- Email: [email protected]
Odontoblast expression of semaphorin 7A during innervation of human dentin
Matrix Biology 24 (2005) 232 – 238 www.elsevier.com/locate/matbio
Odontoblast expression of semaphorin 7A during innervation of human dentin Jean-Christophe Maurina, Guillaume Delormeb, Irma Machuca-Gayetb, Marie-Lise Coublea, Henry Magloirea, Pierre Jurdicb, Franc¸oise Bleichera,* a
Laboratoire du De´veloppement des Tissus Dentaires, ESPRI INSERM / EA 1892, IFR 62, Faculte´ d’Odontologie, UNIV LYON 1; Rue Guillaume Paradin, 69372 Lyon cedex 08, France b Laboratoire de Biologie Mole´culaire et Cellulaire de l’Ecole Normale Supe´rieure de Lyon, UMR5161 CNRS/ENS, INRA913, 69364 Lyon, France Received 12 January 2005; received in revised form 1 March 2005; accepted 1 March 2005
Abstract Semaphorin 7A (SEMA 7A) is a membrane-anchored member of the semaphorin family of guidance proteins, previously identified in the immune system. Expressed in central and peripheral nervous system during embryonic and post-natal stages, it can mediate neuronal functions by promoting axonal growth. We show here that SEMA 7A is expressed in human odontoblasts in vivo and in vitro and that its expression is correlated with the establishment of dentin-pulp complex terminal innervation . Co-cultures of trigeminal ganglion (TG) with COS cells overexpressing SEMA 7A demonstrate that SEMA 7A can promote the growth of trigeminal nerve fibers. Finally, by RT-PCR and immunochemistry, we show that h1-integrin, a SEMA 7A putative receptor, is expressed in pulpal nerve fibers but we failed to detect a colocalization between nerves and odontoblasts through these molecules. On the basis of these data, we suggest that SEMA 7A might be a molecule involved in the terminal innervation of the dentin-pulp complex. D 2005 Elsevier B.V./International Society of Matrix Biology. All rights reserved. Keywords: Semaphorin 7A; Human tooth pulp; Odontoblasts; Trigeminal ganglion; h1-integrin; Axonal growth
1. Introduction During development, human tooth pulp acquires a profuse sensory innervation from trigeminal ganglion. A dense network of sensory axons from neurons in the trigeminal ganglion (TG) branches extensively in the odontoblast region of the crown. Nerve endings have been described as coiled around the cell bodies and processes of odontoblasts within the dentinal canalicules (Byers, 1984). The development of pulpal and dentinal innervation is closely linked to the developmental maturation of the teeth and full dental innervation occurs relatively late at the postnatal stages, many years after tooth eruption. It is well established that molecular regulatory mechanisms underlie
* Corresponding author. Tel.: +33 4 78 77 86 85; fax: +33 4 78 77 87 57. E-mail address: [email protected] (F. Bleicher).
axon growth in the tooth germs and require coordinated action of tooth-specific combinations of regulatory molecules. Several data indicate that dental pulp cells produce neurotrophic factors (Nosrat et al., 1996, 1997, 1998) (Mitsiadis et al., 1992) some of which being key players during formation of dental pulp innervation (Naftel et al., 1994; Sarram et al., 1997). Young rat trigeminal ganglion (TG) co-cultivated with pulpal explants enhances this view, suggesting that pulpal cells stimulate growth of TG axons via soluble molecules (Lillesaar et al., 1999, 2001). However, genes for neurotrophic factors are expressed in dental pulp cells far before the development of pulpal and dentinal innervation (Luukko, 1998; Nosrat et al., 1998). This suggests that additional molecules are necessary to promote neurite outgrowth during this process. Developing neurons are guided to their target by attractive or repulsive cues in the extracellular environment. Several families of such guidance molecules have been
0945-053X/$ - see front matter D 2005 Elsevier B.V./International Society of Matrix Biology. All rights reserved. doi:10.1016/j.matbio.2005.03.005
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
identified including Netrins, Slits, Ephrins and Semaphorins (SEMA) (Yoshikawa and Thomas, 2004). The latter comprises a large family of secreted and membrane-associated proteins, categorized into eight classes based on distinctive structural features (Fiore and Puschel, 2003). They can act by axon steering, fasciculation, branching or synapse formation during nervous system development (Fiore and Puschel, 2003). During tooth development in rodents, gene expression of several semaphorins (subclasses 3, 4, 5, 6 and 7) have been identified by RT-PCR in dental mesenchyme (Lillesaar and Fried, 2004) and SEMA 3A expression was particularly detected in preodontoblast at the bell stage (Loes et al., 2001). It should be pointed out that there are no relevant data concerning rodents at later stages. However, we found SEMA 7A expression in our substractive cDNA library specific of fully differentiated human odontoblast (Buchaille et al., 2000), leading us to analyze this last step of relationship between mature odontoblast and nerve endings. Briefly, semaphorin 7A (CDw108) is a membrane GPI (glycosylphosphatidylinositol)-anchored protein homologous to a viral semaphorin A39R (Xu et al., 1998). It is expressed by lymphoid or myeloid cell and may act on chemotaxis and cytokine production (Holmes et al., 2002), but it has been mainly described in neuronal populations both during embryonic and post-natal stages (Xu et al., 1998). SEMA 7A plays an important role in promoting
233
axonal growth during the developmental establishment of axonal projections in the olfactory system (Pasterkamp et al., 2003). Semaphorin 7A signaling pathway is not very well known but axonal growth involves direct interaction with h1-integrins and activation of MAPK signaling pathways (Pasterkamp et al., 2003). Therefore, at the tooth level, we hypothesized that SEMA 7A could be a good candidate for the establishment of the final step of dentin innervation. In the present study, we first identify the gene expression and localization of semaphorin 7A in cultured human odontoblasts. Then, using immunohistochemistry, we provide evidence for the expression and distribution of semaphorin 7A and h1-integrins in pulpal nerve fibers in vivo. Finally we demonstrate that cocultures of trigeminal ganglion with transfected COS cells secreting SEMA 7A in vitro mimic the process of oriented neurites attraction, enhancing the role of SEMA 7A in dentin innervation.
2. Results 2.1. Expression and localization of SEMA 7A in human odontoblasts in vivo and in vitro In vivo, the SEMA 7A protein is positively identified in human dental pulp cells and strongly detected as dots in the
Fig. 1. In vivo and in vitro expression of SEMA 7A in human mature odontoblasts: (A) Immunofluorescence labeling of SEMA 7A performed on third molar germ pulp shows a positive signal in the odontoblast layer (Od); (B) In control section, no labelling could be detected in the odontoblast layer; (C) RT-PCR analysis of SEMA 7A expression in cultured odontoblasts (541 bp); (D) Immunofluorescence labelling of cultured odontoblasts reveals a strong staining in the Golgi region; (E) Without permeabilization, SEMA 7A labeling appears as dots localized on the odontoblast cell membranes, more specifically at the basal pole of the cell body and at the base of the cell process (arrows). D.P: dental pulp. Bars: 50 microns.
234
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
odontoblast layer (Fig. 1A). Control section performed without primary antibodies, shows negligible staining (Fig. 1B). In vitro, RT-PCR performed with SEMA 7A primers on total RNA extracted from fully differentiated cultured odontoblasts, displays a 541-bp PCR product (Fig. 1C). This product was then cleaved into three fragments (438, 65 and 38 bp) by Pst-1 enzyme (data not shown). These results confirm the expression of SEMA 7A in the differentiated odontoblasts and indicate that the PCR product represents the SEMA 7A sequence quite accurately. Identification of SEMA 7A protein in cultured cells shows a strong staining in the odontoblast cell bodies (Fig. 1D), particularly dense in the supranuclear area corresponding to the Golgi apparatus. Without fixation and permeabilization, SEMA 7A labelling is mainly seen as dots localized in the microenvironment of the odontoblast membrane. The membrane labeling is
particularly concentrated around the odontoblast cell bodies and at the base of the cell processes (Fig. 1E). 2.2. Expression and localization of b1-integrin subunit and nerve fibers The expression of h1-integrin subunit was identified by RT-PCR performed on total RNA extracted from rat trigeminal ganglion (Fig. 2A). A 153-bp product, corresponding to the h1-integrin sequence, is detected. At the morphological level, h1-integrin is detected as dots on dental nerve fibers running in the human pulp core (Fig. 2B). Interestingly, a faint expression of SEMA 7A molecules in the odontoblast layer (Fig. 2C) can be correlated with the dense innervation of the pulp horn (Fig. 2D), in contrast with transitional zones where
Fig. 2. Expression and localization of h1-integrin subunit and nerve fibers: (A) RT-PCR analysis reveals expression of h1-integrin in rat trigeminal ganglion (153 bp); (B) On human dental pulp sections, bundles of nerve fibers are clearly labeled with h1-integrin antibodies (arrows). (C – F) A double staining with anti-SEMA 7A antibodies (red: C, E) and anti-neurofilament antibodies (green: D, F) on dental pulp was analysed by fluorescence microscopy. (C) SEMA 7A is not expressed in the odontoblast layer (Od) when a heavily nerve distribution (arrows) is observed in the pulp horn (D) (Ph: pulp horn). (E) In contrast, the strong expression of SEMA 7A (red) in the secretory odontoblasts (Od) is correlated with the sparse innervation (arrows) observed in the root region (Rt) (F). Bar is 50 microns in B, 100 microns in C – F.
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
innervation is not fully achieved (Fig. 2F), showing an intense labelling of SEMA 7A in secreting odontoblasts (Fig. 2E).
235
control the stability of the protein produced after 48 h, immunostaining was performed with anti-Myc antibodies. A same labelling is observed on the COS cells (Fig. 3C). No labelling is detected in COS cells control (data not shown).
2.3. Co-culture assays When rat trigeminal ganglions are co-cultured with COS cells transiently transfected with a SEMA 7A construct for 2 days, polarized neurite outgrowths are observed, clearly converging towards the transfected cells (Fig. 3A). When the same experiments are performed with non-transfected COS cells, a few neurites sprouting from the trigeminal ganglion are identified without precise orientation (Fig. 3B). The SEMA 7A expression in transfected-COS cells is confirmed by RT-PCR and immunochemistry. RT-PCR performed on total RNA extracted from transfected cells displays a 541-bp PCR product, corresponding to the SEMA 7A sequence (Fig. 3D). The control COS cells do not express the SEMA 7A. The housekeeping gene GAPDH, coamplified to control the equal amounts of template RNA, is identically expressed in both types of cells. The SEMA 7A protein is also identified in transfected cells by immunostaining using the antiCDw108 antibodies. As observed in the cultured odontoblasts, a strong positive labelling is found in COS cells and some dots are present on the cell membrane (Fig. 3E). To
3. Discussion In this study we present evidence that SEMA 7A, (a membrane-associated protein previously identified during brain development) is expressed by odontoblasts in culture derived from human dental pulp cells. It is to be noticed that our cell culture system (Couble et al., 2000) made it possible to obtain highly differentiated odontoblasts both at the functional and morphological levels. In vivo, SEMA 7A was similarly localized in dentin forming cells of mature teeth. These results are consistent with a recent study (Lillesaar and Fried, 2004) showing the expression of SEMA 7A in dental mesenchyme during rodent development and occurring at the final stage (post-natal day 9) after odontoblast differentiation. Interestingly, SEMA 7A expression seems to be correlated with the innervation process occurring in the odontoblast layer. Our in vivo results show that Sema7A is more intensely expressed in the odontoblast layer when nerve fibers have not yet reached this area thus
Fig. 3. Two days co-culture of SEMA 7A-transfected COS cells with rat trigeminal ganglion: (A) A strong density of polarized neurite outgrowth (black arrows) from trigeminal ganglion (TG) converging toward SEMA 7A-transfected COS cells (*) is observed by phase-contrast microscopy. (B) The same experiment performed with non transfected-COS cells (*) shows scattered neurites without specific orientation (arrow). (C) Immunofluorescence labeling with the monoclonal anti-Myc antibody reveals a strong staining in the transfected COS cells and demonstates the stability of the synthesized protein after 2 days of culture. (D) RT-PCR analysis confirms the SEMA 7A expression (541 bp) in transfected COS cells (lane 1) whereas no SEMA 7A transcripts are detected in control COS cells (lane 2). GAPDH transcripts (450 bp) were coamplified in transfected COS cells (lane 3) and control COS cells (lane 4) to confirm the equal amount of template RNA. (E) Immunofluorescence labeling with the monoclonal anti-CDw108 antibody reveals a strong staining in the transfected COS cells. Inset: note positive dots spread on the cell membrane (arrows). Bars: 50 microns.
236
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
contrasting with well innervated zones where a faint positive signal could be identified. In these conditions, the critical window of Sema7A expression during the establishment of dentin innervation, suggests that it might promote the guidance of nerve fibers within the odontoblast layer. It is now well established that neurotrophic factors such as brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), glial cell line-derived neurotrophic factor (GDNF), and SEMA 3A, expressed in pulp tissue, are suspected of being involved in the control of pulpal axon growth (Naftel et al., 1994; Luuko et al., 1997; Nosrat et al., 1998, 2001; Loes et al., 2001). However, the expression of these key factors occurs at the earlier stages of dental development, e.g. when dentin innervation is not fully ended. Therefore, the late expression of SEMA 7A might promote the final step of dentinal innervation. Indeed, transfected COS-cells secreting Sema7A, co-cultured with trigeminal ganglion, demonstrate an oriented attractive process of neurite outgrowth towards the secreting cells. Similar results recently described in rat olfactory bulb or rat cortex (Pasterkamp et al., 2003), enhance this point of view as well as the involvement of semaphorins in the fasciculation of trigeminal nerve fibers (Ulupinar et al., 1999). Taken together, these data strongly suggest that Sema 7A could participate in the guidance of developing pulpal axons even if the intimate mechanisms of this process are still unknown. In neurons, Sema7A signaling probably involves direct interactions of h1-integrin with the RGD motif of the semaphorin domain (Pasterkamp et al., 2003). Indeed plexin C1, first assumed to bind Sema7A (Tamagnone et al., 1999), does not play any part in axon growth (Pasterkamp et al., 2003). Thus, integrins may constitute co-receptors with unidentified Sema7A-binding proteins. Nevertheless, we failed to detect co-localization between pulpal nerves and odontoblast cell membrane through h1-integrin or Sema7A molecules (data not shown). In these conditions, Sema 7A could be taken away from the cell membrane by specific proteases as previously described (Fritz and Lowe, 1996; Kahl et al., 2000; Ohnishi et al., 2004) and released in the intercellular space corresponding to the tenuous extracellular veil detected on odontoblast or COS cell membranes. Several matrix metalloproteinases previously identified on odontoblast (Palosaari et al., 2002, 2003), might participate in this release process of SEMA 7A in the extracellular matrix. Thus, the role of Sema7A could be restricted to the ultimate guidance of pulpal nerve fibers to the odontoblast layer. During the last step, the modulation of adhesion process between nerve endings and odontoblasts is probably mediated by other molecules such as reelin. Indeed, we have recently shown that reelin, expressed in human odontoblasts and co-localized between the latter and nerve varicosities (Maurin et al., 2004), might be involved in the terminal innervation of the dentin/pulp complex. In conclusion, we show for the first time that Sema7A is specifically expressed by odontoblasts in vitro and in
human tooth pulp. Its late expression and its attractive role on trigeminal nerve fibers in vitro, demonstrate that Sema7A could be a neurotrophic factor essential for the establishment of dentin-pulp complex innervation. All these data prompt us to analyze the precise role of SEMA 7A during the dentin –pulp complex innervation in sound and injured teeth using the rodent model (knock-out mice and specific antibodies).
4. Experimental procedures 4.1. Preparation of tissues Dental pulps were obtained from sound human third molar germs (14 –16 years old) extracted for orthodontic reasons with the informed consent of the patients in accordance with French legal requirements (article 672-1, Public Health Code). Whole pulps were removed through the developing apical end. Some of them were cut to obtain explants for cell culture. Others (5 specimens) were embedded in Tissue-Tek O.C.T.-Compound (Miles Scientific, Washington, PA), plunged into liquid nitrogen-cooled isopentane and kept frozen at 70 -C, for immunohistochemistry. Cryostat sections (10 Am) were transferred to 3aminopropyl triethoxysilane-coated slides, air dried and kept frozen until pretreatment. 4.2. Cell culture Odontoblast were obtained by culture of human dental pulp as previously described (Couble et al., 2000). Briefly, explants were grown in Eagle’s basal medium (Invitrogen, Grand Island, NY) supplemented with 50 Ag/ml ascorbic acid, 100 IU/ml penicillin – 50 Ag/ml streptomycin (Roche Diagnostic, Mannheim Germany), 10% fetal calf serum (Biowest, Nuaille´, France). Cells were maintained in culture at 37 -C in a humidified atmosphere of 5% CO2 for 4– 6 weeks. In these conditions, cultured cells exhibited a fibroblastic morphology. When 10 mM h-glycerophosphate was added to the medium, cells differentiated into odontoblast cells. 4.3. Co-culture assays TG explants were then co-cultured with semaphorin 7Atransfected COS cells in three-dimensional collagen gel as recently described (Maurin et al., 2004). Briefly, COS cells were transiently transfected with a soluble Myc-tagged SEMA7A encoding vector (from Exelixis Inc., South San Francisco, CA) at approximately 80% confluency using Lipofectamine 2000, according to the manufacturer’s instruction (Invitrogen). One day old Sprague – Dawley rat pups were decapitated and the TG were exposed. After removal of meningeal coverings, the TGs were cut out and rinsed with Opti-MEM medium (Invitrogen). TG explants
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
237
Table 1 RT-PCR primer characteristics Primers
Sequences
Annealing temperature (-C)
Fragment size (bp)
Semaphorin 7A h1-integrin GAPDH
5¶ CTGGATAAGCGGGACTGCGAG 3¶ GCTGCCACCAACAAGAACTTCA 5¶ AAAGGAGAAAAGAAAGACAC 3¶ ACTGTTGGTTCTATTTTACG 5¶ ACCACAGTCCATGCCATCAC 3¶ TCCACCACCCTGTTGCTGTA
59 49 59
541 153 450
were put down at 1 –3 mm from the peripheral zone of the culture and then trigeminal explant and COS cells were embedded in 100 Al of collagen (Institut Jacques Boy, Reims, France). Cultures were incubated at 37 -C in a humidified atmosphere of 5% CO2. After 2 days, they were fixed in 4% paraformaldehyde-PBS 0.1 M pH 7,4 for 30 min at 4 -C. Controls were also performed with COS transfected cells with an empty pSecTag. Experiments were performed in triplicate. 4.4. Preparation of RNA Total RNA from rat trigeminal ganglion, cultured odontoblasts and COS cells were obtained with the NucleoSpin RNA II kit and protocol (Macherey-Nagel, Du¨ren, Germany). 4.5. RT-PCR (Reverse transcription-polymerase chain reaction) RT-PCR experiments were performed on 100 ng of template RNA by using Titan one tube RT-PCR system (Roche Diagnostic), under the following conditions: incubation at 50 -C for 30 min, 35 cycles of denaturation at 94 -C for 30 s, annealing with specific primers (see Table 1) for 30 s, extension at 68 -C for 45 s, followed by a final extension step at 68 -C for 7 min. For comparison of the SEMA 7A expression between transfected COS cells and control COS cells, a housekeeping gene was coamplified to control the equal amounts of template RNA. The PCR products were run on agarose gel electrophoresis using NuSieve 3 : 1 agarose (FMC Bioproducts, Rockland, ME) and visualized with ethidium bromide (1 mg/ml). PCR amplification specificity was confirmed by enzymatic restriction. 4.6. Antibodies Immunochemistry studies were performed using monoclonal mouse antibodies against CDw108 (Sema 7A) (1 : 50; Chemicon International Inc., Temecula, CA), or polyclonal rabbit antibodies against neurofilament H (200 kDa) (1 : 200; Chemicon) and h1-integrin (M-106) (1 : 50; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). 4.7. Immunohistochemistry For immunostaining with anti-CDw108 and anti-neurofilament antibodies, sections were incubated overnight before
being revealed with a biotinylated antibody (Vector Laboratories, Burlingame, CA) and a streptavidin-Cy3 complex (1 : 6000) (Molecular Probes Inc, Eugene, OR) for 30 min. Odontoblast and COS cell cultures were fixed with 4% paraformaldehyde– 0.05% saponin in PBS for 30 min at 4 -C. After rinsing in 0.05% saponin-PBS containing 0.1 M lysine-HCl, they were treated for 30 min in PBS-0.05% saponin-2% NGS (Normal goat serum). They were incubated overnight with anti-CDw108 antibody and revealed as described above for tissue sections. Some others were directly incubated with anti-CDw108 antibody without permeabilization. To control the synthesis of a stable protein product, COS cell cultures were labeled with anti-Myc antibodies (1 / 500) (Invitrogen). For double-staining, dental pulp section samples were treated for 30 min in PBS-0.05% saponin-2% NGS and incubated overnight with anti-CDw108 and anti-neurofilament H antibodies. They were revealed with a biotinylated antibody (Vector laboratories), and a streptavidin-Cy3 complex (1 : 6000) (Molecular Probes Inc.) for 30 min. Samples were then incubated for 1 h with a conjugated goat anti-rabbit IgG Alexa fluor 488 (1 : 1000) (Molecular Probes Inc.). Control sections were systematically processed simultaneously in which primary antibody was replaced with PBS (Phosphate buffered saline). Check experiments of the COS cell SEMA 7A expression, were carried out with the antiCDw108 antibodies on non-transfected COS cells cultures or by omitting the primary antibody on SEMA 7A transfected COS cell cultures.
Acknowledgements We acknowledge the staff of the ‘‘Service de Stomatologie de l’Hoˆpital Saint-Joseph’’ Lyon for collecting tooth samples. This work has received a technical support from the Centre Commun d’ imagerie (CeCIL), IFR 62, Lyon and was supported by the ‘‘Ministe`re de l’Education Nationale’’ (EA 1892-IFR62). Finally we are grateful to Dr. Lee Pape for grammatical review of the manuscript.
References Buchaille, R., Couble, M.L., Magloire, H., Bleicher, F., 2000. A substractive PCR-based cDNA library from human odontoblast cells: identification of novel genes expressed in tooth forming cells. Matrix Biol. 19, 421 – 430. Byers, M.R., 1984. Dental sensory receptors. Int. Rev. Neurobiol. 25, 39 – 94.
238
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
Couble, M.L., Farges, J.C., Bleicher, F., Perrat-Mabillon, B., Boudeulle, M., Magloire, H., 2000. Odontoblast differentiation of human dental pulp cells in explant cultures. Calcif. Tissue Int. 66, 129 – 138. Fiore, R., Puschel, A.W., 2003. The function of semaphorins during nervous system development. Front. Biosci. 8, s484 – s499. Fritz, B.A., Lowe, A.W., 1996. Polarized GP2 secretion in MDCK cells via GPI targeting and apical membrane restricted proteolysis. Am. J. Physiol. 270, 176 – 183. Holmes, S., Downs, A.M., Fosberry, A., Hayes, P.D., Michalovich, D., Murdoch, P., Moores, K., Fox, J., Deen, K., Pettman, G., Wattam, T., Lewis, C., 2002. Sema7A is a potent monocyte stimulator. Scand. J. Immunol. 56, 270 – 275. Kahl, S., Nissen, M., Girisch, R., Duffy, T., Leiter, E.H., Haag, F., KochNolte, F., 2000. Metalloprotease-mediated shedding of enzymatically active mouse ecto-ADP-ribosyltransferase ART2.2 upon T cell activation. J. Immunol. 165, 4463 – 4469. Lillesaar, C., Fried, K., 2004. Neurites from trigeminal ganglion explants grown in vitro are repelled or attracted by tooth-related tissues depending on developmental stage. Neuroscience 125, 149 – 161. Lillesaar, C., Eriksson, C., Johansson, C.S., Fried, K., Hildebrand, C., 1999. Tooth pulp tissue promotes neurite outgrowth from rat trigeminal ganglia in vitro. J. Neurocytol. 28, 663 – 670. Lillesaar, C., Eriksson, C., Fried, K., 2001. Rat tooth pulp cells elicit neurite growth from trigeminal neurones and express mRNAs for neurotrophic factors in vitro. Neurosci. Lett. 308, 161 – 164. Loes, S., Kettunen, P., Kvinnsland, I.H., Taniguchi, M., Fujisawa, H., Luukko, K., 2001. Expression of class 3 semaphorins and neuropilin receptors in the developing mouse tooth. Mech. Dev. 101, 191 – 194. Luukko, K., 1998. Neuronal cells and neurotrophins in odontogenesis. Eur. J. Oral Sci. 106 (Suppl 1), 80 – 93. Luuko, K., Aruma¨e, U., Karavanov, A., Moshnyakov, M., Sainio, K., Sariola, H., Saarma, M., Thesleff, I., 1997. Neurotrophin m RNA expression in the developing tooth suggests multiple roles in innervation and organogenesis. Dev. Dyn. 210, 117 – 129. Maurin, J.C., Couble, M.L., Didier-Baze`s, M., Brisson, C., Magloire, H., Bleicher, F., 2004. Expression and localization of reelin in human odontoblasts. Matrix Biol. 23, 277 – 285. Mitsiadis, T.A., Dicou, E., Joffre, A., Magloire, H., 1992. Immunohistochemical localization of nerve growth factor (NGF) and NGF receptor (NGF-R) in the developing first molar tooth of the rat. Differentiation 49, 47 – 61. Naftel, J.P., Qian, X.B., Bernanke, J.M., 1994. Effects of postnatal antinerve growth factor serum exposure on development of apical nerves of the rat molar. Brain Res. Dev. Brain Res. 80, 54 – 62.
Nosrat, C.A., Tomac, A., Lindqvist, E., Lindskog, S., Humpel, C., Stromberg, I., Ebendal, T., Hoffer, B.J., Olson, L., 1996. Cellular expression of GDNF mRNA suggests multiple functions inside and outside the nervous system. Cell Tissue Res. 286, 191 – 207. Nosrat, C.A., Fried, K., Lindskog, S., Olson, L., 1997. Cellular expression of neurotrophin mRNAs during tooth development. Cell Tissue Res. 290, 569 – 580. Nosrat, C.A., Fried, K., Ebendal, T., Olson, L., 1998. NGF, BDNF, NT3, NT4 and GDNF in tooth development. Eur. J. Oral Sci. 106 (Suppl 1), 94 – 99. Nosrat, I.V., Widenfalk, J., Olson, L., Nosrat, C.A., 2001. Dental pulp cells produce neurotrophic factors, interact with trigeminal neurons in vitro, and rescue motoneurons after spinal cord injury. Dev. Biol. 238, 120 – 132. Ohnishi, H., Kobayashi, H., Okazawa, H., Ohe, Y., Tomizawa, K., Sato, R., Matozaki, T., 2004. Ectodomain shedding of SHPS-1 and its role in regulation of cell migration. J. Biol. Chem. 279, 27878 – 27887. Palosaari, H., Ding, Y., Larmas, M., Sorsa, T., Barlett, J.D., Salo, T., Tja¨derhane, L., 2002. Regulation and interaction of MT-1-MMP and MMP-20 in human odontoblasts and pulp tissue in vitro. J. Dent. Res. 81, 354 – 359. Palosaari, H., Pennington, C.J., Larmas, M., Edwards, D.R., Tja¨derhane, L., Salo, T., 2003. Expression profile of matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs in mature human odontoblasts and pulp tissue. Eur. J. Oral Sci. 111, 1 – 11. Pasterkamp, R.J., Peschon, J.J., Spriggs, M.K., Kolodkin, A.L., 2003. Semaphorin 7A promotes axon outgrowth through integrins and MAPKs. Nature 424, 398 – 405. Sarram, S., Lee, K.F., Byers, M.R., 1997. Dental innervation and CGRP in adult p75-deficient mice. J. Comp. Neurol. 385, 297 – 308. Tamagnone, L., Artigiani, S., Chen, H., He, Z., Ming, G.I., Song, H., Chedotal, A., Winberg, M.L., Goodman, C.S., Poo, M., TessierLavigne, M., Comoglio, P.M., 1999. Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99, 71 – 80. Ulupinar, E., Datwani, A., Behar, O., Fujisawa, H., Erzurumlu, R., 1999. Role of semaphorin III in the developing rodent trigeminal system. Mol. Cell. Neurosci. 13, 281 – 292. Xu, X., Ng, S., Wu, Z.L., Nguyen, D., Homburger, S., Seidel-Dugan, C., Ebens, A., Luo, Y., 1998. Human semaphorin K1 is glycosylphosphatidylinositol-linked and defines a new subfamily of viral-related semaphorins. J. Biol. Chem. 273, 22428 – 22434. Yoshikawa, S., Thomas, J.B., 2004. Secreted cell signaling molecules in axon guidance. Curr. Opin. Neurobiol. 14, 45 – 50.
Odontoblast expression of semaphorin 7A during innervation of human dentin Jean-Christophe Maurina, Guillaume Delormeb, Irma Machuca-Gayetb, Marie-Lise Coublea, Henry Magloirea, Pierre Jurdicb, Franc¸oise Bleichera,* a
Laboratoire du De´veloppement des Tissus Dentaires, ESPRI INSERM / EA 1892, IFR 62, Faculte´ d’Odontologie, UNIV LYON 1; Rue Guillaume Paradin, 69372 Lyon cedex 08, France b Laboratoire de Biologie Mole´culaire et Cellulaire de l’Ecole Normale Supe´rieure de Lyon, UMR5161 CNRS/ENS, INRA913, 69364 Lyon, France Received 12 January 2005; received in revised form 1 March 2005; accepted 1 March 2005
Abstract Semaphorin 7A (SEMA 7A) is a membrane-anchored member of the semaphorin family of guidance proteins, previously identified in the immune system. Expressed in central and peripheral nervous system during embryonic and post-natal stages, it can mediate neuronal functions by promoting axonal growth. We show here that SEMA 7A is expressed in human odontoblasts in vivo and in vitro and that its expression is correlated with the establishment of dentin-pulp complex terminal innervation . Co-cultures of trigeminal ganglion (TG) with COS cells overexpressing SEMA 7A demonstrate that SEMA 7A can promote the growth of trigeminal nerve fibers. Finally, by RT-PCR and immunochemistry, we show that h1-integrin, a SEMA 7A putative receptor, is expressed in pulpal nerve fibers but we failed to detect a colocalization between nerves and odontoblasts through these molecules. On the basis of these data, we suggest that SEMA 7A might be a molecule involved in the terminal innervation of the dentin-pulp complex. D 2005 Elsevier B.V./International Society of Matrix Biology. All rights reserved. Keywords: Semaphorin 7A; Human tooth pulp; Odontoblasts; Trigeminal ganglion; h1-integrin; Axonal growth
1. Introduction During development, human tooth pulp acquires a profuse sensory innervation from trigeminal ganglion. A dense network of sensory axons from neurons in the trigeminal ganglion (TG) branches extensively in the odontoblast region of the crown. Nerve endings have been described as coiled around the cell bodies and processes of odontoblasts within the dentinal canalicules (Byers, 1984). The development of pulpal and dentinal innervation is closely linked to the developmental maturation of the teeth and full dental innervation occurs relatively late at the postnatal stages, many years after tooth eruption. It is well established that molecular regulatory mechanisms underlie
* Corresponding author. Tel.: +33 4 78 77 86 85; fax: +33 4 78 77 87 57. E-mail address: [email protected] (F. Bleicher).
axon growth in the tooth germs and require coordinated action of tooth-specific combinations of regulatory molecules. Several data indicate that dental pulp cells produce neurotrophic factors (Nosrat et al., 1996, 1997, 1998) (Mitsiadis et al., 1992) some of which being key players during formation of dental pulp innervation (Naftel et al., 1994; Sarram et al., 1997). Young rat trigeminal ganglion (TG) co-cultivated with pulpal explants enhances this view, suggesting that pulpal cells stimulate growth of TG axons via soluble molecules (Lillesaar et al., 1999, 2001). However, genes for neurotrophic factors are expressed in dental pulp cells far before the development of pulpal and dentinal innervation (Luukko, 1998; Nosrat et al., 1998). This suggests that additional molecules are necessary to promote neurite outgrowth during this process. Developing neurons are guided to their target by attractive or repulsive cues in the extracellular environment. Several families of such guidance molecules have been
0945-053X/$ - see front matter D 2005 Elsevier B.V./International Society of Matrix Biology. All rights reserved. doi:10.1016/j.matbio.2005.03.005
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
identified including Netrins, Slits, Ephrins and Semaphorins (SEMA) (Yoshikawa and Thomas, 2004). The latter comprises a large family of secreted and membrane-associated proteins, categorized into eight classes based on distinctive structural features (Fiore and Puschel, 2003). They can act by axon steering, fasciculation, branching or synapse formation during nervous system development (Fiore and Puschel, 2003). During tooth development in rodents, gene expression of several semaphorins (subclasses 3, 4, 5, 6 and 7) have been identified by RT-PCR in dental mesenchyme (Lillesaar and Fried, 2004) and SEMA 3A expression was particularly detected in preodontoblast at the bell stage (Loes et al., 2001). It should be pointed out that there are no relevant data concerning rodents at later stages. However, we found SEMA 7A expression in our substractive cDNA library specific of fully differentiated human odontoblast (Buchaille et al., 2000), leading us to analyze this last step of relationship between mature odontoblast and nerve endings. Briefly, semaphorin 7A (CDw108) is a membrane GPI (glycosylphosphatidylinositol)-anchored protein homologous to a viral semaphorin A39R (Xu et al., 1998). It is expressed by lymphoid or myeloid cell and may act on chemotaxis and cytokine production (Holmes et al., 2002), but it has been mainly described in neuronal populations both during embryonic and post-natal stages (Xu et al., 1998). SEMA 7A plays an important role in promoting
233
axonal growth during the developmental establishment of axonal projections in the olfactory system (Pasterkamp et al., 2003). Semaphorin 7A signaling pathway is not very well known but axonal growth involves direct interaction with h1-integrins and activation of MAPK signaling pathways (Pasterkamp et al., 2003). Therefore, at the tooth level, we hypothesized that SEMA 7A could be a good candidate for the establishment of the final step of dentin innervation. In the present study, we first identify the gene expression and localization of semaphorin 7A in cultured human odontoblasts. Then, using immunohistochemistry, we provide evidence for the expression and distribution of semaphorin 7A and h1-integrins in pulpal nerve fibers in vivo. Finally we demonstrate that cocultures of trigeminal ganglion with transfected COS cells secreting SEMA 7A in vitro mimic the process of oriented neurites attraction, enhancing the role of SEMA 7A in dentin innervation.
2. Results 2.1. Expression and localization of SEMA 7A in human odontoblasts in vivo and in vitro In vivo, the SEMA 7A protein is positively identified in human dental pulp cells and strongly detected as dots in the
Fig. 1. In vivo and in vitro expression of SEMA 7A in human mature odontoblasts: (A) Immunofluorescence labeling of SEMA 7A performed on third molar germ pulp shows a positive signal in the odontoblast layer (Od); (B) In control section, no labelling could be detected in the odontoblast layer; (C) RT-PCR analysis of SEMA 7A expression in cultured odontoblasts (541 bp); (D) Immunofluorescence labelling of cultured odontoblasts reveals a strong staining in the Golgi region; (E) Without permeabilization, SEMA 7A labeling appears as dots localized on the odontoblast cell membranes, more specifically at the basal pole of the cell body and at the base of the cell process (arrows). D.P: dental pulp. Bars: 50 microns.
234
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
odontoblast layer (Fig. 1A). Control section performed without primary antibodies, shows negligible staining (Fig. 1B). In vitro, RT-PCR performed with SEMA 7A primers on total RNA extracted from fully differentiated cultured odontoblasts, displays a 541-bp PCR product (Fig. 1C). This product was then cleaved into three fragments (438, 65 and 38 bp) by Pst-1 enzyme (data not shown). These results confirm the expression of SEMA 7A in the differentiated odontoblasts and indicate that the PCR product represents the SEMA 7A sequence quite accurately. Identification of SEMA 7A protein in cultured cells shows a strong staining in the odontoblast cell bodies (Fig. 1D), particularly dense in the supranuclear area corresponding to the Golgi apparatus. Without fixation and permeabilization, SEMA 7A labelling is mainly seen as dots localized in the microenvironment of the odontoblast membrane. The membrane labeling is
particularly concentrated around the odontoblast cell bodies and at the base of the cell processes (Fig. 1E). 2.2. Expression and localization of b1-integrin subunit and nerve fibers The expression of h1-integrin subunit was identified by RT-PCR performed on total RNA extracted from rat trigeminal ganglion (Fig. 2A). A 153-bp product, corresponding to the h1-integrin sequence, is detected. At the morphological level, h1-integrin is detected as dots on dental nerve fibers running in the human pulp core (Fig. 2B). Interestingly, a faint expression of SEMA 7A molecules in the odontoblast layer (Fig. 2C) can be correlated with the dense innervation of the pulp horn (Fig. 2D), in contrast with transitional zones where
Fig. 2. Expression and localization of h1-integrin subunit and nerve fibers: (A) RT-PCR analysis reveals expression of h1-integrin in rat trigeminal ganglion (153 bp); (B) On human dental pulp sections, bundles of nerve fibers are clearly labeled with h1-integrin antibodies (arrows). (C – F) A double staining with anti-SEMA 7A antibodies (red: C, E) and anti-neurofilament antibodies (green: D, F) on dental pulp was analysed by fluorescence microscopy. (C) SEMA 7A is not expressed in the odontoblast layer (Od) when a heavily nerve distribution (arrows) is observed in the pulp horn (D) (Ph: pulp horn). (E) In contrast, the strong expression of SEMA 7A (red) in the secretory odontoblasts (Od) is correlated with the sparse innervation (arrows) observed in the root region (Rt) (F). Bar is 50 microns in B, 100 microns in C – F.
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
innervation is not fully achieved (Fig. 2F), showing an intense labelling of SEMA 7A in secreting odontoblasts (Fig. 2E).
235
control the stability of the protein produced after 48 h, immunostaining was performed with anti-Myc antibodies. A same labelling is observed on the COS cells (Fig. 3C). No labelling is detected in COS cells control (data not shown).
2.3. Co-culture assays When rat trigeminal ganglions are co-cultured with COS cells transiently transfected with a SEMA 7A construct for 2 days, polarized neurite outgrowths are observed, clearly converging towards the transfected cells (Fig. 3A). When the same experiments are performed with non-transfected COS cells, a few neurites sprouting from the trigeminal ganglion are identified without precise orientation (Fig. 3B). The SEMA 7A expression in transfected-COS cells is confirmed by RT-PCR and immunochemistry. RT-PCR performed on total RNA extracted from transfected cells displays a 541-bp PCR product, corresponding to the SEMA 7A sequence (Fig. 3D). The control COS cells do not express the SEMA 7A. The housekeeping gene GAPDH, coamplified to control the equal amounts of template RNA, is identically expressed in both types of cells. The SEMA 7A protein is also identified in transfected cells by immunostaining using the antiCDw108 antibodies. As observed in the cultured odontoblasts, a strong positive labelling is found in COS cells and some dots are present on the cell membrane (Fig. 3E). To
3. Discussion In this study we present evidence that SEMA 7A, (a membrane-associated protein previously identified during brain development) is expressed by odontoblasts in culture derived from human dental pulp cells. It is to be noticed that our cell culture system (Couble et al., 2000) made it possible to obtain highly differentiated odontoblasts both at the functional and morphological levels. In vivo, SEMA 7A was similarly localized in dentin forming cells of mature teeth. These results are consistent with a recent study (Lillesaar and Fried, 2004) showing the expression of SEMA 7A in dental mesenchyme during rodent development and occurring at the final stage (post-natal day 9) after odontoblast differentiation. Interestingly, SEMA 7A expression seems to be correlated with the innervation process occurring in the odontoblast layer. Our in vivo results show that Sema7A is more intensely expressed in the odontoblast layer when nerve fibers have not yet reached this area thus
Fig. 3. Two days co-culture of SEMA 7A-transfected COS cells with rat trigeminal ganglion: (A) A strong density of polarized neurite outgrowth (black arrows) from trigeminal ganglion (TG) converging toward SEMA 7A-transfected COS cells (*) is observed by phase-contrast microscopy. (B) The same experiment performed with non transfected-COS cells (*) shows scattered neurites without specific orientation (arrow). (C) Immunofluorescence labeling with the monoclonal anti-Myc antibody reveals a strong staining in the transfected COS cells and demonstates the stability of the synthesized protein after 2 days of culture. (D) RT-PCR analysis confirms the SEMA 7A expression (541 bp) in transfected COS cells (lane 1) whereas no SEMA 7A transcripts are detected in control COS cells (lane 2). GAPDH transcripts (450 bp) were coamplified in transfected COS cells (lane 3) and control COS cells (lane 4) to confirm the equal amount of template RNA. (E) Immunofluorescence labeling with the monoclonal anti-CDw108 antibody reveals a strong staining in the transfected COS cells. Inset: note positive dots spread on the cell membrane (arrows). Bars: 50 microns.
236
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
contrasting with well innervated zones where a faint positive signal could be identified. In these conditions, the critical window of Sema7A expression during the establishment of dentin innervation, suggests that it might promote the guidance of nerve fibers within the odontoblast layer. It is now well established that neurotrophic factors such as brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), glial cell line-derived neurotrophic factor (GDNF), and SEMA 3A, expressed in pulp tissue, are suspected of being involved in the control of pulpal axon growth (Naftel et al., 1994; Luuko et al., 1997; Nosrat et al., 1998, 2001; Loes et al., 2001). However, the expression of these key factors occurs at the earlier stages of dental development, e.g. when dentin innervation is not fully ended. Therefore, the late expression of SEMA 7A might promote the final step of dentinal innervation. Indeed, transfected COS-cells secreting Sema7A, co-cultured with trigeminal ganglion, demonstrate an oriented attractive process of neurite outgrowth towards the secreting cells. Similar results recently described in rat olfactory bulb or rat cortex (Pasterkamp et al., 2003), enhance this point of view as well as the involvement of semaphorins in the fasciculation of trigeminal nerve fibers (Ulupinar et al., 1999). Taken together, these data strongly suggest that Sema 7A could participate in the guidance of developing pulpal axons even if the intimate mechanisms of this process are still unknown. In neurons, Sema7A signaling probably involves direct interactions of h1-integrin with the RGD motif of the semaphorin domain (Pasterkamp et al., 2003). Indeed plexin C1, first assumed to bind Sema7A (Tamagnone et al., 1999), does not play any part in axon growth (Pasterkamp et al., 2003). Thus, integrins may constitute co-receptors with unidentified Sema7A-binding proteins. Nevertheless, we failed to detect co-localization between pulpal nerves and odontoblast cell membrane through h1-integrin or Sema7A molecules (data not shown). In these conditions, Sema 7A could be taken away from the cell membrane by specific proteases as previously described (Fritz and Lowe, 1996; Kahl et al., 2000; Ohnishi et al., 2004) and released in the intercellular space corresponding to the tenuous extracellular veil detected on odontoblast or COS cell membranes. Several matrix metalloproteinases previously identified on odontoblast (Palosaari et al., 2002, 2003), might participate in this release process of SEMA 7A in the extracellular matrix. Thus, the role of Sema7A could be restricted to the ultimate guidance of pulpal nerve fibers to the odontoblast layer. During the last step, the modulation of adhesion process between nerve endings and odontoblasts is probably mediated by other molecules such as reelin. Indeed, we have recently shown that reelin, expressed in human odontoblasts and co-localized between the latter and nerve varicosities (Maurin et al., 2004), might be involved in the terminal innervation of the dentin/pulp complex. In conclusion, we show for the first time that Sema7A is specifically expressed by odontoblasts in vitro and in
human tooth pulp. Its late expression and its attractive role on trigeminal nerve fibers in vitro, demonstrate that Sema7A could be a neurotrophic factor essential for the establishment of dentin-pulp complex innervation. All these data prompt us to analyze the precise role of SEMA 7A during the dentin –pulp complex innervation in sound and injured teeth using the rodent model (knock-out mice and specific antibodies).
4. Experimental procedures 4.1. Preparation of tissues Dental pulps were obtained from sound human third molar germs (14 –16 years old) extracted for orthodontic reasons with the informed consent of the patients in accordance with French legal requirements (article 672-1, Public Health Code). Whole pulps were removed through the developing apical end. Some of them were cut to obtain explants for cell culture. Others (5 specimens) were embedded in Tissue-Tek O.C.T.-Compound (Miles Scientific, Washington, PA), plunged into liquid nitrogen-cooled isopentane and kept frozen at 70 -C, for immunohistochemistry. Cryostat sections (10 Am) were transferred to 3aminopropyl triethoxysilane-coated slides, air dried and kept frozen until pretreatment. 4.2. Cell culture Odontoblast were obtained by culture of human dental pulp as previously described (Couble et al., 2000). Briefly, explants were grown in Eagle’s basal medium (Invitrogen, Grand Island, NY) supplemented with 50 Ag/ml ascorbic acid, 100 IU/ml penicillin – 50 Ag/ml streptomycin (Roche Diagnostic, Mannheim Germany), 10% fetal calf serum (Biowest, Nuaille´, France). Cells were maintained in culture at 37 -C in a humidified atmosphere of 5% CO2 for 4– 6 weeks. In these conditions, cultured cells exhibited a fibroblastic morphology. When 10 mM h-glycerophosphate was added to the medium, cells differentiated into odontoblast cells. 4.3. Co-culture assays TG explants were then co-cultured with semaphorin 7Atransfected COS cells in three-dimensional collagen gel as recently described (Maurin et al., 2004). Briefly, COS cells were transiently transfected with a soluble Myc-tagged SEMA7A encoding vector (from Exelixis Inc., South San Francisco, CA) at approximately 80% confluency using Lipofectamine 2000, according to the manufacturer’s instruction (Invitrogen). One day old Sprague – Dawley rat pups were decapitated and the TG were exposed. After removal of meningeal coverings, the TGs were cut out and rinsed with Opti-MEM medium (Invitrogen). TG explants
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
237
Table 1 RT-PCR primer characteristics Primers
Sequences
Annealing temperature (-C)
Fragment size (bp)
Semaphorin 7A h1-integrin GAPDH
5¶ CTGGATAAGCGGGACTGCGAG 3¶ GCTGCCACCAACAAGAACTTCA 5¶ AAAGGAGAAAAGAAAGACAC 3¶ ACTGTTGGTTCTATTTTACG 5¶ ACCACAGTCCATGCCATCAC 3¶ TCCACCACCCTGTTGCTGTA
59 49 59
541 153 450
were put down at 1 –3 mm from the peripheral zone of the culture and then trigeminal explant and COS cells were embedded in 100 Al of collagen (Institut Jacques Boy, Reims, France). Cultures were incubated at 37 -C in a humidified atmosphere of 5% CO2. After 2 days, they were fixed in 4% paraformaldehyde-PBS 0.1 M pH 7,4 for 30 min at 4 -C. Controls were also performed with COS transfected cells with an empty pSecTag. Experiments were performed in triplicate. 4.4. Preparation of RNA Total RNA from rat trigeminal ganglion, cultured odontoblasts and COS cells were obtained with the NucleoSpin RNA II kit and protocol (Macherey-Nagel, Du¨ren, Germany). 4.5. RT-PCR (Reverse transcription-polymerase chain reaction) RT-PCR experiments were performed on 100 ng of template RNA by using Titan one tube RT-PCR system (Roche Diagnostic), under the following conditions: incubation at 50 -C for 30 min, 35 cycles of denaturation at 94 -C for 30 s, annealing with specific primers (see Table 1) for 30 s, extension at 68 -C for 45 s, followed by a final extension step at 68 -C for 7 min. For comparison of the SEMA 7A expression between transfected COS cells and control COS cells, a housekeeping gene was coamplified to control the equal amounts of template RNA. The PCR products were run on agarose gel electrophoresis using NuSieve 3 : 1 agarose (FMC Bioproducts, Rockland, ME) and visualized with ethidium bromide (1 mg/ml). PCR amplification specificity was confirmed by enzymatic restriction. 4.6. Antibodies Immunochemistry studies were performed using monoclonal mouse antibodies against CDw108 (Sema 7A) (1 : 50; Chemicon International Inc., Temecula, CA), or polyclonal rabbit antibodies against neurofilament H (200 kDa) (1 : 200; Chemicon) and h1-integrin (M-106) (1 : 50; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). 4.7. Immunohistochemistry For immunostaining with anti-CDw108 and anti-neurofilament antibodies, sections were incubated overnight before
being revealed with a biotinylated antibody (Vector Laboratories, Burlingame, CA) and a streptavidin-Cy3 complex (1 : 6000) (Molecular Probes Inc, Eugene, OR) for 30 min. Odontoblast and COS cell cultures were fixed with 4% paraformaldehyde– 0.05% saponin in PBS for 30 min at 4 -C. After rinsing in 0.05% saponin-PBS containing 0.1 M lysine-HCl, they were treated for 30 min in PBS-0.05% saponin-2% NGS (Normal goat serum). They were incubated overnight with anti-CDw108 antibody and revealed as described above for tissue sections. Some others were directly incubated with anti-CDw108 antibody without permeabilization. To control the synthesis of a stable protein product, COS cell cultures were labeled with anti-Myc antibodies (1 / 500) (Invitrogen). For double-staining, dental pulp section samples were treated for 30 min in PBS-0.05% saponin-2% NGS and incubated overnight with anti-CDw108 and anti-neurofilament H antibodies. They were revealed with a biotinylated antibody (Vector laboratories), and a streptavidin-Cy3 complex (1 : 6000) (Molecular Probes Inc.) for 30 min. Samples were then incubated for 1 h with a conjugated goat anti-rabbit IgG Alexa fluor 488 (1 : 1000) (Molecular Probes Inc.). Control sections were systematically processed simultaneously in which primary antibody was replaced with PBS (Phosphate buffered saline). Check experiments of the COS cell SEMA 7A expression, were carried out with the antiCDw108 antibodies on non-transfected COS cells cultures or by omitting the primary antibody on SEMA 7A transfected COS cell cultures.
Acknowledgements We acknowledge the staff of the ‘‘Service de Stomatologie de l’Hoˆpital Saint-Joseph’’ Lyon for collecting tooth samples. This work has received a technical support from the Centre Commun d’ imagerie (CeCIL), IFR 62, Lyon and was supported by the ‘‘Ministe`re de l’Education Nationale’’ (EA 1892-IFR62). Finally we are grateful to Dr. Lee Pape for grammatical review of the manuscript.
References Buchaille, R., Couble, M.L., Magloire, H., Bleicher, F., 2000. A substractive PCR-based cDNA library from human odontoblast cells: identification of novel genes expressed in tooth forming cells. Matrix Biol. 19, 421 – 430. Byers, M.R., 1984. Dental sensory receptors. Int. Rev. Neurobiol. 25, 39 – 94.
238
J.-C. Maurin et al. / Matrix Biology 24 (2005) 232 – 238
Couble, M.L., Farges, J.C., Bleicher, F., Perrat-Mabillon, B., Boudeulle, M., Magloire, H., 2000. Odontoblast differentiation of human dental pulp cells in explant cultures. Calcif. Tissue Int. 66, 129 – 138. Fiore, R., Puschel, A.W., 2003. The function of semaphorins during nervous system development. Front. Biosci. 8, s484 – s499. Fritz, B.A., Lowe, A.W., 1996. Polarized GP2 secretion in MDCK cells via GPI targeting and apical membrane restricted proteolysis. Am. J. Physiol. 270, 176 – 183. Holmes, S., Downs, A.M., Fosberry, A., Hayes, P.D., Michalovich, D., Murdoch, P., Moores, K., Fox, J., Deen, K., Pettman, G., Wattam, T., Lewis, C., 2002. Sema7A is a potent monocyte stimulator. Scand. J. Immunol. 56, 270 – 275. Kahl, S., Nissen, M., Girisch, R., Duffy, T., Leiter, E.H., Haag, F., KochNolte, F., 2000. Metalloprotease-mediated shedding of enzymatically active mouse ecto-ADP-ribosyltransferase ART2.2 upon T cell activation. J. Immunol. 165, 4463 – 4469. Lillesaar, C., Fried, K., 2004. Neurites from trigeminal ganglion explants grown in vitro are repelled or attracted by tooth-related tissues depending on developmental stage. Neuroscience 125, 149 – 161. Lillesaar, C., Eriksson, C., Johansson, C.S., Fried, K., Hildebrand, C., 1999. Tooth pulp tissue promotes neurite outgrowth from rat trigeminal ganglia in vitro. J. Neurocytol. 28, 663 – 670. Lillesaar, C., Eriksson, C., Fried, K., 2001. Rat tooth pulp cells elicit neurite growth from trigeminal neurones and express mRNAs for neurotrophic factors in vitro. Neurosci. Lett. 308, 161 – 164. Loes, S., Kettunen, P., Kvinnsland, I.H., Taniguchi, M., Fujisawa, H., Luukko, K., 2001. Expression of class 3 semaphorins and neuropilin receptors in the developing mouse tooth. Mech. Dev. 101, 191 – 194. Luukko, K., 1998. Neuronal cells and neurotrophins in odontogenesis. Eur. J. Oral Sci. 106 (Suppl 1), 80 – 93. Luuko, K., Aruma¨e, U., Karavanov, A., Moshnyakov, M., Sainio, K., Sariola, H., Saarma, M., Thesleff, I., 1997. Neurotrophin m RNA expression in the developing tooth suggests multiple roles in innervation and organogenesis. Dev. Dyn. 210, 117 – 129. Maurin, J.C., Couble, M.L., Didier-Baze`s, M., Brisson, C., Magloire, H., Bleicher, F., 2004. Expression and localization of reelin in human odontoblasts. Matrix Biol. 23, 277 – 285. Mitsiadis, T.A., Dicou, E., Joffre, A., Magloire, H., 1992. Immunohistochemical localization of nerve growth factor (NGF) and NGF receptor (NGF-R) in the developing first molar tooth of the rat. Differentiation 49, 47 – 61. Naftel, J.P., Qian, X.B., Bernanke, J.M., 1994. Effects of postnatal antinerve growth factor serum exposure on development of apical nerves of the rat molar. Brain Res. Dev. Brain Res. 80, 54 – 62.
Nosrat, C.A., Tomac, A., Lindqvist, E., Lindskog, S., Humpel, C., Stromberg, I., Ebendal, T., Hoffer, B.J., Olson, L., 1996. Cellular expression of GDNF mRNA suggests multiple functions inside and outside the nervous system. Cell Tissue Res. 286, 191 – 207. Nosrat, C.A., Fried, K., Lindskog, S., Olson, L., 1997. Cellular expression of neurotrophin mRNAs during tooth development. Cell Tissue Res. 290, 569 – 580. Nosrat, C.A., Fried, K., Ebendal, T., Olson, L., 1998. NGF, BDNF, NT3, NT4 and GDNF in tooth development. Eur. J. Oral Sci. 106 (Suppl 1), 94 – 99. Nosrat, I.V., Widenfalk, J., Olson, L., Nosrat, C.A., 2001. Dental pulp cells produce neurotrophic factors, interact with trigeminal neurons in vitro, and rescue motoneurons after spinal cord injury. Dev. Biol. 238, 120 – 132. Ohnishi, H., Kobayashi, H., Okazawa, H., Ohe, Y., Tomizawa, K., Sato, R., Matozaki, T., 2004. Ectodomain shedding of SHPS-1 and its role in regulation of cell migration. J. Biol. Chem. 279, 27878 – 27887. Palosaari, H., Ding, Y., Larmas, M., Sorsa, T., Barlett, J.D., Salo, T., Tja¨derhane, L., 2002. Regulation and interaction of MT-1-MMP and MMP-20 in human odontoblasts and pulp tissue in vitro. J. Dent. Res. 81, 354 – 359. Palosaari, H., Pennington, C.J., Larmas, M., Edwards, D.R., Tja¨derhane, L., Salo, T., 2003. Expression profile of matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs in mature human odontoblasts and pulp tissue. Eur. J. Oral Sci. 111, 1 – 11. Pasterkamp, R.J., Peschon, J.J., Spriggs, M.K., Kolodkin, A.L., 2003. Semaphorin 7A promotes axon outgrowth through integrins and MAPKs. Nature 424, 398 – 405. Sarram, S., Lee, K.F., Byers, M.R., 1997. Dental innervation and CGRP in adult p75-deficient mice. J. Comp. Neurol. 385, 297 – 308. Tamagnone, L., Artigiani, S., Chen, H., He, Z., Ming, G.I., Song, H., Chedotal, A., Winberg, M.L., Goodman, C.S., Poo, M., TessierLavigne, M., Comoglio, P.M., 1999. Plexins are a large family of receptors for transmembrane, secreted, and GPI-anchored semaphorins in vertebrates. Cell 99, 71 – 80. Ulupinar, E., Datwani, A., Behar, O., Fujisawa, H., Erzurumlu, R., 1999. Role of semaphorin III in the developing rodent trigeminal system. Mol. Cell. Neurosci. 13, 281 – 292. Xu, X., Ng, S., Wu, Z.L., Nguyen, D., Homburger, S., Seidel-Dugan, C., Ebens, A., Luo, Y., 1998. Human semaphorin K1 is glycosylphosphatidylinositol-linked and defines a new subfamily of viral-related semaphorins. J. Biol. Chem. 273, 22428 – 22434. Yoshikawa, S., Thomas, J.B., 2004. Secreted cell signaling molecules in axon guidance. Curr. Opin. Neurobiol. 14, 45 – 50.