytic enzyme secretion in C. albicans isolated from various infection sites from both HIV positive and HIV negative patients. Materials and methods Essential oil used in the present study was obtained from leaves of Ocimum sanctum by hydrodistillation and characterized using detailed GC–MS analysis as reported earlier (Khan et al., 2010b). All inorganic chemicals were of analytical grade and procured from E. Merck (India).
A. Khan et al. / Phytomedicine 21 (2014) 448–452
449
Table 1 Primers and annealing temperatures used for RT-PCR for genes associated with pathogenicity of C. albicans. Gene
Primer sequence (5 →3 ) Forward primer
Reverse primer
ACT1 HWP1 SAP1 PLB2
TTTAAGAATTGATTTGGCT ATGACTCCAGCTGGTTC TCAATCAATTTACTCTTCCATTTTAACA GTGGGATCTTGCAGAGTTCAAGC
GAAGATTGAGAAGAAGTTT TAGATCAAGAATGCAGC CCA GTA GCA TTA ACA GGA GTT TTA ACA CTCAAAGCTCTCCCATAGACATCTG
Strains and culture conditions Selection of strains: 35 clinical strains of C. albicans used in our previous study (Khan et al., 2010b) were investigated for hydrolytic enzyme secretions and hyphal formation. Strains showing ability to induce germ tubes in Lee’s simplified media (LSM) at pH 6.5 and possessing very strong proteinase and phospholipase activity with Pz value < 0.6 were selected for the present study. Twenty two strains were thus investigated for the effect of sub-inhibitory concentrations (1/2 MIC, 1/4 MIC and 1/8 MIC) of OSEO on them. Yeast to hyphal transition To initiate hyphal development, Candida cells were grown in LSM. For zinc depletion and synchronous population growth, cells were grown in fresh plastic Erlenmeyer flasks and maintained for 48 h at 25 ◦ C. To induce hyphae formation, stationary phase G1 -singlets were transferred to fresh Lee’s media at 37 ◦ C at pH 6.5. Desired concentrations of OSEO (0.1 l/ml, 0.05 l/ml and 0.025 l/ml) were added to LSM. Every half hour, pH of medium was adjusted to 6.5 and cells were observed microscopically using Motic AE31 (Germany) by taking aliquots after every 30 min (Yousuf et al., 2011). Proteinase assay Proteinase activity was assayed as described previously (Yousuf et al., 2011). Briefly, Candida strains were exposed to different concentrations of OSEO (0.1 l/ml, 0.05 l/ml and 0.025 l/ml) for 5 min. Cells without any treatment serve as control. 2 l aliquots were placed on top of proteinase agar plate (0.1% yeast nitrogen base w/o amino acids; 0.145% ammonium sulfate; 2% glucose with 0.2% (w/v) BSA fraction V mixed into agar at ∼40 ◦ C). After incubation at 37 ◦ C for 3–4 days, plates were examined for proteinase secretion by measuring clear zones around the colonies. A Pz value of 1.0 depicts no enzyme activity. Pz =
diameter of the colony + zone of clearance diameter of the colony
Phospholipase assay Candida strains were assayed for extracellular phospholipase activity as described previously (Yousuf et al., 2011). Briefly, Candida cells were exposed to different concentrations of OSEO for 5 min. 2 l aliquots were overlaid, on phospholipase agar plates (1% peptone; 3% glucose; 5.73% NaCl; 0.055% CaCl2 with 10% (v/v) egg yolk emulsion [HiMedia]). After incubation for 2–4 days at 37 ◦ C, phospholipase secretion was determined by measuring precipitation zones around colonies. Zone of precipitation (Pz) was measured as described above. RNA extraction and qRT-PCR RNA extraction and gene expressions of HWP1, SAP1 and PLB2 genes in C. albicans (cells were exposed to 0.05 l/ml of OSEO or 1%
Annealing temp (◦ C)
48 59 60 54
DMSO (solvent control)) were performed as described previously (Ahmad et al., 2013). ACT1, a housekeeping gene, was used as an endogenous control. Primer sequences and annealing temperatures used for qRT-PCR are shown in Table 1. All qRT-PCR experiments were done in duplicate for all treated cell samples from two independent biological experiments.
Statistical analysis Student’s t-test was used to compare effect of OSEO with control in all the experiments. All experiments were performed in triplicate and results were determined as mean ± standard deviation.
Results OSEO used in the present study is high in methyl chavicol concentration followed by linalool (GC–MS characterized oil composition, Khan et al., 2010b). Indian O. sanctum has been distinguished into three chemotypes i.e., eugenol, methyl eugenol and caryophyllene (Verma et al., 2013) as variations in compositions due to geographical, seasonal and soil characteristics are very common (Bowes and Zheljazkov, 2004; Kumar et al., 2010, 2013). Even the method of harvesting and age of leaves at harvesting time (Kothari et al., 2004; Lewinsohn et al., 2000) plays a crucial role in EO composition. OSEO rich in methyl chavicol showed synergy with azoles (Khan et al., 2010c).
Yeast to hyphal transition Yeast to hyphal transition in C. albicans is strongly dependent on pH besides other factors. In control cells (untreated) at pH 6.5, germ tubes were visible only after 30 min. More than 90% cells were seen undergoing yeast to hyphal transition after 210 min (Fig. 1A). Sub-MICs of OSEO at sub-inhibitory concentrations showed potent inhibitory activity against yeast to hyphal transition. At ½ MIC (0.1 l/l) germ tubes were seen after 150 min of incubation when only <1% cells showed transition and hyphal length was 0.51 in comparison to control (7.26 on a scale of 10). After 210 min, when around 99% control cells showed transition with a hyphal length of 9.84, cells incubated with ½ MIC of OSEO showed only 6–8% transition with hyphal length of only 3.5 on a scale of 10. Only around 8% cells were seen forming germ tubes even after 210 min (Fig. 1D). Further, at lower concentrations equal to 1/4 MIC (0.05 l/ml) and 1/8 MIC (0.025 l/ml), only 12–15% and 25–35% cells, respectively showed morphological transition. OSEO thus inhibits yeast to hyphal transition in C. albicans at pH 6.5, thus interfering at the initial stages of infection. Table 2 shows percentage of cells showing hyphae and length of hyphae in m. Hyphal length was even more profoundly affected. While cells continued to grow with time, their length at each point of time was significantly less in comparison to control. At incubation of 210 min, reduced hyphal length to ∼48%, 38% and 35% in presence of OSEO at 1/8, ¼ and ½ MIC.
450
A. Khan et al. / Phytomedicine 21 (2014) 448–452
Fig. 1. Yeast to hyphal transition in Candida albicans ATCC 90028. Cells were grown for 90 min, 150 min and 210 min in [A] untreated control cells [B] 0.025 l/ml [C] 0.05 l/ml [D] 0.1 l/ml of OSEO.
Proteinase and phospholipase assay Cells were tested extensively for proteinase activity in the presence and absence of sub-inhibitory concentrations of OSEO. Fig. 2A summarizes proteinase activity for all the strains tested. It was observed that at ½ MIC, 69% of proteinase activity was inhibited while the respective figure for ¼ MIC was 48%. However, 1/8 MIC of OSEO did not show any significant proteinase inhibition (figure not shown). Fig. 2B summarizes phospholipase enzyme activity for all C. albicans strains tested. 49% and 38% phospholipase secretion was inhibited at ½ MIC and ¼ MIC of OSEO. Even at lower oil
concentrations, a significant inhibition was observed. Experiments performed at 1/8 MIC of OSEO showed results similar to control. Gene expression assay Expression levels of HWP1, SAP1 and PLB2 genes, which are crucial for pathogenesis and expressed exclusively during infection of C. albicans, are shown in Fig. 3. All the three genes were observed to be down regulated when cells were treated with sub-inhibitory concentrations of OSEO. Down regulation of HWP1 and SAP1 genes directly correlates with results observed in separate experiments of morphological transition and proteinase production, respectively.
A. Khan et al. / Phytomedicine 21 (2014) 448–452
451
Table 2 Yeast to hyphal transition in Candida albicans in the presence of OSEO. Time (min)
0 30 60 90 120 150 180 210
Control
1/8 MIC OSEO
¼ MIC OSEO
½ MIC OSEO
I
II
I
II
I
II
I
II
– 5–7% 35–40% 53–58% 60–65% 70–75% 80–85% 95–99%
– 3.34 4.03 4.53 5.66 7.26 7.85 9.84
– 5–7% 5–8% 10% 13–15% 17–19% 21% 25–35%
– 2.76 2.95 3.39 3.66 3.98 4.41 4.7
– – – – ≤1% 2% 7% 12–15%
– – – – 0.91 1.26 1.97 3.71
– – – – – ≤1% 2–3% 6–8%
– – – – 0.51 1.66 3.54
0.8
*
A
0.7 0.6
*
0.5 0.4 0.3 0.2 0.1 0 a
b
c
Pz Value (Zone of precipitation)
Pz Value (Zone of degradation)
MIC of OSEO was taken as 0.2 l/ml. I, percentage of cells showing hyphal growth. II, length of hyphae on a scale of 10 (140 m).
0.9 0.8
*
B *
0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 a
d
b
c
d
Fig. 2. Effect on proteinase (A) and phospholipase (B) secretion by various strains of Candida albicans when exposed to 0 l/ml (a), 0.025 l/ml (b), 0.05 l/ml and (c) 0.1 l/ml of OSEO.
However, expression levels of PLB2 gene were rather erratic, as this gene was not considerably down regulated. Expression of genes is shown as relative values in comparison to untreated cells that were set to one. Down regulation of HWP1 gene with respect to control cells was observed to be 65% whereas the ratio further increases to 85% for SAP1 gene. In contrast, down regulation of PLB2 gene was
Fig. 3. Relative expression of HWP1, SAP1 and PLB2 of Candida albicans ATCC 90028 treated with OSEO (dotted bars) at 0.05 l/ml values. White bars represent the test compound free cells (negative control). Control had an average relative expression of 3 independent recordings.
not much significant and is only around 15% with respect to control. Expression level of ACT1 gene, which is a housekeeping gene, was determined in each set of experiment (data not shown).
Discussion Virulence attributes of Candida species include adherence to host tissues, morphological changes, and secretion of hydrolases, e.g., phospholipases and proteinases (Yang, 2003). Transition from yeast to hyphae is one of the initial stages of infection process of C. albicans. Our work demonstrates that OSEO significantly inhibits the transition of cells from yeasts to hyphae (Fig. 1), thus preventing the initial stage of infection process. Inhibitory effects of sub-inhibitory concentrations of OSEO on Candida cells, suggest that crucial cascades of events leading to morphological transitions may have stopped in presence of this EO. Besides germ tube induction, hyphal length was also inhibited in the presence of OSEO. Hyphal elongation is necessary for deep invasion of host tissues as infection progresses. In control cells, germ tube induction and typical chlamydospore aggregation around hyphae increased as a function of incubation time. Host target cell membrane is made up of proteins and lipids. C. albicans is capable of secreting proteinases (Naglik et al., 2003) and phospholipases (Ibrahim et al., 1995) that hydrolyse peptide bonds and phospholipids, respectively and cause tissue invasion and damage which is the next level in pathogenesis. OSEO has significant inhibitory effect on proteinases (Fig. 2A) and phospholipases (Fig. 2B) suggesting that it can prevent hydrolysis of host tissues when colonized with C. albicans. Thus, it not only prevents transition of yeast to more pathogenic hyphal form but also checks invasion of host tissues by the fungi. As phospholipases and aspartyl proteinases are important virulence factors (Yang, 2003),
452
A. Khan et al. / Phytomedicine 21 (2014) 448–452
their absence or lowered secretion may indicate reduced Candida virulence in presence of OSEO. The present study was also done to investigate expression levels of genes encoding hyphal wall protein (HWP1) which is exclusively expressed in hyphae (Staab et al., 1999); SAP1 (secreted aspartyl proteinase) known to cause tissue damage (Naglik et al., 2003), and PLB2 (lysophospholipase), expression of which is detected in vivo during mouse infections and human oral infections Down regulation of these genes was significantly observed in cells treated with sub-inhibitory concentrations of OSEO. Using qRT-PCR, we detected high Ct values (i.e. low absolute mRNA levels) for all the three genes studied. Low expression of HWP1 gene correlates directly with reduction of yeast to hyphal transition in C. albicans. Similar results were observed with SAP1 gene. However, some discrepancies were observed in PLB2 expression analysis which showed slight variations of Ct values in treated and untreated cells. Besides, HWP1, SAP1and PLB2, the possibility of involvement of other genes (Nailis et al., 2010) in the expression of virulence attributes of C. albicans cannot be denied. Further studies on other gene targets are required to boost present findings and present a clearer picture. Hence, OSEO not only reduces morphological transition in C. albicans from yeast to more pathogenic hyphal form at subinhibitory concentrations, but also has a significant inhibitory effect on the secretion of hydrolytic enzymes during infection. All these effects originate at genetic levels as confirmed by qRT-PCR based analysis of genes expression. Acknowledgements This work was partially supported by Indian Council of Medical Research, India (59/24/2008/BMS/TRM [2008-04780]). Authors wish to thank Dr Malini R. Capoor, Safdarjung Hospital, New Delhi, India for providing clinical isolates of Candida. References Ahmad, A., Khan, A., Manzoor, N., 2013. Reversal of efflux mediated antifungal resistance underlies synergistic activity of two monoterpenes with fluconazole. Eur. J. Pharm. Sci. 48, 80–86.
Bowes, K.M., Zheljazkov, V.D., 2004. Factors affecting yields and essential oil quality of Ocimum sanctum L. and Ocimum basilicum L. cultivars. J. Am. Soc. Hort. Sci. 129, 789–794. Devkatte, A.N., Zore, G.B., Karuppayil, S.M., 2005. Potential of plant oils as inhibitors of Candida albicans growth. FEMS Yeast Res. 5, 867–873. Ibrahim, A.S., Mirbod, F., Filler, S.G., Banno, Y., Cole, G.T., Kitajima, Y., Edward Jr., J.E., Nozawa, Y., Ghannoum, M.A., 1995. Evidence implicating phospholipase as a virulence factor of Candida albicans. Infect. Immun. 63, 1993–1998. Khan, A., Ahmad, A., Akhtar, F., Yousuf, S., Immaculata, X., Khan, L.A., Manzoor, N., 2010b. Ocimum sanctum essential oil and its active principles exert their antifungal activity by disrupting ergosterol biosynthesis and membrane integrity. Res. Microbiol. 161, 816–823. Khan, A., Ahmad, A., Immaculata, X., Khan, L.A., Manzoor, N., 2010c. Anticandidal effect of Ocimum sanctum essential oil and its synergy with fluconazole and ketoconazole. Phytomedicine 17, 921–925. Khan, A., Ahmad, A., Manzoor, N., Khan, L.A., 2010a. Antifungal activities of Ocimum sanctum essential oil and its lead molecules. Nat. Prod. Commun. 5 (2), 345–349. Kothari, S.K., Bhattacharya, A.K., Ramesh, S., 2004. Essential oil yield and quality of methyl eugenol rich Ocimum tenuiflorum L.f (syn. O. sanctum L.) grown in south India as influenced by method of harvest. J. Chromatogr. A. 1054 (1/2), 67–72. Kumar, A., Dubey, N.K., Srivastava, S., 2013. Antifungal evaluation of Ocimum sanctum essential oil against fungal deterioration of raw materials of Rauvolfia serpentina during storage. Ind. Crops Prod. 45, 30–35. Kumar, A., Shukla, R., Singh, P., Dubey, N.K., 2010. Chemical composition, antifungal and antiaflatoxigenic activities of Ocimum sanctum L. essential oil and its safety assessment as plant based antimicrobial. Food Chem. Toxicol. 48, 539–543. Lewinsohn, E., Ziv-Raz, I.I., Dudai, N., Tadmor, Y., Lastochkin, E., Larkov, O., Chaimovitsh, D., Ravid, U., Putievsky, E., Pichersky, E., Shoham, Y., 2000. Biosynthesis of estragole and methyl-eugenol in sweet basil (Ocimum basilicum L). Developmental and chemotypic association of allylphenol O-methyltransferase activities. Plant Sci. 160, 27–35. Naglik, J.R., Rodgers, C.A., Shirlaw, P.J., Dobbie, J.L., Fernandes-Naglik, L.L., Greenspan, D., Agabian, N., Challacombe, S.J., 2003. Differential expression of Candida albicans secreted aspartyl proteinase and phospholipase B genes in humans correlates with active oral and vaginal infections. J. Infect. Dis. 188 (3), 469–479. ˇ cicová, M., Van Dijck, P., Dieter Deforce, D., Nelis, H., Nailis, H., Kucharíková, S., Riˇ Coenye, T., 2010. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression. BMC Microbiol. 10, 114. Staab, J.F., Bradway, S.D., Fidel, P.L., Sundstrom, P., 1999. Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1. Science 283 (5407), 1535–1538. Verma, R.S., Padaliaa, R.C., Chauhana, A., Thulb, S.T., 2013. Exploring compositional diversity in the essential oils of 34 Ocimum taxa from Indian flora. Ind. Crops Prod. 45, 7–19. Yang, Y.L., 2003. Virulence factors of Candida species. J. Microbiol. Immunol. Infect. 36, 223–228. Yousuf, S., Ahmad, A., Khan, A., Manzoor, N., Khan, L.A., 2011. Effect of garlic-derived allyl sulphides on morphogenesis and hydrolytic enzyme secretion in Candida albicans. Med. Mycol. 49 (4), 444–448.
Contents lists available at ScienceDirect
Phytomedicine journal homepage: www.elsevier.de/phymed
Short communication
Ocimum sanctum essential oil inhibits virulence attributes in Candida albicans Amber Khan a , Aijaz Ahmad c,1 , Immaculata Xess b , Luqman A. Khan a , Nikhat Manzoor a,∗ a b c
Medical Mycology Lab, Department of Biosciences, Jamia Millia Islamia, New Delhi, India Department of Microbiology, All India Institute of Medical Sciences, New Delhi, India Department of Pharmaceutical Sciences, Tshwane University of Technology, Arcadia Campus, Pretoria 0001, South Africa
a r t i c l e
i n f o
Article history: Received 27 May 2013 Received in revised form 18 September 2013 Accepted 17 October 2013 Keywords: Ocimum sanctum Essential oil Candida albicans Virulence Morphological transition Proteinase Phospholipase
a b s t r a c t Candida albicans is an opportunistic human fungal pathogen which causes disease mainly in immunocompromised patients. Activity of hydrolytic enzymes is essential for virulence of C. albicans and so is the capacity of these cells to undergo transition from yeast to mycelial form of growth. Ocimum sanctum is cultivated worldwide for its essential oil which exhibits medicinal properties. This work evaluates the anti-virulence activity of O. sanctum essential oil (OSEO) on 22 strains of C. albicans (including a standard strain ATCC 90028) isolated from both HIV positive and HIV negative patients. Candida isolates were exposed to sub-MICs of OSEO. In vitro secretion of proteinases and phospholipases was evaluated by plate assay containing BSA and egg yolk respectively. Morphological transition from yeast to filamentous form was monitored microscopically in LSM. For genetic analysis, respective genes associated with morphological transition (HWP1), proteinase (SAP1) and phospholipase (PLB2) were also investigated by Real Time PCR (qRT-PCR). Results were analyzed using Student’s t-test. OSEO inhibits morphological transition in C. albicans and had a significant inhibitory effect on extracellular secretion of proteinases and phospholipases. Expression profile of respective selected genes associated with C. albicans virulence by qRT-PCR showed a reduced expression of HWP1, SAP1 and PLB2 genes in cells treated with sub-inhibitory concentrations of OSEO. This work suggests that OSEO inhibits morphological transition in C. albicans and decreases the secretion of hydrolytic enzymes involved in the early stage of infection as well as down regulates the associated genes. Further studies will assess the clinical application of OSEO and its constituents in the treatment of fungal infections. © 2013 Elsevier GmbH. All rights reserved.
Introduction Candida albicans is an opportunistic fungal pathogen whose ability to become virulent is primarily determined by the immune status of the host. Major determinants of virulence are dimorphic switching (Yang, 2003), secretion of hydrolytic enzymes such as proteinases and phospholipases. These enzymes are responsible for adhesion, tissue damage and invasion of host tissues. Therefore, screening for compounds that inhibit hyphal growth and secretion of hydrolytic enzymes will lead to the development of new antifungal therapies. Plant-derived substances have recently gained tremendous attention due to their versatile applications. However, scientific information still falls short of their influences on microbial
∗ Corresponding author at: Department of Biosciences, Jamia Millia Islamia, New Delhi 110025, India. Tel.: +91 11 2698 1717x3410; fax: +91 11 2698 0229. E-mail address: [email protected] (N. Manzoor). 1 Present address. 0944-7113/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.phymed.2013.10.028
physiology and pathogenicity. Ocimum sanctum is widely used in the management of various diseases and its antifungal effects have been reported (Devkatte et al., 2005; Kumar et al., 2010). We have reported the chemical composition and antifungal efficacy of Ocimum sanctum essential oil (OSEO) against various Candida isolates (Khan et al., 2010a,b). In the present work we have investigated the effect of sub-inhibitory concentrations of previously used OSEO (methyl chavicol as lead component, Khan et al., 2010b,c) on virulence attributes of C. albicans. We studied the effect of OSEO on morphological transition and hydrolytic enzyme secretion in C. albicans isolated from various infection sites from both HIV positive and HIV negative patients. Materials and methods Essential oil used in the present study was obtained from leaves of Ocimum sanctum by hydrodistillation and characterized using detailed GC–MS analysis as reported earlier (Khan et al., 2010b). All inorganic chemicals were of analytical grade and procured from E. Merck (India).
A. Khan et al. / Phytomedicine 21 (2014) 448–452
449
Table 1 Primers and annealing temperatures used for RT-PCR for genes associated with pathogenicity of C. albicans. Gene
Primer sequence (5 →3 ) Forward primer
Reverse primer
ACT1 HWP1 SAP1 PLB2
TTTAAGAATTGATTTGGCT ATGACTCCAGCTGGTTC TCAATCAATTTACTCTTCCATTTTAACA GTGGGATCTTGCAGAGTTCAAGC
GAAGATTGAGAAGAAGTTT TAGATCAAGAATGCAGC CCA GTA GCA TTA ACA GGA GTT TTA ACA CTCAAAGCTCTCCCATAGACATCTG
Strains and culture conditions Selection of strains: 35 clinical strains of C. albicans used in our previous study (Khan et al., 2010b) were investigated for hydrolytic enzyme secretions and hyphal formation. Strains showing ability to induce germ tubes in Lee’s simplified media (LSM) at pH 6.5 and possessing very strong proteinase and phospholipase activity with Pz value < 0.6 were selected for the present study. Twenty two strains were thus investigated for the effect of sub-inhibitory concentrations (1/2 MIC, 1/4 MIC and 1/8 MIC) of OSEO on them. Yeast to hyphal transition To initiate hyphal development, Candida cells were grown in LSM. For zinc depletion and synchronous population growth, cells were grown in fresh plastic Erlenmeyer flasks and maintained for 48 h at 25 ◦ C. To induce hyphae formation, stationary phase G1 -singlets were transferred to fresh Lee’s media at 37 ◦ C at pH 6.5. Desired concentrations of OSEO (0.1 l/ml, 0.05 l/ml and 0.025 l/ml) were added to LSM. Every half hour, pH of medium was adjusted to 6.5 and cells were observed microscopically using Motic AE31 (Germany) by taking aliquots after every 30 min (Yousuf et al., 2011). Proteinase assay Proteinase activity was assayed as described previously (Yousuf et al., 2011). Briefly, Candida strains were exposed to different concentrations of OSEO (0.1 l/ml, 0.05 l/ml and 0.025 l/ml) for 5 min. Cells without any treatment serve as control. 2 l aliquots were placed on top of proteinase agar plate (0.1% yeast nitrogen base w/o amino acids; 0.145% ammonium sulfate; 2% glucose with 0.2% (w/v) BSA fraction V mixed into agar at ∼40 ◦ C). After incubation at 37 ◦ C for 3–4 days, plates were examined for proteinase secretion by measuring clear zones around the colonies. A Pz value of 1.0 depicts no enzyme activity. Pz =
diameter of the colony + zone of clearance diameter of the colony
Phospholipase assay Candida strains were assayed for extracellular phospholipase activity as described previously (Yousuf et al., 2011). Briefly, Candida cells were exposed to different concentrations of OSEO for 5 min. 2 l aliquots were overlaid, on phospholipase agar plates (1% peptone; 3% glucose; 5.73% NaCl; 0.055% CaCl2 with 10% (v/v) egg yolk emulsion [HiMedia]). After incubation for 2–4 days at 37 ◦ C, phospholipase secretion was determined by measuring precipitation zones around colonies. Zone of precipitation (Pz) was measured as described above. RNA extraction and qRT-PCR RNA extraction and gene expressions of HWP1, SAP1 and PLB2 genes in C. albicans (cells were exposed to 0.05 l/ml of OSEO or 1%
Annealing temp (◦ C)
48 59 60 54
DMSO (solvent control)) were performed as described previously (Ahmad et al., 2013). ACT1, a housekeeping gene, was used as an endogenous control. Primer sequences and annealing temperatures used for qRT-PCR are shown in Table 1. All qRT-PCR experiments were done in duplicate for all treated cell samples from two independent biological experiments.
Statistical analysis Student’s t-test was used to compare effect of OSEO with control in all the experiments. All experiments were performed in triplicate and results were determined as mean ± standard deviation.
Results OSEO used in the present study is high in methyl chavicol concentration followed by linalool (GC–MS characterized oil composition, Khan et al., 2010b). Indian O. sanctum has been distinguished into three chemotypes i.e., eugenol, methyl eugenol and caryophyllene (Verma et al., 2013) as variations in compositions due to geographical, seasonal and soil characteristics are very common (Bowes and Zheljazkov, 2004; Kumar et al., 2010, 2013). Even the method of harvesting and age of leaves at harvesting time (Kothari et al., 2004; Lewinsohn et al., 2000) plays a crucial role in EO composition. OSEO rich in methyl chavicol showed synergy with azoles (Khan et al., 2010c).
Yeast to hyphal transition Yeast to hyphal transition in C. albicans is strongly dependent on pH besides other factors. In control cells (untreated) at pH 6.5, germ tubes were visible only after 30 min. More than 90% cells were seen undergoing yeast to hyphal transition after 210 min (Fig. 1A). Sub-MICs of OSEO at sub-inhibitory concentrations showed potent inhibitory activity against yeast to hyphal transition. At ½ MIC (0.1 l/l) germ tubes were seen after 150 min of incubation when only <1% cells showed transition and hyphal length was 0.51 in comparison to control (7.26 on a scale of 10). After 210 min, when around 99% control cells showed transition with a hyphal length of 9.84, cells incubated with ½ MIC of OSEO showed only 6–8% transition with hyphal length of only 3.5 on a scale of 10. Only around 8% cells were seen forming germ tubes even after 210 min (Fig. 1D). Further, at lower concentrations equal to 1/4 MIC (0.05 l/ml) and 1/8 MIC (0.025 l/ml), only 12–15% and 25–35% cells, respectively showed morphological transition. OSEO thus inhibits yeast to hyphal transition in C. albicans at pH 6.5, thus interfering at the initial stages of infection. Table 2 shows percentage of cells showing hyphae and length of hyphae in m. Hyphal length was even more profoundly affected. While cells continued to grow with time, their length at each point of time was significantly less in comparison to control. At incubation of 210 min, reduced hyphal length to ∼48%, 38% and 35% in presence of OSEO at 1/8, ¼ and ½ MIC.
450
A. Khan et al. / Phytomedicine 21 (2014) 448–452
Fig. 1. Yeast to hyphal transition in Candida albicans ATCC 90028. Cells were grown for 90 min, 150 min and 210 min in [A] untreated control cells [B] 0.025 l/ml [C] 0.05 l/ml [D] 0.1 l/ml of OSEO.
Proteinase and phospholipase assay Cells were tested extensively for proteinase activity in the presence and absence of sub-inhibitory concentrations of OSEO. Fig. 2A summarizes proteinase activity for all the strains tested. It was observed that at ½ MIC, 69% of proteinase activity was inhibited while the respective figure for ¼ MIC was 48%. However, 1/8 MIC of OSEO did not show any significant proteinase inhibition (figure not shown). Fig. 2B summarizes phospholipase enzyme activity for all C. albicans strains tested. 49% and 38% phospholipase secretion was inhibited at ½ MIC and ¼ MIC of OSEO. Even at lower oil
concentrations, a significant inhibition was observed. Experiments performed at 1/8 MIC of OSEO showed results similar to control. Gene expression assay Expression levels of HWP1, SAP1 and PLB2 genes, which are crucial for pathogenesis and expressed exclusively during infection of C. albicans, are shown in Fig. 3. All the three genes were observed to be down regulated when cells were treated with sub-inhibitory concentrations of OSEO. Down regulation of HWP1 and SAP1 genes directly correlates with results observed in separate experiments of morphological transition and proteinase production, respectively.
A. Khan et al. / Phytomedicine 21 (2014) 448–452
451
Table 2 Yeast to hyphal transition in Candida albicans in the presence of OSEO. Time (min)
0 30 60 90 120 150 180 210
Control
1/8 MIC OSEO
¼ MIC OSEO
½ MIC OSEO
I
II
I
II
I
II
I
II
– 5–7% 35–40% 53–58% 60–65% 70–75% 80–85% 95–99%
– 3.34 4.03 4.53 5.66 7.26 7.85 9.84
– 5–7% 5–8% 10% 13–15% 17–19% 21% 25–35%
– 2.76 2.95 3.39 3.66 3.98 4.41 4.7
– – – – ≤1% 2% 7% 12–15%
– – – – 0.91 1.26 1.97 3.71
– – – – – ≤1% 2–3% 6–8%
– – – – 0.51 1.66 3.54
0.8
*
A
0.7 0.6
*
0.5 0.4 0.3 0.2 0.1 0 a
b
c
Pz Value (Zone of precipitation)
Pz Value (Zone of degradation)
MIC of OSEO was taken as 0.2 l/ml. I, percentage of cells showing hyphal growth. II, length of hyphae on a scale of 10 (140 m).
0.9 0.8
*
B *
0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 a
d
b
c
d
Fig. 2. Effect on proteinase (A) and phospholipase (B) secretion by various strains of Candida albicans when exposed to 0 l/ml (a), 0.025 l/ml (b), 0.05 l/ml and (c) 0.1 l/ml of OSEO.
However, expression levels of PLB2 gene were rather erratic, as this gene was not considerably down regulated. Expression of genes is shown as relative values in comparison to untreated cells that were set to one. Down regulation of HWP1 gene with respect to control cells was observed to be 65% whereas the ratio further increases to 85% for SAP1 gene. In contrast, down regulation of PLB2 gene was
Fig. 3. Relative expression of HWP1, SAP1 and PLB2 of Candida albicans ATCC 90028 treated with OSEO (dotted bars) at 0.05 l/ml values. White bars represent the test compound free cells (negative control). Control had an average relative expression of 3 independent recordings.
not much significant and is only around 15% with respect to control. Expression level of ACT1 gene, which is a housekeeping gene, was determined in each set of experiment (data not shown).
Discussion Virulence attributes of Candida species include adherence to host tissues, morphological changes, and secretion of hydrolases, e.g., phospholipases and proteinases (Yang, 2003). Transition from yeast to hyphae is one of the initial stages of infection process of C. albicans. Our work demonstrates that OSEO significantly inhibits the transition of cells from yeasts to hyphae (Fig. 1), thus preventing the initial stage of infection process. Inhibitory effects of sub-inhibitory concentrations of OSEO on Candida cells, suggest that crucial cascades of events leading to morphological transitions may have stopped in presence of this EO. Besides germ tube induction, hyphal length was also inhibited in the presence of OSEO. Hyphal elongation is necessary for deep invasion of host tissues as infection progresses. In control cells, germ tube induction and typical chlamydospore aggregation around hyphae increased as a function of incubation time. Host target cell membrane is made up of proteins and lipids. C. albicans is capable of secreting proteinases (Naglik et al., 2003) and phospholipases (Ibrahim et al., 1995) that hydrolyse peptide bonds and phospholipids, respectively and cause tissue invasion and damage which is the next level in pathogenesis. OSEO has significant inhibitory effect on proteinases (Fig. 2A) and phospholipases (Fig. 2B) suggesting that it can prevent hydrolysis of host tissues when colonized with C. albicans. Thus, it not only prevents transition of yeast to more pathogenic hyphal form but also checks invasion of host tissues by the fungi. As phospholipases and aspartyl proteinases are important virulence factors (Yang, 2003),
452
A. Khan et al. / Phytomedicine 21 (2014) 448–452
their absence or lowered secretion may indicate reduced Candida virulence in presence of OSEO. The present study was also done to investigate expression levels of genes encoding hyphal wall protein (HWP1) which is exclusively expressed in hyphae (Staab et al., 1999); SAP1 (secreted aspartyl proteinase) known to cause tissue damage (Naglik et al., 2003), and PLB2 (lysophospholipase), expression of which is detected in vivo during mouse infections and human oral infections Down regulation of these genes was significantly observed in cells treated with sub-inhibitory concentrations of OSEO. Using qRT-PCR, we detected high Ct values (i.e. low absolute mRNA levels) for all the three genes studied. Low expression of HWP1 gene correlates directly with reduction of yeast to hyphal transition in C. albicans. Similar results were observed with SAP1 gene. However, some discrepancies were observed in PLB2 expression analysis which showed slight variations of Ct values in treated and untreated cells. Besides, HWP1, SAP1and PLB2, the possibility of involvement of other genes (Nailis et al., 2010) in the expression of virulence attributes of C. albicans cannot be denied. Further studies on other gene targets are required to boost present findings and present a clearer picture. Hence, OSEO not only reduces morphological transition in C. albicans from yeast to more pathogenic hyphal form at subinhibitory concentrations, but also has a significant inhibitory effect on the secretion of hydrolytic enzymes during infection. All these effects originate at genetic levels as confirmed by qRT-PCR based analysis of genes expression. Acknowledgements This work was partially supported by Indian Council of Medical Research, India (59/24/2008/BMS/TRM [2008-04780]). Authors wish to thank Dr Malini R. Capoor, Safdarjung Hospital, New Delhi, India for providing clinical isolates of Candida. References Ahmad, A., Khan, A., Manzoor, N., 2013. Reversal of efflux mediated antifungal resistance underlies synergistic activity of two monoterpenes with fluconazole. Eur. J. Pharm. Sci. 48, 80–86.
Bowes, K.M., Zheljazkov, V.D., 2004. Factors affecting yields and essential oil quality of Ocimum sanctum L. and Ocimum basilicum L. cultivars. J. Am. Soc. Hort. Sci. 129, 789–794. Devkatte, A.N., Zore, G.B., Karuppayil, S.M., 2005. Potential of plant oils as inhibitors of Candida albicans growth. FEMS Yeast Res. 5, 867–873. Ibrahim, A.S., Mirbod, F., Filler, S.G., Banno, Y., Cole, G.T., Kitajima, Y., Edward Jr., J.E., Nozawa, Y., Ghannoum, M.A., 1995. Evidence implicating phospholipase as a virulence factor of Candida albicans. Infect. Immun. 63, 1993–1998. Khan, A., Ahmad, A., Akhtar, F., Yousuf, S., Immaculata, X., Khan, L.A., Manzoor, N., 2010b. Ocimum sanctum essential oil and its active principles exert their antifungal activity by disrupting ergosterol biosynthesis and membrane integrity. Res. Microbiol. 161, 816–823. Khan, A., Ahmad, A., Immaculata, X., Khan, L.A., Manzoor, N., 2010c. Anticandidal effect of Ocimum sanctum essential oil and its synergy with fluconazole and ketoconazole. Phytomedicine 17, 921–925. Khan, A., Ahmad, A., Manzoor, N., Khan, L.A., 2010a. Antifungal activities of Ocimum sanctum essential oil and its lead molecules. Nat. Prod. Commun. 5 (2), 345–349. Kothari, S.K., Bhattacharya, A.K., Ramesh, S., 2004. Essential oil yield and quality of methyl eugenol rich Ocimum tenuiflorum L.f (syn. O. sanctum L.) grown in south India as influenced by method of harvest. J. Chromatogr. A. 1054 (1/2), 67–72. Kumar, A., Dubey, N.K., Srivastava, S., 2013. Antifungal evaluation of Ocimum sanctum essential oil against fungal deterioration of raw materials of Rauvolfia serpentina during storage. Ind. Crops Prod. 45, 30–35. Kumar, A., Shukla, R., Singh, P., Dubey, N.K., 2010. Chemical composition, antifungal and antiaflatoxigenic activities of Ocimum sanctum L. essential oil and its safety assessment as plant based antimicrobial. Food Chem. Toxicol. 48, 539–543. Lewinsohn, E., Ziv-Raz, I.I., Dudai, N., Tadmor, Y., Lastochkin, E., Larkov, O., Chaimovitsh, D., Ravid, U., Putievsky, E., Pichersky, E., Shoham, Y., 2000. Biosynthesis of estragole and methyl-eugenol in sweet basil (Ocimum basilicum L). Developmental and chemotypic association of allylphenol O-methyltransferase activities. Plant Sci. 160, 27–35. Naglik, J.R., Rodgers, C.A., Shirlaw, P.J., Dobbie, J.L., Fernandes-Naglik, L.L., Greenspan, D., Agabian, N., Challacombe, S.J., 2003. Differential expression of Candida albicans secreted aspartyl proteinase and phospholipase B genes in humans correlates with active oral and vaginal infections. J. Infect. Dis. 188 (3), 469–479. ˇ cicová, M., Van Dijck, P., Dieter Deforce, D., Nelis, H., Nailis, H., Kucharíková, S., Riˇ Coenye, T., 2010. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression. BMC Microbiol. 10, 114. Staab, J.F., Bradway, S.D., Fidel, P.L., Sundstrom, P., 1999. Adhesive and mammalian transglutaminase substrate properties of Candida albicans Hwp1. Science 283 (5407), 1535–1538. Verma, R.S., Padaliaa, R.C., Chauhana, A., Thulb, S.T., 2013. Exploring compositional diversity in the essential oils of 34 Ocimum taxa from Indian flora. Ind. Crops Prod. 45, 7–19. Yang, Y.L., 2003. Virulence factors of Candida species. J. Microbiol. Immunol. Infect. 36, 223–228. Yousuf, S., Ahmad, A., Khan, A., Manzoor, N., Khan, L.A., 2011. Effect of garlic-derived allyl sulphides on morphogenesis and hydrolytic enzyme secretion in Candida albicans. Med. Mycol. 49 (4), 444–448.