- Email: [email protected]
Oesophagostomum dentatum and Oesophagostomum quadrispinulatum: Characterization of the complete mitochondrial genome sequences of the two pig nodule worms
Experimental Parasitology 131 (2012) 1–7
Contents lists available at SciVerse ScienceDirect
Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr
Oesophagostomum dentatum and Oesophagostomum quadrispinulatum: Characterization of the complete mitochondrial genome sequences of the two pig nodule worms Rui-Qing Lin a,b,1, Guo-Hua Liu a,c,1, Min Hu d, Hui-Qun Song a, Xiang-Yun Wu e, Ming-Wei Li f, Yuan Zhang b, Feng-Cai Zou g, Xing-Quan Zhu a,c,g,⇑ a State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province 730046, PR China b College of Veterinary Medicine, South China Agricultural University, Guangzhou, Guangdong Province 510642, PR China c College of Veterinary Medicine, Hunan Agricultural University, Changsha, Hunan Province 410128, PR China d State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei Province 430070, PR China e Laboratory of Marine Bio-resources Sustainable Utilization, South China Sea Institute of Oceanology, Guangzhou, Guangdong Province 510301, PR China f Agricultural College, Guangdong Ocean University, Zhanjiang, Guangdong Province 524088, PR China g College of Animal Science and Technology, Yunnan Agricultural University, Kunming, Yunnan Province 650201, PR China
a r t i c l e
i n f o
Article history: Received 27 December 2011 Received in revised form 10 February 2012 Accepted 13 February 2012 Available online 6 March 2012 Keywords: Mitochondrial genome Mitochondrial DNA Gene organization Oesophagostomum dentatum Oesophagostomum quadrispinulatum
a b s t r a c t In the present study, the complete mitochondrial DNA (mtDNA) sequences of the pig nodule worm Oesophagostomum quadrispinulatum were determined for the first time, and the mt genome of Oesophagostomum dentatum from China was also sequenced for comparative analysis of their gene contents and genome organizations. The mtDNA sequences of O. dentatum China isolate and O. quadrispinulatum were 13,752 and 13,681 bp in size, respectively. Each of the two mt genomes comprises 36 genes, including 12 protein-coding genes, two ribosomal RNA and 22 transfer RNA genes, but lacks the ATP synthetase subunit 8 gene. All genes are transcribed in the same direction and have a nucleotide composition high in A and T. The contents of A + T are 75.79% and 77.52% for the mt genomes of O. dentatum and O. quadrispinulatum, respectively. Phylogenetic analyses using concatenated amino acid sequences of the 12 proteincoding genes, with three different computational algorithms (maximum likelihood, maximum parsimony and Bayesian inference), all revealed that O. dentatum and O. quadrispinulatum represent distinct but closely-related species. These data provide novel and useful markers for studying the systematics, population genetics and molecular diagnosis of the two pig nodule worms. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Parasitic nematodes belonging to the genus Oesophagostomum are commonly known as ‘nodule’ worms of ruminants, pigs and primates. They can cause serious clinical diseases (e.g., oesophagostomiasis) in these hosts (McCarthy and Moore, 2000; Legesse and Erko, 2004; Weng et al., 2005; Krief et al., 2010). Human oesophagostomiasis is a serious public health problem in northern Togo and Ghana (McCarthy and Moore, 2000; Verweij et al., 2001). Oesophagostomum infection in pigs is quite common and has a global geographical distribution (Joachim et al., 2001; Weng et al.,
⇑ Corresponding author at: State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province 730046, PR China. Fax: +86 931 8340977. E-mail addresses: [email protected], [email protected] (X.-Q. Zhu). 1 These authors contributed equally to this work. 0014-4894/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2012.02.015
2005). A few species of Oesophagostomum have been found parasitizing pigs, but only two species, namely Oesophagostomum dentatum and Oesophagostomum quadrispinulatum were identified to be the main causative nodule worms (Cutillas et al., 1999; Lin et al., 2008). Meanwhile, O. dentatum was proposed as a potential model for genomic studies of strongylid nematodes (Gasser et al., 2007). Therefore, relevant studies on the biological, biochemical and molecular biological and genomic information of ‘nodule’ worms in pig would be of help for the control of oesophagostomiasis and diseases caused by other strongylid nematodes. The metazoan mitochondrial (mt) genomes, ranging in size from 14 to 18 kb, are typically circular and usually encode 36–37 genes, including 12–13 protein-coding genes, 22 transfer RNA genes, and two ribosomal RNA genes (Wolstenholme, 1992). Due to its maternal inheritance, rapid evolutionary rate, lack of recombination and relatively conserved genome structures, mtDNA sequences have been widely used as genetic markers not only for studying the taxonomy, systematics and population genetics of
2
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7
animals, but also for phylogenetic and evolutionary analyses (Li et al., 2008; Catanese et al., 2010; Liu et al., 2011, 2012; Xie et al., 2011; Lin et al., 2011, 2012). In spite of significant advances in mt genomics, there are gaps in our knowledge of mt genomes for many groups of metazoan parasites. In the family Chabertiidae, the mt genomes of only two species, namely Chabertia ovina and O. dentatum, were sequenced (Jex et al., 2010). This lack of enough knowledge of mt genomics for parasitic nematodes in this family forms a major limitation for population genetic and phylogenetic studies of pathogens in this family including members of the genus Oesophagostomum. The objectives of the present study were to determine and analyze the mt genomes of the two pig nodule worms O. dentatum and O. quadrispinulatum, and to re-construct the phylogenetic relationships of members of the Chabertiidae using mtDNA sequences. 2. Materials and methods 2.1. Samples and DNA extraction One nodule worm representing O. dentatum used in the present study was from Daqing city, Heilongjiang Province, China, and one specimen representing O. quadrispinulatum was collected from Chongqing city, China. These specimens were obtained from the feces of slaughtered fatten pigs, washed in physiological saline, identified primarily based on morphological characters to species, fixed in 70% (v/v) ethanol and stored at 20 °C until use. Total genomic DNA was isolated from individual nematodes using sodium dodecyl-sulfate/proteinase K treatment, followed by spincolumn purification (Wizard Clean-Up, Promega). The identity of the specimen was confirmed as O. dentatum or O. quadrispinulatum by a multiplex PCR assay following protocols reported previously (Lin et al., 2008). 2.2. Long-PCR amplification and sequencing Based on the partial sequences of mt cytochrome c oxidase subunit (cox1) and NADH dehydrogenase subunit 1 (nad1) genes available in GenBank (Accession Nos. FM161897–FM161886 and FM163322–FM163311, respectively), primers (Table 1) were designed in the conserved regions to amplify the entire mt genome of each species in two overlapping long fragments. PCR reactions (50 lL) were performed in 2.5 mM MgCl2, 0.4 mM each of dNTPs, 5 lL 10 LA Taq buffer, 0.5 lM of each primer, 2.5 U rTaq polymerase (Takara) and 2 lL of DNA sample in a thermocycler (Biometra) under the following conditions: 92 °C for 2 min (initial denaturation), then 92 °C for 10 s (denaturation), 50 °C for 30 s (annealing), and 60 °C for 10 min (extension) for five cycles, followed by 92 °C for 10 s, 50 °C for 30 s, and 66 °C for 10 min for 25 cycles, and a final extension at 66 °C for 10 min. Samples without DNA (no-DNA controls) were included in each amplification run, and in no case were amplicons detected in the no-DNA controls (data not shown). Each amplicon (3 lL) was examined by agarose (0.8%) gel electrophoresis, stained with ethidium bromide and photographed using a gel documentation system (UVItec). PCR products were sent to Sangon Company (Shanghai, China) for sequencing using a primer walking strategy. 2.3. Sequence analyses Sequences were assembled manually and aligned against the complete mt genome sequences of Ancylostoma duodenale (GenBank Accession No. NC_003415) and O. dentatum (Denmark isolate, GenBank Accession No. GQ888716) available using the computer program Clustal X 1.83 to identify gene boundaries (Thompson
Table 1 Sequences of primers used to amplify long-PCR fragments from two Oesophagostomum species. Name of primer
Sequence (50 to 30 )
For O. dentatum ODmtNAD1F ODmtCOX1R ODmtCOX1F ODmtNAD1R
TAGTTATGATTATTGCTGAG ATAAAACCTAACACCCAC TTCTCGTGCTTATTTTAC AAACTCCCATATTCACTT
For O. quadrispinulatum OQmtNAD1F OQmtCOX1R OQmtCOX1F OQmtNAD1R
TTTATAGGTGTATTACAAGCRTT CAGTAAAATAAGCACGAGAATC ACAGTGGGTATGGATTTA AAAAGAAACACCTGGAAC
et al., 1997). The open-reading frames and codon usage profiles of protein-coding genes were analyzed using the program MacVector 4.1.4 (Kodak, version4.0). Gene annotation, genome organization, translation initiation, translation termination codons and the boundaries between protein-coding genes of mt genomes of the two Oesophagostomum species were identified based on comparison with mt genomes of other nematodes reported previously (Hu et al., 2002a; Jex et al., 2010). The amino acid sequences inferred for the mt genes of the two Oesophagostomum species were aligned with those of other nematodes by using Clustal X 1.83. Based on pair-wise alignments, amino acid identity (%) was calculated for homologous genes. Codon usage was examined based on the relationships between the nucleotide composition of codon families and amino acid occurrence, and the genetic codons are grouped into AT rich codons, GC-rich codons and unbiased codons. For analyzing ribosomal RNA genes, putative secondary structures of 22 tRNA genes were identified using tRNAscan-SE (Lowe and Eddy, 1997), or by recognizing potential secondary structures and anticodon sequences by eye by aligning mtDNA sequences of O. dentatum and O. quadrispinulatum. 2.4. Phylogenetic analyses Phylogenetic relationship among representative members of the orders Rhabditida and Strongylida (Table 2), plus the two mtDNA sequences obtained in the present study, were performed, using an Enoplean species Trichinella spiralis (GenBank Accession No. NC_002681) as the outgroup, based on amino acid sequences of 12 protein-coding genes. Each gene was translated into amino acid sequence using the invertebrate mitochondrial genetic code in MEGA 5.0 (Tamura et al., 2011), and aligned based on its amino acid sequence using default settings, and ambiguously aligned regions were excluded using Gblocks online server (http://molevol.cmima.csic.es/castresana/Gblocks_server.html) (Talavera and Castresana, 2007), using the options for a more stringent selection. The final amino acid sequences of the 12 protein-coding genes were then concatenated into single alignments for phylogenetic analyses. Three methods, namely, maximum likelihood (ML), maximum parsimony (MP) and Bayesian inference (Bayes), were employed for phylogenetic re-constructions. ML analyses were performed using PhyML 3.0 (Guindon and Gascuel, 2003), and the mtREV model with its parameter for the concatenated dataset was determined for the ML analysis using ProtTest based on the Akaike information criterion (AIC) (Abascal et al., 2005). Bootstrap support for ML trees was calculated using 100 bootstrap replicates. MP analysis was performed using PAUP 4.0 Beta 10 programme (Swofford, 2002), with indels treated as missing character states. A total of 1000 random addition searches using TBR were performed for each MP analysis. Bootstrap probability (BP) was calculated from 1000 bootstrap replicates with 10 random additions per
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7
3
Table 2 Mitochondrial genome sequences of representative nematodes used for phylogenetic studies. Species
The size of mtDNA (bp)
GenBank™Accession Nos.
Trichinella spiralis Ancylostoma duodenale Ancylostoma caninum Bunostomum phlebotomum Caenorhabditis elegans Angiostrongylus costaricensis Angiostrongylus cantonensis Haemonchus contortus Cooperia oncophora Chabertia ovina Cylicocyclus insignis Mecistocirrus digitatus Strongylus vulgaris Syngamus trachea Teladorsagia circumcincta Trichostrongylus axei Trichostrongylus vitrinus Oesophagostomum dentatum (Denmark isolate)
16,706 13,721 13,717 13,790 13,794 13,585 13,497 14,055 13,636 13,682 13,828 15,221 14,301 14,647 14,066 13,653 13,800 13,869
NC_002681 NC_003415 FJ483518 FJ483517 NC_001328 NC_013067 NC_013065 NC_010383 NC_004806 NC_013831 NC_013808 NC_013848 NC_013818 NC_013821 NC_013827 NC_013824 NC_013807 GQ888716
replicate in PAUP. Bayesian analyses were conducted with four independent Markov chains run for 1,000,000 metropolis-coupled MCMC generations, sampling a tree every 100 generations in MrBayes 3.1.1 (Ronquist and Huelsenbeck, 2003). The first 2500 trees were omitted as burn-in and the remaining trees were used to calculate Bayesian posterior probabilities (PP). Phylograms were drawn using the Tree View program version 1.65 (Page, 1996).
Fig. 1. Arrangement of the mitochondrial genome of Oesophagostomum dentatum and O. quadrispinulatum. Gene scaling is only approximate. All genes are coded by the same DNA strand and are transcribed clockwise. All genes have standard nomenclature except for the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the two leucine- and serine- specifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families AGN and UCN, respectively). NC1– NC3 refer to non-coding regions.
3. Results and discussion 3.1. General features of the mt genome of the two Oesophagostomum species The complete mitochondrial genomes of O. dentatum China isolate and O. quadrispinulatum are 13,752 and 13,681 bp in size, respectively (Fig. 1). The mt genome of the O. dentatum China isolate was significantly shorter (117 bp) than that of the O. dentatum Denmark isolate. These mt genome sequences have been deposited in the GenBank under the Accession Nos. FM161882 (O. dentatum, China isolate) and FM161883 (O. quadrispinulatum). Both mt genomes contain 12 protein-coding genes (cox1–3, nad1–6, nad4L, atp6 and cytb), 22 transfer RNA genes, two ribosomal RNA genes and three non-coding regions, but lacking an atp8 gene (Table 3). All genes are predicted to be transcribed in the same direction, and the mt genome arrangement of the O. dentatum and O. quadrispinulatum are the same as that of Chabertia ovina, Cylicocyclus insignis, Strongylus vulgaris, A. duodenale and N. americanus (see Hu et al., 2002a; Jex et al., 2010), and similar to that of Caenorhabditis elegans, Cooperia oncophora and Ascaris suum, except for its number of non-coding regions (Okimoto et al., 1992; Van der Veer and de Vries, 2004). Comparison of gene orders with other namatodes indicated that O. dentatum and O. quadrispinulatum were more closely related to C. ovina and C. insignis than to C. elegans and C. oncophora, consistent with results of previous phylogenetic studies (Gouÿ de Bellocq et al., 2001; Jex et al., 2010). The nucleotide compositions of the entire mtDNA sequences for O. dentatum and O. quadrispinulatum are biased towards A and T, with T being the most common nucleotide and C the least favored, in accordance with mt genomes of other nematodes sequenced to date, such as that of C. ovina, C. insignis and S. vulgaris. The content of A + T is 75.79% for O. dentatum China isolate (28.69% A, 47.10% T, 16.96% G and 7.24% C), 77.74% for O. dentatum Denmark isolate
(28.63% A, 47.11% T, 17.07% G and 7.17% C), and 77.52% for O. quadrispinulatum (30.71% A, 46.80% T, 15.23% G and 7.26% C), respectively.
3.2. Protein genes and codon usage patterns The initiation and termination codon sequences of the 12 protein-coding genes of the two Oesophagostomum species sequenced in the present study were inferred by comparing their sequences with those of C. ovina. The inferred nucleotide and amino acid sequences for each of the 12 mt protein genes of O. dentatum China isolate and O. quadrispinulatum were compared with those of O. dentatum Denmark isolate, C. ovina, C. insignis, S. vulgaris, A. duodenale, N. americanus, C. elegans and C. oncophora. The identity of the 12 amino acid sequences is 91.7–99.6% between O. dentatum China isolate and O. quadrispinulatum, 99.9–100% between O. dentatum China isolate and O. dentatum Denmark isolate, respectively. A total of 3419 amino acids are encoded by the O. dentatum China isolate and O. quadrispinulatum mt genomes. The most common start codon for two Oesophagostomum species is ATT (8 for O. quadrispinulatum and 9 for O. dentatum of 12 protein genes), followed by TTG (two of 12 protein genes for two Oesophagostomum species) and ATA (two of 12 protein genes for O. quadrispinulatum, one for O. dentatum) (Table 3). Ten of the 12 protein genes were predicted to have a TAA or TAG translation termination codon. The remaining protein genes were inferred to end with an abbreviated stop codon T (Table 3). For the two Oesophagostomum species, the 30 -end of genes nad4L, atp6, nad2, cytb, cox3, cox1, cox2 and nad5 is immediately adjacent to a downstream trn gene (Table 1), which is consistent with the arrangement in A. duodenale and N. americanus, and 30 -end of genes nad1, nad3, nad4 and nad6 is adjacent to a downstream protein genes atp6, cox1, nad5 and nad4L, respectively,
4
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7
Table 3 Positions and nucleotide sequence lengths of mitochondrial genomes of Oesophagostomum dentatum and O. quadrispinulatum, anticodons, and initiation and termination codons (ITC) for protein-coding genes (starting from tRNA-Pro). Genes
tRNA-Pro (P) tRNA-Val (V) nad6 nad4L tRNA-Trp (W) tRNA-Glu (E) rrnS tRNA-SerUCN (S2) tRNA-Asn (N) tRNA-Tyr (Y) nad1 atp6 tRNA-Lys (K) tRNA-LeuUUR (L2) tRNA-SerAGN (S1) nad2 tRNA-Ile (I) tRNA-Arg (R) tRNA-Gln (Q) tRNA-Phe (F) cytb tRNA-LeuCUN (L1) cox3 tRNA-Thr (T) nad4 Non-coding region (NC1) cox1 tRNA-Cys (C) tRNA-Met (M) tRNA-Asp (D) tRNA-Gly (G) cox2 tRNA-His (H) rrnL nad3 Non-coding region (NC2) nad5 tRNA-Ala (A) Non-coding region (NC3)
Positions and nt sequence lengths (bp)
ITC
OdC
OdD
Oq
1–55 (55) 81–135 (55) 136–570 (435) 574–807 (234) 811–866 (56) 876–932 (57) 933–1632 (700) 1633–1688 (56) 1689–1745 (57) 1765–1821 (57) 1822–2694 (873) 2703–3302 (600) 3315–3377 (63) 3389–3443 (55) 3444–3496 (53) 3497–4342 (846) 4344–4402 (59) 4403–4457 (55) 4463–4517 (55) 4526–4581 (56) 4582–5694 (1113) 5695–5749 (55) 5750–6515 (766) 6516–6572 (57) 6573–7802 (1230) 7803–7906 (104) 7907–9484 (1578) 9485–9539 (55) 9540–9598 (59) 9608–9667 (60) 9678–9733 (56) 9734–10,429 (696) 10,430–10,484 (55) 10,485–11,450 (966) 11,451–11,786 (336) 11,787–11,868 (82) 11,869–13,450 (1582) 13,451–13,507 (57) 13,508–13,752 (245)
1–56 (56) 80–136 (57) 136–570 (435) 574–807 (234) 811–867 (57) 876–934 (59) 929–1628 (700) 1633–1690 (58) 1689–1746 (58) 1765–1822 (58) 1942–2814(873) 2823–3422 (600) 3435–3498 (64) 3509–3564 (56) 3564–3617 (54) 3617–4462 (846) 4464–4523(60) 4523–4578 (56) 4583–4638(56) 4646–4702 (57) 4702–5814(1113) 5815–5870 (56) 5870–6640 (771) 6636–6693 (58) 6693–7922 (1230) 7923–8025 (103) 8026–9603 (1578) 9604–9659 (56) 9659–9718 (60) 9727–9786 (60) 9797–9852 (56) 9852–10,547 (696) 10,548–10,603 (56) 10,607–11,565 (969) 11,568–11,903 (336) 11,904–11,984 (81) 11,985–13,566 (1582) 13,567–13,624 (58) 13,625–13,869 (245)
1–56 (56) 66–120 (55) 121–555 (435) 557–790 (234) 795–850 (56) 852–909 (58) 910–1608 (699) 1609–1662 (54) 1663–1718 (56) 1739–1794 (56) 1795–2667 (873) 2670–3269 (600) 3279–3341 (63) 3355–3409 (55) 3410–3462 (53) 3463–4308 (846) 4314–4372 (59) 4373–4427 (55) 4434–4488 (55) 4489–4544 (56) 4545–5657 (1113) 5658–5713(56) 5714–6479 (766) 6480–6534 (55) 6535–7764 (1230) 7765–7857 (93) 7858–9435 (1578) 9436–9489 (54) 9498–9556 (59) 8560–9617 (58) 9633–9688 (56) 9689–10,384 (696) 10,385–10,439 (55) 10,440–11,401 (962) 11,402–11,737 (336) 11,738–11,815 (78) 11,816–13,397 (1582) 13,398–13,453 (56) 13,454–13,681 (228)
OdC/OdD
Anticodons Oq
OdC/OdD/Oq TGG TAC
ATT/TAA ATT/TAA
ATT/TAG ATT/TAA TCA TTC TGA GTT GTA
ATA/TAG ATT/TAA
ATT/TAA ATT/TAG TTT TAA TCT
TTG/TAG
TTG/TAA GAT ACG TTG GAA
ATT/TAA
ATT/TAA
ATT/T
ATA/T
TTG/TAA
TTG/TAA
ATT/TAA
ATT/TAA
TAG TGT
GCA CAT GTC TCC ATT/TAA
ATA/TAA GTG
ATT/TAA
AAT/TAG
ATT/T
ATT/T TGC
OdC, Oesophagostomum dentatum China isolate; OdD, Oesophagostomum dentatum Denmark isolate; Oq, Oesophagostomum quadrispinulatum.
but there are inter spaces (non-coding regions) between two protein genes. Incomplete stop codons (TA and T) are common for the mt protein genes of animals (Wolstenholme, 1992). Both the nad5 and cox3 genes of the two Oesophagostomum species terminate in T, and are followed by tRNA-Ala and tRNA-Thr genes, respectively. In the protein-coding genes of the two nodule-worms, the 62 possible codons were used, and the most frequently used codon was TTT (Phe) while the least used codons were CGA (Arg), TGC (Cys) and CTC (Leu), and codons CGC and CGG were not used. The preferred usage of synonymous codons is proposed to be highest in gene regions of functional significance, codon bias is believed to be related mainly to selection at silent sites and thought to maximize translation efficiency (Sharp and Matassi, 1994; Durent and Mouchiroud, 1999). At the third codon position of nodule-worm mt protein genes, T is the most frequently used, and C the least frequently used. It is believed that the bias toward using amino acids relates to the ‘mutational bias-translational selection’ paradigm (Romero et al., 2000), meaning that both mutation and selection have an affect on the bias in codon usage, but it is unclear whether this plays a role in animal mitochondrial systems (Helfenbein et al., 2001). The protein-coding genes of the two nodule-worm genomes are biased toward using amino acids encoded by T-, A- and G-rich codons. The AT-rich codons represent amino acids Phe, Ile, Met, Tyr,
Asn or Lys, and the GC-rich codons represent Pro, Ala, Arg or Gly. Trich codons (more than two Ts in a triplet) comprise Phe (12.6% TTT and 0.5% TTC), Leu (8.7–11.1% TTA, 3.2–6.0% TTG, and 0.3% CTT), Ile (7.3–7.8% ATT), Val (3.4–4.1% GTT), Tyr (4.9–5.0% TAT), Ser (3.1–3.4% TCT), and Cys (1.2% TGT), and account for approximately half (48.1–49.1%) of the total amino acid composition. Aand G-rich codons (with P2 As and Gs, respectively) represent 15.5–17.1% and 8.1–8.7% of the total amino acid composition, respectively (data not shown). In contrast, the proportion of C-rich codons (with P2 Cs) is much lower (3.1–3.3%). This result showed that the genome sequences of O. dentatum or O. quadrispinulatum favor T, A and G, but are strongly biased against C. A previous study (Singer and Hickey, 2000) indicated that nucleotide bias can cause a genome wide bias in the amino acid composition of protein. 3.3. Transfer RNA genes and ribosomal RNA genes Twenty-two trn gene sequences (ranging from 53 to 63 bp in size, see Table 3) were identified in the mt genomes of the two nodule worms and were predicted to fold into putative secondary structures (not showed), which were similar to those of other nematode mtDNA sequences (Keddie et al., 1998; Hu et al., 2002b, 2003a, 2003b), with the exception of that of T. spiralis (Lavrov and Brown, 2001). Common features of the predicted secondary structures of the 22 tRNA genes in O. dentatum China isolate and
5
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7
Table 4 Comparison of A + T content (%) of the AT region, protein-coding and rRNA genes of Oesophagostomum mitochondrial genomes with that of other representative nematode species. Genes
OdC
OdD
Oq
Cov
Sv
Ci
Ad
Na
Co
Ce
Ov
Di
Ss
As
atp6 cox1 cox2 cox3 cytb nad1 nad2 nad3 nad4 nad4L nad5 nad6 rrnS rrnL AT region Emt G
75.5 69.8 72.0 73.2 73.8 74.2 79.4 76.8 76.8 78.6 75.7 75.6 75.9 80.3 84.1 75.8
75.5 69.7 72.3 72.8 73.8 72.9 79.3 76.9 76.5 79.1 76.2 76.8 76.0 80.5 84.0 75.7
78.0 72.2 73.0 73.5 75.7 75.6 83.3 79.5 79.5 79.5 78.2 78.4 76.7 81.7 85.5 77.5
74.8 69.7 72.8 73.5 73.2 73.3 81.2 80.4 77.1 78.5 77.3 78.4 76.7 80.6 83.8 76.3
76.4 70.8 72.7 73.6 74.0 73.4 78.9 78.4 79.0 79.5 78.4 78.6 76.3 81.2 92.9 76.5
75.50 69.65 72.56 72.43 72.42 73.20 81.44 75.00 79.02 82.48 77.84 80.92 76.86 82.59 83.20 76.6
77.8 74.0 69.3 70.8 74.3 74.1 81.2 78.3 78.5 80.3 77.1 79.3 76.6 81.1 90.1 76.7
75.9 74.3 69.5 72.0 73.9 74.0 80.5 79.2 79.0 80.3 79.3 77.7 75.3 81.4 83.2 76.6
77.0 70.8 72.0 72.6 73.4 72.1 80.8 79.3 79.8 80.8 79.1 79.2 75.6 82.2 85.5 76.8
76.0 73.8 70.3 74.1 72.0 74.6 80.0 78.5 77.7 81.6 77.3 80.0 73.7 79.0 93.1 76.2
73.0 72.9 67.0 69.2 71.8 70.0 74.3 76.4 73.2 78.6 72.9 79.1 78.9 77.0 85.3 73.3
71.9 67.9 69.2 71.8 72.3 72.9 74.4 77.2 74.6 77.4 73.8 80.6 75.8 79.6 85.9 74.2
78.4 72.7 72.6 75.5 75.9 73.9 81.3 78.3 76.6 82.9 79.6 82.1 69.5 77.5 85.0 76.6
71.6 68.4 66.7 68.8 70.4 69.5 73.0 73.8 71.0 76.5 72.9 72.6 71.9 76.8 84.7 71.9
OdC, Oesophagostomum dentatum China isolate; OdD, Oesophagostomum dentatum Denmark isolate; Oq, Oesophagostomum quadrispinulatum; Cov, Chabertia ovina; Sv, Strongylus vulgaris; Ci, Cylicocyclus insignis; Ad, Ancylostoma duodenale; Na, Necator americanus; Co, Cooperia oncophora; Ce, Caenorhabditis elegans; Ov, Onchocerca volvulus; Di, Dirofiliria immitis; Ss, Strongyloides stercoralis; As, Ascaris suum; EmtG, entire mitochondrial genome.
O. quadrispinulatum mt genomes differ from the conventional cloverleaf-like structures found in other metazoan mtDNA molecules, in accordance with other nematodes. The putative secondary structures usually have a TV replacement loop of 6–12 bp with some exceptions. The exceptions are trnS1 (AGN) and trnS2 (UCN) in which the DHU-arm is lacking. The mt trnS for two nodule worms possesses a secondary structure consisting of a DHU replacement loop of 4–6 bp, a 3 bp TWC arm, a TWC loop of 4–7 bp and a variable loop of 4 bp, in accordance with other members of the class Secernentea (Okimoto et al., 1992; Keddie et al., 1998), but distinct from T. spiralis. The rrnS and rrnL genes of the two nodule-worm species were identified by sequence comparison with those of C. ovina. The rrnS is located between tRNA-Glu and tRNA-SerUCN, and rrnL is located between tRNA-His and nad3. The size of the rrnS gene is 700 bp for both O. dentatum China isolate and Denmark isolate, and 699 bp for O. quadrispinulatum. The size of the rrnL gene is 966 bp for O. dentatum China isolate, 959 bp for O. dentatum Denmark isolate and 962 bp for O. quadrispinulatum. The A + T contents of the rrnS for O. dentatum China isolate, O. dentatum Denmark isolate and O. quadrispinulatum are 75.9%, 76.0% and 76.7%, and those of the rrnL are 80.3%, 80.5% and 81.7%, respectively (Table 4). Sequence identity in the rrnS and rrnL genes are 93.8% and 91.6% between O. dentatum China isolate and O. quadrispinulatum. Sequence identity in the rrnS and rrnL genes are 99.9% and 98.5% between O. dentatum China isolate and O. dentatum Denmark isolate. 3.4. Non-coding regions In the mt genomes of the two pig nodule worms, the longest non-coding region (NC3) is located between the trnA and trnP. Their sizes are 245 bp for both O. dentatum China isolate and Denmark isolate, and 228 bp for O. quadrispinulatum, which are much shorter than that in A. suum. The AT content are 84.1% for O. dentatum China isolate, 84.9% for O. dentatum Denmark isolate, and 85.5% for O. quadrispinulatum, which are almost the same level comparing with that of genomes of other rhabditid nematodes studied to date. Six and four pairs of inverted AT dinucleotides repeat sequence tracts were identified in O. dentatum and O. quadrispinulatum, respectively. For the two pig nodule-worm species, the second longest noncoding region (NC1) is located between nad4 and cox1 genes, as in the mt genomes of A. duodenale and N. americanus and ascaridoid nematodes A. suum and A. simplex (Okimoto et al., 1992). Its
length is 104 bp (O. dentatum China isolate) and 103 (O. dentatum Denmark isolate) or 93 bp (O. quadrispinulatum), with an AT content of 84.6%, 84.5%, and 87.1%, respectively. The non-coding regions for the two Oesophagostomum species could form a hairpin loop structure (TAAAATTTTTA), which is similar to that of the hookworm N. americanus. Whether this region has the potential to initiate the synthesis of the second (L) strand of mtDNA is unknown. In some cases, where protein genes are adjacent to one another, stem-and-loop structures may form which, when transcribed, may serve as alternative signals for RNA processing enzymes (Boore and Brown, 1994). Like hookworms A. duodenale and N. americanus, a third noncoding region was identified for the two nodule worms between nad3 and nad5 genes (82 bp for O. dentatum China isolate and 81 bp for O. dentatum Denmark isolate, and 78 bp for O. quadrispinulatum), with an AT content of 82.9%, 82.7% and 82.1%, respectively. For the two pig nodule worms, the sequence could not be folded into a stem-and-loop secondary structure, as described for the same non-coding region of N. americanus. Except for the noncoding sequences described above, there are a few short sequences (the longest is 25 bp) among tRNA genes. In mammalian mitochondria, portions of the trns in polycistronic transcripts are thought to serve as RNA processing signals (Ojala et al., 1981). 3.5. Phylogenetic analyses The final alignment of the amino acid sequences of 12 proteincoding genes for 18 nematode species of the Rhabditida and Strongylida was subjected to ML, MP and Bayes analyses using T. spiralis as the outgroup. ML, MP and Bayes analyses yielded similar tree topologies (Fig. 2). Based on the phylogenetic trees, the two pig Oesophagostomum species were clustered together, indicating that O. dentatum and O. quadrispinulatum represent distinct but closely-related species. Oesophagostomum were sister to C. ovina, which is in agreement with a previous phylogenetic study of nematodes based on 28S rDNA sequence data (Gouÿ de Bellocq et al., 2001). In conclusion, the present study determined the complete mtDNA sequences of O. quadrispinulatum for the first time, obtained the complete mtDNA sequences of O. dentatum from China and revealed their gene annotations and genome organizations. Phylogenetic analysis using concatenated amino acid sequences of the 12 mt protein-coding genes indicated that O. dentatum and O. quadrispinulatum represent distinct but closely-related species.
6
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7
Fig. 2. Inferred phylogenetic relationships among representative nematode parasites of the orders Rhabditida and Strongylida based on amino acid sequences of 12 mitochondrial protein-coding genes using Trichinella spiralis (GenBank Accession No. NC_002681) as the out-group utilizing maximum likelihood (ML), maximum parsimony (MP) and Bayesian analysis (Bayes) analyses. The numbers along the branches indicate bootstrap probability (BP) and posterior probability (PP) values resulting from different analyses in the order of ML/MP/Bayes. Values lower than 50 are given as ‘‘-’’.
These data provide additional novel mtDNA markers for studying the molecular epidemiology, population genetics and molecular diagnosis of the two Oesophagostomum species. Acknowledgments Project support was provided, in part, by the Program for Outstanding Scientists in Agricultural Research, the Open Funds of the State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Grant Nos. SKLVEB2011KFKT011, SKLVEB2010KFKT009, SKL VEB2009KFKT008, SKLVEB2011KFKT010 and SKLVEB2011KFKT0 04) and the Yunnan Provincial Program for Introducing High-level Scientists (Grant No. 2009CI125). References Abascal, F., Zardoya, R., Posada, D., 2005. ProtTest: selection of best-fit models of protein evolution. Bioinformatics 21, 2104–2105. Boore, J.L., Brown, W.M., 1994. Complete DNA sequence of the mitochondrial genome of the black chiton, Katharina tunicata. Genetics 138, 423–443. Catanese, G., Manchado, M., Infante, C., 2010. Evolutionary relatedness of mackerels of the genus Scomber based on complete mitochondrial genomes: strong support to the recognition of Atlantic Scomber colias and Pacific Scomber japonicus as distinct species. Gene 452, 35–43. Cutillas, C., Guevara-Martínez, D., Oliveros, R., Arias, P., Guevara, D.C., 1999. Characterization of porcine and ovine Oesophagostomum spp. by isoenzymatic patterns and restriction-fragment-length polymorphisms (RFLPs). Acta Tropica 73, 59–71. Durent, L., Mouchiroud, D., 1999. Expression pattern and, surprisingly, gene length shape codon usage in Caenorhabditis, Drosophila and Arabidopsis. Proceedings of the National academy of Sciences of the United States of America 96, 4482– 4487. Gasser, R.B., Cottee, P., Nisbet, A.J., Ruttkowski, B., Ranganathan, S., Joachim, A., 2007. Oesophagostomum dentatum - potential as a model for genomic studies of strongylid nematodes, with biotechnological prospects. Biotechnology Advances 25, 281–293. Gouÿ de Bellocq, J., Ferté, H., Depaquit, J., Justine, J.L., Tillier, A., Durette-Desset, M.C., 2001. Phylogeny of the Trichostrongylina (Nematoda) inferred from 28S rDNA sequences. Molecular Phylogenetics and Evolution 19, 430–442. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52, 696–704. Helfenbein, K.G., Brown, W.M., Boore, J.L., 2001. The complete mitochondrial genome of the articulate brachiopod Terebratalia transversa. Molecular Biology and Evolution 18, 1734–1744. Hu, M., Chilton, N.B., Gasser, R.B., 2002a. The mitochondrial genomes of the two human hookworms Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea). International Journal for Parasitology 32, 145–158. Hu, M., Chilton, N.B., Gasser, R.B., 2002b. Long PCR-based amplification and sequencing of the entire mitochondrial genome from parasite nematodes. Molecular and Cellular Probes 16, 261–267. Hu, M., Chilton, N.B., Gasser, R.B., 2003a. The mitochondrial genome of Strongyloides stercoralis (Nematoda) - idiosyncratic gene order and evolutionary implications. International Journal for Parasitology 33, 1393–1408.
Hu, M., Gasser, R.B., Abs EL-Osta, Y.G., Chilton, N.B., 2003b. Structure and organization of the mitochondrial genome of Dirofilaria immitis. Parasitology 127, 37–51. Jex, A.R., Hall, R.S., Littlewood, D.T., Gasser, R.B., 2010. An integrated pipeline for next-generation sequencing and annotation of mitochondrial genomes. Nucleic Acids Research 38, 522–533. Joachim, A., Dülmer, N., Daugschies, A., Roepstorff, A., 2001. Occurrence of helminthes in pig fattening units with different management systems in Northern Germany. Veterinary Parasitology 96, 135–146. Keddie, E.M., Higazi, T., Unnasch, T.R., 1998. The mitochondrial genome of Onchocerca volvulus: sequence, structure and phylogenetic analysis. Molecular Biochemical Parasitology 95, 111–127. Krief, S., Vermeulen, B., Lafosse, S., Kasenene, J.M., Nieguitsila, A., Berthelemy, M., L’hostis, M., Bain, O., Guillot, J., 2010. Nodular worm infection in wild chimpanzees in Western Uganda: a risk for human health? PLoS Neglected Tropical Diseases 4, e630. Lavrov, D.V., Brown, W.M., 2001. Trichinella spiralis mtDNA: a nematode mitochondrial genome that encodes a putative ATP8 and normally structured tRNAs and has a gene arrangement relatable to those of coelomate metazoans. Genetics 157, 621–637. Legesse, M., Erko, B., 2004. Zoonotic intestinal parasites in Papio anubis (baboon) and Cercopithecus aethiops (vervet) from four localities in Ethiopia. Acta Tropica 90, 231–236. Li, M.W., Lin, R.Q., Song, H.Q., Wu, X.Y., Zhu, X.Q., 2008. The complete mitochondrial genomes for three Toxocara species of human and animal health significance. BMC Genomics 9, 224. Lin, R.Q., Ai, L., Zou, F.C., Verweij, J.J., Jiang, Q., Li, M.W., Song, H.Q., Zhu, X.Q., 2008. A multiplex PCR tool for the specific identification of Oesophagostomum spp. from pigs. Parasitology Research 103, 993–997. Lin, R.Q., Qiu, L.L., Liu, G.H., Wu, X.Y., Weng, Y.B., Xie, W.Q., Hou, J., Pan, H., Yuan, Z.G., Zou, F.C., Hu, M., Zhu, X.Q., 2011. Characterization of the complete mitochondrial genomes of five Eimeria species from domestic chickens. Gene 480, 28–33. Lin, R.Q., Liu, G.H., Zhang, Y., D’Amelio, S., Zhou, D.H., Yuan, Z.G., Zou, F.C., Song, H.Q., Zhu, X.Q., 2012. Contracaecum rudolphii B: gene content, arrangement and composition of its complete mitochondrial genome compared with Anisakis simplex s.l. Experimental Parasitology 130, 135–140. Liu, G.H., Lin, R.Q., Li, M.W., Liu, W., Liu, Y., Yuan, Z.G., Song, H.Q., Zhao, G.H., Zhang, K.X., Zhu, X.Q., 2011. The complete mitochondrial genomes of three cestode species of Taenia infecting animals and humans. Molecular Biology Reports 38, 2249–2256. Liu, G.H., Wu, C.Y., Song, H.Q., Wei, S.J., Xu, M.J., Lin, R.Q., Zhao, G.H., Huang, S.Y., Zhu, X.Q., 2012. Comparative analyses of the complete mitochondrial genomes of Ascaris lumbricoides and Ascaris suum from humans and pigs. Gene 492, 110–116. Lowe, T.M., Eddy, S.R., 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25, 955–964. McCarthy, J., Moore, T.A., 2000. Emerging helminth zoonoses. International Journal for Parasitology 30, 1351–1360. Ojala, D., Montoya, J., Attardi, G., 1981. tRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470–474. Okimoto, R., Macfarlane, J.L., Clary, D.O., 1992. Wolstenholme DR. The mitochondrial genomes of two nematodes. Caenorhabditis elegans and Ascaris suum. Genetics 130, 471–498. Page, R.D., 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Computer Applied Bioscience 12, 357–358. Romero, H., Zavala, A., Musto, H., 2000. Codon usage in Chlamydia trachomatis is the result of strand-specific mutational biases and a complex pattern of selective force. Nucleic Acids Research 28, 2084–2090. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574.
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7 Sharp, P.M., Matassi, G., 1994. Codon usage and genome evolution. Current opinion in genetics & development 4, 851–860. Singer, G.A., Hickey, D.A., 2000. Nucleotide bias causes a genomewide bias in the amino acid composition of proteins. Molecular Biology and Evolution 17, 1581–1588. Swofford, D.L., 2002. Paup⁄: Phylogenetic Analysis Using Parsimony, version 4.0b10. Sinauer Associates, Sunderland, MA. 2002. Talavera, G., Castresana, J., 2007. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology 56, 564–577. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28, 2731–2739. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The Clustal X windows interface. Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876– 4882.
7
Van der Veer, M., de Vries, E., 2004. A single nucleotide polymorphism map of the mitochondrial genome of the parasitic nematode Cooperia oncophora. Parasitology 128, 421–431. Verweij, J.J., Pit, D.S., van Lieshout, L., Baeta, S.M., Dery, G.D., Gasser, R.B., Polderman, A.M., 2001. Determining the prevalence of Oesophagostomum bifurcum and Necator americanus infections using specific PCR amplification of DNA from faecal samples. Tropical Medicine & International Health 6, 726–731. Weng, Y.B., Hu, Y.J., Li, Y., Li, B.S., Lin, R.Q., Xie, D.H., Gasser, R.B., Zhu, X.Q., 2005. Survey of intestinal parasites from intensive pig farms in Guangdong Province, People’s Republic of China. Veterinary Parasitology 127, 333–336. Wolstenholme, D.R., 1992. Animal mitochondrial DNA, structure and evolution. International Review of Cytology 141, 173–216. Xie, Y., Zhang, Z., Wang, C., Lan, J., Li, Y., Chen, Z., Fu, Y., Nie, H., Yan, N., Gu, X., Wang, S., Peng, X., Yang, G., 2011. Complete mitochondrial genomes of Baylisascaris schroederi, Baylisascaris ailuri and Baylisascaris transfuga from giant panda, red panda and polar bear. Gene 482, 59–67.
Contents lists available at SciVerse ScienceDirect
Experimental Parasitology journal homepage: www.elsevier.com/locate/yexpr
Oesophagostomum dentatum and Oesophagostomum quadrispinulatum: Characterization of the complete mitochondrial genome sequences of the two pig nodule worms Rui-Qing Lin a,b,1, Guo-Hua Liu a,c,1, Min Hu d, Hui-Qun Song a, Xiang-Yun Wu e, Ming-Wei Li f, Yuan Zhang b, Feng-Cai Zou g, Xing-Quan Zhu a,c,g,⇑ a State Key Laboratory of Veterinary Etiological Biology, Key Laboratory of Veterinary Parasitology of Gansu Province, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province 730046, PR China b College of Veterinary Medicine, South China Agricultural University, Guangzhou, Guangdong Province 510642, PR China c College of Veterinary Medicine, Hunan Agricultural University, Changsha, Hunan Province 410128, PR China d State Key Laboratory of Agricultural Microbiology, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan, Hubei Province 430070, PR China e Laboratory of Marine Bio-resources Sustainable Utilization, South China Sea Institute of Oceanology, Guangzhou, Guangdong Province 510301, PR China f Agricultural College, Guangdong Ocean University, Zhanjiang, Guangdong Province 524088, PR China g College of Animal Science and Technology, Yunnan Agricultural University, Kunming, Yunnan Province 650201, PR China
a r t i c l e
i n f o
Article history: Received 27 December 2011 Received in revised form 10 February 2012 Accepted 13 February 2012 Available online 6 March 2012 Keywords: Mitochondrial genome Mitochondrial DNA Gene organization Oesophagostomum dentatum Oesophagostomum quadrispinulatum
a b s t r a c t In the present study, the complete mitochondrial DNA (mtDNA) sequences of the pig nodule worm Oesophagostomum quadrispinulatum were determined for the first time, and the mt genome of Oesophagostomum dentatum from China was also sequenced for comparative analysis of their gene contents and genome organizations. The mtDNA sequences of O. dentatum China isolate and O. quadrispinulatum were 13,752 and 13,681 bp in size, respectively. Each of the two mt genomes comprises 36 genes, including 12 protein-coding genes, two ribosomal RNA and 22 transfer RNA genes, but lacks the ATP synthetase subunit 8 gene. All genes are transcribed in the same direction and have a nucleotide composition high in A and T. The contents of A + T are 75.79% and 77.52% for the mt genomes of O. dentatum and O. quadrispinulatum, respectively. Phylogenetic analyses using concatenated amino acid sequences of the 12 proteincoding genes, with three different computational algorithms (maximum likelihood, maximum parsimony and Bayesian inference), all revealed that O. dentatum and O. quadrispinulatum represent distinct but closely-related species. These data provide novel and useful markers for studying the systematics, population genetics and molecular diagnosis of the two pig nodule worms. Ó 2012 Elsevier Inc. All rights reserved.
1. Introduction Parasitic nematodes belonging to the genus Oesophagostomum are commonly known as ‘nodule’ worms of ruminants, pigs and primates. They can cause serious clinical diseases (e.g., oesophagostomiasis) in these hosts (McCarthy and Moore, 2000; Legesse and Erko, 2004; Weng et al., 2005; Krief et al., 2010). Human oesophagostomiasis is a serious public health problem in northern Togo and Ghana (McCarthy and Moore, 2000; Verweij et al., 2001). Oesophagostomum infection in pigs is quite common and has a global geographical distribution (Joachim et al., 2001; Weng et al.,
⇑ Corresponding author at: State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu Province 730046, PR China. Fax: +86 931 8340977. E-mail addresses: [email protected], [email protected] (X.-Q. Zhu). 1 These authors contributed equally to this work. 0014-4894/$ - see front matter Ó 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.exppara.2012.02.015
2005). A few species of Oesophagostomum have been found parasitizing pigs, but only two species, namely Oesophagostomum dentatum and Oesophagostomum quadrispinulatum were identified to be the main causative nodule worms (Cutillas et al., 1999; Lin et al., 2008). Meanwhile, O. dentatum was proposed as a potential model for genomic studies of strongylid nematodes (Gasser et al., 2007). Therefore, relevant studies on the biological, biochemical and molecular biological and genomic information of ‘nodule’ worms in pig would be of help for the control of oesophagostomiasis and diseases caused by other strongylid nematodes. The metazoan mitochondrial (mt) genomes, ranging in size from 14 to 18 kb, are typically circular and usually encode 36–37 genes, including 12–13 protein-coding genes, 22 transfer RNA genes, and two ribosomal RNA genes (Wolstenholme, 1992). Due to its maternal inheritance, rapid evolutionary rate, lack of recombination and relatively conserved genome structures, mtDNA sequences have been widely used as genetic markers not only for studying the taxonomy, systematics and population genetics of
2
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7
animals, but also for phylogenetic and evolutionary analyses (Li et al., 2008; Catanese et al., 2010; Liu et al., 2011, 2012; Xie et al., 2011; Lin et al., 2011, 2012). In spite of significant advances in mt genomics, there are gaps in our knowledge of mt genomes for many groups of metazoan parasites. In the family Chabertiidae, the mt genomes of only two species, namely Chabertia ovina and O. dentatum, were sequenced (Jex et al., 2010). This lack of enough knowledge of mt genomics for parasitic nematodes in this family forms a major limitation for population genetic and phylogenetic studies of pathogens in this family including members of the genus Oesophagostomum. The objectives of the present study were to determine and analyze the mt genomes of the two pig nodule worms O. dentatum and O. quadrispinulatum, and to re-construct the phylogenetic relationships of members of the Chabertiidae using mtDNA sequences. 2. Materials and methods 2.1. Samples and DNA extraction One nodule worm representing O. dentatum used in the present study was from Daqing city, Heilongjiang Province, China, and one specimen representing O. quadrispinulatum was collected from Chongqing city, China. These specimens were obtained from the feces of slaughtered fatten pigs, washed in physiological saline, identified primarily based on morphological characters to species, fixed in 70% (v/v) ethanol and stored at 20 °C until use. Total genomic DNA was isolated from individual nematodes using sodium dodecyl-sulfate/proteinase K treatment, followed by spincolumn purification (Wizard Clean-Up, Promega). The identity of the specimen was confirmed as O. dentatum or O. quadrispinulatum by a multiplex PCR assay following protocols reported previously (Lin et al., 2008). 2.2. Long-PCR amplification and sequencing Based on the partial sequences of mt cytochrome c oxidase subunit (cox1) and NADH dehydrogenase subunit 1 (nad1) genes available in GenBank (Accession Nos. FM161897–FM161886 and FM163322–FM163311, respectively), primers (Table 1) were designed in the conserved regions to amplify the entire mt genome of each species in two overlapping long fragments. PCR reactions (50 lL) were performed in 2.5 mM MgCl2, 0.4 mM each of dNTPs, 5 lL 10 LA Taq buffer, 0.5 lM of each primer, 2.5 U rTaq polymerase (Takara) and 2 lL of DNA sample in a thermocycler (Biometra) under the following conditions: 92 °C for 2 min (initial denaturation), then 92 °C for 10 s (denaturation), 50 °C for 30 s (annealing), and 60 °C for 10 min (extension) for five cycles, followed by 92 °C for 10 s, 50 °C for 30 s, and 66 °C for 10 min for 25 cycles, and a final extension at 66 °C for 10 min. Samples without DNA (no-DNA controls) were included in each amplification run, and in no case were amplicons detected in the no-DNA controls (data not shown). Each amplicon (3 lL) was examined by agarose (0.8%) gel electrophoresis, stained with ethidium bromide and photographed using a gel documentation system (UVItec). PCR products were sent to Sangon Company (Shanghai, China) for sequencing using a primer walking strategy. 2.3. Sequence analyses Sequences were assembled manually and aligned against the complete mt genome sequences of Ancylostoma duodenale (GenBank Accession No. NC_003415) and O. dentatum (Denmark isolate, GenBank Accession No. GQ888716) available using the computer program Clustal X 1.83 to identify gene boundaries (Thompson
Table 1 Sequences of primers used to amplify long-PCR fragments from two Oesophagostomum species. Name of primer
Sequence (50 to 30 )
For O. dentatum ODmtNAD1F ODmtCOX1R ODmtCOX1F ODmtNAD1R
TAGTTATGATTATTGCTGAG ATAAAACCTAACACCCAC TTCTCGTGCTTATTTTAC AAACTCCCATATTCACTT
For O. quadrispinulatum OQmtNAD1F OQmtCOX1R OQmtCOX1F OQmtNAD1R
TTTATAGGTGTATTACAAGCRTT CAGTAAAATAAGCACGAGAATC ACAGTGGGTATGGATTTA AAAAGAAACACCTGGAAC
et al., 1997). The open-reading frames and codon usage profiles of protein-coding genes were analyzed using the program MacVector 4.1.4 (Kodak, version4.0). Gene annotation, genome organization, translation initiation, translation termination codons and the boundaries between protein-coding genes of mt genomes of the two Oesophagostomum species were identified based on comparison with mt genomes of other nematodes reported previously (Hu et al., 2002a; Jex et al., 2010). The amino acid sequences inferred for the mt genes of the two Oesophagostomum species were aligned with those of other nematodes by using Clustal X 1.83. Based on pair-wise alignments, amino acid identity (%) was calculated for homologous genes. Codon usage was examined based on the relationships between the nucleotide composition of codon families and amino acid occurrence, and the genetic codons are grouped into AT rich codons, GC-rich codons and unbiased codons. For analyzing ribosomal RNA genes, putative secondary structures of 22 tRNA genes were identified using tRNAscan-SE (Lowe and Eddy, 1997), or by recognizing potential secondary structures and anticodon sequences by eye by aligning mtDNA sequences of O. dentatum and O. quadrispinulatum. 2.4. Phylogenetic analyses Phylogenetic relationship among representative members of the orders Rhabditida and Strongylida (Table 2), plus the two mtDNA sequences obtained in the present study, were performed, using an Enoplean species Trichinella spiralis (GenBank Accession No. NC_002681) as the outgroup, based on amino acid sequences of 12 protein-coding genes. Each gene was translated into amino acid sequence using the invertebrate mitochondrial genetic code in MEGA 5.0 (Tamura et al., 2011), and aligned based on its amino acid sequence using default settings, and ambiguously aligned regions were excluded using Gblocks online server (http://molevol.cmima.csic.es/castresana/Gblocks_server.html) (Talavera and Castresana, 2007), using the options for a more stringent selection. The final amino acid sequences of the 12 protein-coding genes were then concatenated into single alignments for phylogenetic analyses. Three methods, namely, maximum likelihood (ML), maximum parsimony (MP) and Bayesian inference (Bayes), were employed for phylogenetic re-constructions. ML analyses were performed using PhyML 3.0 (Guindon and Gascuel, 2003), and the mtREV model with its parameter for the concatenated dataset was determined for the ML analysis using ProtTest based on the Akaike information criterion (AIC) (Abascal et al., 2005). Bootstrap support for ML trees was calculated using 100 bootstrap replicates. MP analysis was performed using PAUP 4.0 Beta 10 programme (Swofford, 2002), with indels treated as missing character states. A total of 1000 random addition searches using TBR were performed for each MP analysis. Bootstrap probability (BP) was calculated from 1000 bootstrap replicates with 10 random additions per
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7
3
Table 2 Mitochondrial genome sequences of representative nematodes used for phylogenetic studies. Species
The size of mtDNA (bp)
GenBank™Accession Nos.
Trichinella spiralis Ancylostoma duodenale Ancylostoma caninum Bunostomum phlebotomum Caenorhabditis elegans Angiostrongylus costaricensis Angiostrongylus cantonensis Haemonchus contortus Cooperia oncophora Chabertia ovina Cylicocyclus insignis Mecistocirrus digitatus Strongylus vulgaris Syngamus trachea Teladorsagia circumcincta Trichostrongylus axei Trichostrongylus vitrinus Oesophagostomum dentatum (Denmark isolate)
16,706 13,721 13,717 13,790 13,794 13,585 13,497 14,055 13,636 13,682 13,828 15,221 14,301 14,647 14,066 13,653 13,800 13,869
NC_002681 NC_003415 FJ483518 FJ483517 NC_001328 NC_013067 NC_013065 NC_010383 NC_004806 NC_013831 NC_013808 NC_013848 NC_013818 NC_013821 NC_013827 NC_013824 NC_013807 GQ888716
replicate in PAUP. Bayesian analyses were conducted with four independent Markov chains run for 1,000,000 metropolis-coupled MCMC generations, sampling a tree every 100 generations in MrBayes 3.1.1 (Ronquist and Huelsenbeck, 2003). The first 2500 trees were omitted as burn-in and the remaining trees were used to calculate Bayesian posterior probabilities (PP). Phylograms were drawn using the Tree View program version 1.65 (Page, 1996).
Fig. 1. Arrangement of the mitochondrial genome of Oesophagostomum dentatum and O. quadrispinulatum. Gene scaling is only approximate. All genes are coded by the same DNA strand and are transcribed clockwise. All genes have standard nomenclature except for the 22 tRNA genes, which are designated by the one-letter code for the corresponding amino acid, with numerals differentiating each of the two leucine- and serine- specifying tRNAs (L1 and L2 for codon families CUN and UUR, respectively; S1 and S2 for codon families AGN and UCN, respectively). NC1– NC3 refer to non-coding regions.
3. Results and discussion 3.1. General features of the mt genome of the two Oesophagostomum species The complete mitochondrial genomes of O. dentatum China isolate and O. quadrispinulatum are 13,752 and 13,681 bp in size, respectively (Fig. 1). The mt genome of the O. dentatum China isolate was significantly shorter (117 bp) than that of the O. dentatum Denmark isolate. These mt genome sequences have been deposited in the GenBank under the Accession Nos. FM161882 (O. dentatum, China isolate) and FM161883 (O. quadrispinulatum). Both mt genomes contain 12 protein-coding genes (cox1–3, nad1–6, nad4L, atp6 and cytb), 22 transfer RNA genes, two ribosomal RNA genes and three non-coding regions, but lacking an atp8 gene (Table 3). All genes are predicted to be transcribed in the same direction, and the mt genome arrangement of the O. dentatum and O. quadrispinulatum are the same as that of Chabertia ovina, Cylicocyclus insignis, Strongylus vulgaris, A. duodenale and N. americanus (see Hu et al., 2002a; Jex et al., 2010), and similar to that of Caenorhabditis elegans, Cooperia oncophora and Ascaris suum, except for its number of non-coding regions (Okimoto et al., 1992; Van der Veer and de Vries, 2004). Comparison of gene orders with other namatodes indicated that O. dentatum and O. quadrispinulatum were more closely related to C. ovina and C. insignis than to C. elegans and C. oncophora, consistent with results of previous phylogenetic studies (Gouÿ de Bellocq et al., 2001; Jex et al., 2010). The nucleotide compositions of the entire mtDNA sequences for O. dentatum and O. quadrispinulatum are biased towards A and T, with T being the most common nucleotide and C the least favored, in accordance with mt genomes of other nematodes sequenced to date, such as that of C. ovina, C. insignis and S. vulgaris. The content of A + T is 75.79% for O. dentatum China isolate (28.69% A, 47.10% T, 16.96% G and 7.24% C), 77.74% for O. dentatum Denmark isolate
(28.63% A, 47.11% T, 17.07% G and 7.17% C), and 77.52% for O. quadrispinulatum (30.71% A, 46.80% T, 15.23% G and 7.26% C), respectively.
3.2. Protein genes and codon usage patterns The initiation and termination codon sequences of the 12 protein-coding genes of the two Oesophagostomum species sequenced in the present study were inferred by comparing their sequences with those of C. ovina. The inferred nucleotide and amino acid sequences for each of the 12 mt protein genes of O. dentatum China isolate and O. quadrispinulatum were compared with those of O. dentatum Denmark isolate, C. ovina, C. insignis, S. vulgaris, A. duodenale, N. americanus, C. elegans and C. oncophora. The identity of the 12 amino acid sequences is 91.7–99.6% between O. dentatum China isolate and O. quadrispinulatum, 99.9–100% between O. dentatum China isolate and O. dentatum Denmark isolate, respectively. A total of 3419 amino acids are encoded by the O. dentatum China isolate and O. quadrispinulatum mt genomes. The most common start codon for two Oesophagostomum species is ATT (8 for O. quadrispinulatum and 9 for O. dentatum of 12 protein genes), followed by TTG (two of 12 protein genes for two Oesophagostomum species) and ATA (two of 12 protein genes for O. quadrispinulatum, one for O. dentatum) (Table 3). Ten of the 12 protein genes were predicted to have a TAA or TAG translation termination codon. The remaining protein genes were inferred to end with an abbreviated stop codon T (Table 3). For the two Oesophagostomum species, the 30 -end of genes nad4L, atp6, nad2, cytb, cox3, cox1, cox2 and nad5 is immediately adjacent to a downstream trn gene (Table 1), which is consistent with the arrangement in A. duodenale and N. americanus, and 30 -end of genes nad1, nad3, nad4 and nad6 is adjacent to a downstream protein genes atp6, cox1, nad5 and nad4L, respectively,
4
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7
Table 3 Positions and nucleotide sequence lengths of mitochondrial genomes of Oesophagostomum dentatum and O. quadrispinulatum, anticodons, and initiation and termination codons (ITC) for protein-coding genes (starting from tRNA-Pro). Genes
tRNA-Pro (P) tRNA-Val (V) nad6 nad4L tRNA-Trp (W) tRNA-Glu (E) rrnS tRNA-SerUCN (S2) tRNA-Asn (N) tRNA-Tyr (Y) nad1 atp6 tRNA-Lys (K) tRNA-LeuUUR (L2) tRNA-SerAGN (S1) nad2 tRNA-Ile (I) tRNA-Arg (R) tRNA-Gln (Q) tRNA-Phe (F) cytb tRNA-LeuCUN (L1) cox3 tRNA-Thr (T) nad4 Non-coding region (NC1) cox1 tRNA-Cys (C) tRNA-Met (M) tRNA-Asp (D) tRNA-Gly (G) cox2 tRNA-His (H) rrnL nad3 Non-coding region (NC2) nad5 tRNA-Ala (A) Non-coding region (NC3)
Positions and nt sequence lengths (bp)
ITC
OdC
OdD
Oq
1–55 (55) 81–135 (55) 136–570 (435) 574–807 (234) 811–866 (56) 876–932 (57) 933–1632 (700) 1633–1688 (56) 1689–1745 (57) 1765–1821 (57) 1822–2694 (873) 2703–3302 (600) 3315–3377 (63) 3389–3443 (55) 3444–3496 (53) 3497–4342 (846) 4344–4402 (59) 4403–4457 (55) 4463–4517 (55) 4526–4581 (56) 4582–5694 (1113) 5695–5749 (55) 5750–6515 (766) 6516–6572 (57) 6573–7802 (1230) 7803–7906 (104) 7907–9484 (1578) 9485–9539 (55) 9540–9598 (59) 9608–9667 (60) 9678–9733 (56) 9734–10,429 (696) 10,430–10,484 (55) 10,485–11,450 (966) 11,451–11,786 (336) 11,787–11,868 (82) 11,869–13,450 (1582) 13,451–13,507 (57) 13,508–13,752 (245)
1–56 (56) 80–136 (57) 136–570 (435) 574–807 (234) 811–867 (57) 876–934 (59) 929–1628 (700) 1633–1690 (58) 1689–1746 (58) 1765–1822 (58) 1942–2814(873) 2823–3422 (600) 3435–3498 (64) 3509–3564 (56) 3564–3617 (54) 3617–4462 (846) 4464–4523(60) 4523–4578 (56) 4583–4638(56) 4646–4702 (57) 4702–5814(1113) 5815–5870 (56) 5870–6640 (771) 6636–6693 (58) 6693–7922 (1230) 7923–8025 (103) 8026–9603 (1578) 9604–9659 (56) 9659–9718 (60) 9727–9786 (60) 9797–9852 (56) 9852–10,547 (696) 10,548–10,603 (56) 10,607–11,565 (969) 11,568–11,903 (336) 11,904–11,984 (81) 11,985–13,566 (1582) 13,567–13,624 (58) 13,625–13,869 (245)
1–56 (56) 66–120 (55) 121–555 (435) 557–790 (234) 795–850 (56) 852–909 (58) 910–1608 (699) 1609–1662 (54) 1663–1718 (56) 1739–1794 (56) 1795–2667 (873) 2670–3269 (600) 3279–3341 (63) 3355–3409 (55) 3410–3462 (53) 3463–4308 (846) 4314–4372 (59) 4373–4427 (55) 4434–4488 (55) 4489–4544 (56) 4545–5657 (1113) 5658–5713(56) 5714–6479 (766) 6480–6534 (55) 6535–7764 (1230) 7765–7857 (93) 7858–9435 (1578) 9436–9489 (54) 9498–9556 (59) 8560–9617 (58) 9633–9688 (56) 9689–10,384 (696) 10,385–10,439 (55) 10,440–11,401 (962) 11,402–11,737 (336) 11,738–11,815 (78) 11,816–13,397 (1582) 13,398–13,453 (56) 13,454–13,681 (228)
OdC/OdD
Anticodons Oq
OdC/OdD/Oq TGG TAC
ATT/TAA ATT/TAA
ATT/TAG ATT/TAA TCA TTC TGA GTT GTA
ATA/TAG ATT/TAA
ATT/TAA ATT/TAG TTT TAA TCT
TTG/TAG
TTG/TAA GAT ACG TTG GAA
ATT/TAA
ATT/TAA
ATT/T
ATA/T
TTG/TAA
TTG/TAA
ATT/TAA
ATT/TAA
TAG TGT
GCA CAT GTC TCC ATT/TAA
ATA/TAA GTG
ATT/TAA
AAT/TAG
ATT/T
ATT/T TGC
OdC, Oesophagostomum dentatum China isolate; OdD, Oesophagostomum dentatum Denmark isolate; Oq, Oesophagostomum quadrispinulatum.
but there are inter spaces (non-coding regions) between two protein genes. Incomplete stop codons (TA and T) are common for the mt protein genes of animals (Wolstenholme, 1992). Both the nad5 and cox3 genes of the two Oesophagostomum species terminate in T, and are followed by tRNA-Ala and tRNA-Thr genes, respectively. In the protein-coding genes of the two nodule-worms, the 62 possible codons were used, and the most frequently used codon was TTT (Phe) while the least used codons were CGA (Arg), TGC (Cys) and CTC (Leu), and codons CGC and CGG were not used. The preferred usage of synonymous codons is proposed to be highest in gene regions of functional significance, codon bias is believed to be related mainly to selection at silent sites and thought to maximize translation efficiency (Sharp and Matassi, 1994; Durent and Mouchiroud, 1999). At the third codon position of nodule-worm mt protein genes, T is the most frequently used, and C the least frequently used. It is believed that the bias toward using amino acids relates to the ‘mutational bias-translational selection’ paradigm (Romero et al., 2000), meaning that both mutation and selection have an affect on the bias in codon usage, but it is unclear whether this plays a role in animal mitochondrial systems (Helfenbein et al., 2001). The protein-coding genes of the two nodule-worm genomes are biased toward using amino acids encoded by T-, A- and G-rich codons. The AT-rich codons represent amino acids Phe, Ile, Met, Tyr,
Asn or Lys, and the GC-rich codons represent Pro, Ala, Arg or Gly. Trich codons (more than two Ts in a triplet) comprise Phe (12.6% TTT and 0.5% TTC), Leu (8.7–11.1% TTA, 3.2–6.0% TTG, and 0.3% CTT), Ile (7.3–7.8% ATT), Val (3.4–4.1% GTT), Tyr (4.9–5.0% TAT), Ser (3.1–3.4% TCT), and Cys (1.2% TGT), and account for approximately half (48.1–49.1%) of the total amino acid composition. Aand G-rich codons (with P2 As and Gs, respectively) represent 15.5–17.1% and 8.1–8.7% of the total amino acid composition, respectively (data not shown). In contrast, the proportion of C-rich codons (with P2 Cs) is much lower (3.1–3.3%). This result showed that the genome sequences of O. dentatum or O. quadrispinulatum favor T, A and G, but are strongly biased against C. A previous study (Singer and Hickey, 2000) indicated that nucleotide bias can cause a genome wide bias in the amino acid composition of protein. 3.3. Transfer RNA genes and ribosomal RNA genes Twenty-two trn gene sequences (ranging from 53 to 63 bp in size, see Table 3) were identified in the mt genomes of the two nodule worms and were predicted to fold into putative secondary structures (not showed), which were similar to those of other nematode mtDNA sequences (Keddie et al., 1998; Hu et al., 2002b, 2003a, 2003b), with the exception of that of T. spiralis (Lavrov and Brown, 2001). Common features of the predicted secondary structures of the 22 tRNA genes in O. dentatum China isolate and
5
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7
Table 4 Comparison of A + T content (%) of the AT region, protein-coding and rRNA genes of Oesophagostomum mitochondrial genomes with that of other representative nematode species. Genes
OdC
OdD
Oq
Cov
Sv
Ci
Ad
Na
Co
Ce
Ov
Di
Ss
As
atp6 cox1 cox2 cox3 cytb nad1 nad2 nad3 nad4 nad4L nad5 nad6 rrnS rrnL AT region Emt G
75.5 69.8 72.0 73.2 73.8 74.2 79.4 76.8 76.8 78.6 75.7 75.6 75.9 80.3 84.1 75.8
75.5 69.7 72.3 72.8 73.8 72.9 79.3 76.9 76.5 79.1 76.2 76.8 76.0 80.5 84.0 75.7
78.0 72.2 73.0 73.5 75.7 75.6 83.3 79.5 79.5 79.5 78.2 78.4 76.7 81.7 85.5 77.5
74.8 69.7 72.8 73.5 73.2 73.3 81.2 80.4 77.1 78.5 77.3 78.4 76.7 80.6 83.8 76.3
76.4 70.8 72.7 73.6 74.0 73.4 78.9 78.4 79.0 79.5 78.4 78.6 76.3 81.2 92.9 76.5
75.50 69.65 72.56 72.43 72.42 73.20 81.44 75.00 79.02 82.48 77.84 80.92 76.86 82.59 83.20 76.6
77.8 74.0 69.3 70.8 74.3 74.1 81.2 78.3 78.5 80.3 77.1 79.3 76.6 81.1 90.1 76.7
75.9 74.3 69.5 72.0 73.9 74.0 80.5 79.2 79.0 80.3 79.3 77.7 75.3 81.4 83.2 76.6
77.0 70.8 72.0 72.6 73.4 72.1 80.8 79.3 79.8 80.8 79.1 79.2 75.6 82.2 85.5 76.8
76.0 73.8 70.3 74.1 72.0 74.6 80.0 78.5 77.7 81.6 77.3 80.0 73.7 79.0 93.1 76.2
73.0 72.9 67.0 69.2 71.8 70.0 74.3 76.4 73.2 78.6 72.9 79.1 78.9 77.0 85.3 73.3
71.9 67.9 69.2 71.8 72.3 72.9 74.4 77.2 74.6 77.4 73.8 80.6 75.8 79.6 85.9 74.2
78.4 72.7 72.6 75.5 75.9 73.9 81.3 78.3 76.6 82.9 79.6 82.1 69.5 77.5 85.0 76.6
71.6 68.4 66.7 68.8 70.4 69.5 73.0 73.8 71.0 76.5 72.9 72.6 71.9 76.8 84.7 71.9
OdC, Oesophagostomum dentatum China isolate; OdD, Oesophagostomum dentatum Denmark isolate; Oq, Oesophagostomum quadrispinulatum; Cov, Chabertia ovina; Sv, Strongylus vulgaris; Ci, Cylicocyclus insignis; Ad, Ancylostoma duodenale; Na, Necator americanus; Co, Cooperia oncophora; Ce, Caenorhabditis elegans; Ov, Onchocerca volvulus; Di, Dirofiliria immitis; Ss, Strongyloides stercoralis; As, Ascaris suum; EmtG, entire mitochondrial genome.
O. quadrispinulatum mt genomes differ from the conventional cloverleaf-like structures found in other metazoan mtDNA molecules, in accordance with other nematodes. The putative secondary structures usually have a TV replacement loop of 6–12 bp with some exceptions. The exceptions are trnS1 (AGN) and trnS2 (UCN) in which the DHU-arm is lacking. The mt trnS for two nodule worms possesses a secondary structure consisting of a DHU replacement loop of 4–6 bp, a 3 bp TWC arm, a TWC loop of 4–7 bp and a variable loop of 4 bp, in accordance with other members of the class Secernentea (Okimoto et al., 1992; Keddie et al., 1998), but distinct from T. spiralis. The rrnS and rrnL genes of the two nodule-worm species were identified by sequence comparison with those of C. ovina. The rrnS is located between tRNA-Glu and tRNA-SerUCN, and rrnL is located between tRNA-His and nad3. The size of the rrnS gene is 700 bp for both O. dentatum China isolate and Denmark isolate, and 699 bp for O. quadrispinulatum. The size of the rrnL gene is 966 bp for O. dentatum China isolate, 959 bp for O. dentatum Denmark isolate and 962 bp for O. quadrispinulatum. The A + T contents of the rrnS for O. dentatum China isolate, O. dentatum Denmark isolate and O. quadrispinulatum are 75.9%, 76.0% and 76.7%, and those of the rrnL are 80.3%, 80.5% and 81.7%, respectively (Table 4). Sequence identity in the rrnS and rrnL genes are 93.8% and 91.6% between O. dentatum China isolate and O. quadrispinulatum. Sequence identity in the rrnS and rrnL genes are 99.9% and 98.5% between O. dentatum China isolate and O. dentatum Denmark isolate. 3.4. Non-coding regions In the mt genomes of the two pig nodule worms, the longest non-coding region (NC3) is located between the trnA and trnP. Their sizes are 245 bp for both O. dentatum China isolate and Denmark isolate, and 228 bp for O. quadrispinulatum, which are much shorter than that in A. suum. The AT content are 84.1% for O. dentatum China isolate, 84.9% for O. dentatum Denmark isolate, and 85.5% for O. quadrispinulatum, which are almost the same level comparing with that of genomes of other rhabditid nematodes studied to date. Six and four pairs of inverted AT dinucleotides repeat sequence tracts were identified in O. dentatum and O. quadrispinulatum, respectively. For the two pig nodule-worm species, the second longest noncoding region (NC1) is located between nad4 and cox1 genes, as in the mt genomes of A. duodenale and N. americanus and ascaridoid nematodes A. suum and A. simplex (Okimoto et al., 1992). Its
length is 104 bp (O. dentatum China isolate) and 103 (O. dentatum Denmark isolate) or 93 bp (O. quadrispinulatum), with an AT content of 84.6%, 84.5%, and 87.1%, respectively. The non-coding regions for the two Oesophagostomum species could form a hairpin loop structure (TAAAATTTTTA), which is similar to that of the hookworm N. americanus. Whether this region has the potential to initiate the synthesis of the second (L) strand of mtDNA is unknown. In some cases, where protein genes are adjacent to one another, stem-and-loop structures may form which, when transcribed, may serve as alternative signals for RNA processing enzymes (Boore and Brown, 1994). Like hookworms A. duodenale and N. americanus, a third noncoding region was identified for the two nodule worms between nad3 and nad5 genes (82 bp for O. dentatum China isolate and 81 bp for O. dentatum Denmark isolate, and 78 bp for O. quadrispinulatum), with an AT content of 82.9%, 82.7% and 82.1%, respectively. For the two pig nodule worms, the sequence could not be folded into a stem-and-loop secondary structure, as described for the same non-coding region of N. americanus. Except for the noncoding sequences described above, there are a few short sequences (the longest is 25 bp) among tRNA genes. In mammalian mitochondria, portions of the trns in polycistronic transcripts are thought to serve as RNA processing signals (Ojala et al., 1981). 3.5. Phylogenetic analyses The final alignment of the amino acid sequences of 12 proteincoding genes for 18 nematode species of the Rhabditida and Strongylida was subjected to ML, MP and Bayes analyses using T. spiralis as the outgroup. ML, MP and Bayes analyses yielded similar tree topologies (Fig. 2). Based on the phylogenetic trees, the two pig Oesophagostomum species were clustered together, indicating that O. dentatum and O. quadrispinulatum represent distinct but closely-related species. Oesophagostomum were sister to C. ovina, which is in agreement with a previous phylogenetic study of nematodes based on 28S rDNA sequence data (Gouÿ de Bellocq et al., 2001). In conclusion, the present study determined the complete mtDNA sequences of O. quadrispinulatum for the first time, obtained the complete mtDNA sequences of O. dentatum from China and revealed their gene annotations and genome organizations. Phylogenetic analysis using concatenated amino acid sequences of the 12 mt protein-coding genes indicated that O. dentatum and O. quadrispinulatum represent distinct but closely-related species.
6
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7
Fig. 2. Inferred phylogenetic relationships among representative nematode parasites of the orders Rhabditida and Strongylida based on amino acid sequences of 12 mitochondrial protein-coding genes using Trichinella spiralis (GenBank Accession No. NC_002681) as the out-group utilizing maximum likelihood (ML), maximum parsimony (MP) and Bayesian analysis (Bayes) analyses. The numbers along the branches indicate bootstrap probability (BP) and posterior probability (PP) values resulting from different analyses in the order of ML/MP/Bayes. Values lower than 50 are given as ‘‘-’’.
These data provide additional novel mtDNA markers for studying the molecular epidemiology, population genetics and molecular diagnosis of the two Oesophagostomum species. Acknowledgments Project support was provided, in part, by the Program for Outstanding Scientists in Agricultural Research, the Open Funds of the State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Grant Nos. SKLVEB2011KFKT011, SKLVEB2010KFKT009, SKL VEB2009KFKT008, SKLVEB2011KFKT010 and SKLVEB2011KFKT0 04) and the Yunnan Provincial Program for Introducing High-level Scientists (Grant No. 2009CI125). References Abascal, F., Zardoya, R., Posada, D., 2005. ProtTest: selection of best-fit models of protein evolution. Bioinformatics 21, 2104–2105. Boore, J.L., Brown, W.M., 1994. Complete DNA sequence of the mitochondrial genome of the black chiton, Katharina tunicata. Genetics 138, 423–443. Catanese, G., Manchado, M., Infante, C., 2010. Evolutionary relatedness of mackerels of the genus Scomber based on complete mitochondrial genomes: strong support to the recognition of Atlantic Scomber colias and Pacific Scomber japonicus as distinct species. Gene 452, 35–43. Cutillas, C., Guevara-Martínez, D., Oliveros, R., Arias, P., Guevara, D.C., 1999. Characterization of porcine and ovine Oesophagostomum spp. by isoenzymatic patterns and restriction-fragment-length polymorphisms (RFLPs). Acta Tropica 73, 59–71. Durent, L., Mouchiroud, D., 1999. Expression pattern and, surprisingly, gene length shape codon usage in Caenorhabditis, Drosophila and Arabidopsis. Proceedings of the National academy of Sciences of the United States of America 96, 4482– 4487. Gasser, R.B., Cottee, P., Nisbet, A.J., Ruttkowski, B., Ranganathan, S., Joachim, A., 2007. Oesophagostomum dentatum - potential as a model for genomic studies of strongylid nematodes, with biotechnological prospects. Biotechnology Advances 25, 281–293. Gouÿ de Bellocq, J., Ferté, H., Depaquit, J., Justine, J.L., Tillier, A., Durette-Desset, M.C., 2001. Phylogeny of the Trichostrongylina (Nematoda) inferred from 28S rDNA sequences. Molecular Phylogenetics and Evolution 19, 430–442. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology 52, 696–704. Helfenbein, K.G., Brown, W.M., Boore, J.L., 2001. The complete mitochondrial genome of the articulate brachiopod Terebratalia transversa. Molecular Biology and Evolution 18, 1734–1744. Hu, M., Chilton, N.B., Gasser, R.B., 2002a. The mitochondrial genomes of the two human hookworms Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea). International Journal for Parasitology 32, 145–158. Hu, M., Chilton, N.B., Gasser, R.B., 2002b. Long PCR-based amplification and sequencing of the entire mitochondrial genome from parasite nematodes. Molecular and Cellular Probes 16, 261–267. Hu, M., Chilton, N.B., Gasser, R.B., 2003a. The mitochondrial genome of Strongyloides stercoralis (Nematoda) - idiosyncratic gene order and evolutionary implications. International Journal for Parasitology 33, 1393–1408.
Hu, M., Gasser, R.B., Abs EL-Osta, Y.G., Chilton, N.B., 2003b. Structure and organization of the mitochondrial genome of Dirofilaria immitis. Parasitology 127, 37–51. Jex, A.R., Hall, R.S., Littlewood, D.T., Gasser, R.B., 2010. An integrated pipeline for next-generation sequencing and annotation of mitochondrial genomes. Nucleic Acids Research 38, 522–533. Joachim, A., Dülmer, N., Daugschies, A., Roepstorff, A., 2001. Occurrence of helminthes in pig fattening units with different management systems in Northern Germany. Veterinary Parasitology 96, 135–146. Keddie, E.M., Higazi, T., Unnasch, T.R., 1998. The mitochondrial genome of Onchocerca volvulus: sequence, structure and phylogenetic analysis. Molecular Biochemical Parasitology 95, 111–127. Krief, S., Vermeulen, B., Lafosse, S., Kasenene, J.M., Nieguitsila, A., Berthelemy, M., L’hostis, M., Bain, O., Guillot, J., 2010. Nodular worm infection in wild chimpanzees in Western Uganda: a risk for human health? PLoS Neglected Tropical Diseases 4, e630. Lavrov, D.V., Brown, W.M., 2001. Trichinella spiralis mtDNA: a nematode mitochondrial genome that encodes a putative ATP8 and normally structured tRNAs and has a gene arrangement relatable to those of coelomate metazoans. Genetics 157, 621–637. Legesse, M., Erko, B., 2004. Zoonotic intestinal parasites in Papio anubis (baboon) and Cercopithecus aethiops (vervet) from four localities in Ethiopia. Acta Tropica 90, 231–236. Li, M.W., Lin, R.Q., Song, H.Q., Wu, X.Y., Zhu, X.Q., 2008. The complete mitochondrial genomes for three Toxocara species of human and animal health significance. BMC Genomics 9, 224. Lin, R.Q., Ai, L., Zou, F.C., Verweij, J.J., Jiang, Q., Li, M.W., Song, H.Q., Zhu, X.Q., 2008. A multiplex PCR tool for the specific identification of Oesophagostomum spp. from pigs. Parasitology Research 103, 993–997. Lin, R.Q., Qiu, L.L., Liu, G.H., Wu, X.Y., Weng, Y.B., Xie, W.Q., Hou, J., Pan, H., Yuan, Z.G., Zou, F.C., Hu, M., Zhu, X.Q., 2011. Characterization of the complete mitochondrial genomes of five Eimeria species from domestic chickens. Gene 480, 28–33. Lin, R.Q., Liu, G.H., Zhang, Y., D’Amelio, S., Zhou, D.H., Yuan, Z.G., Zou, F.C., Song, H.Q., Zhu, X.Q., 2012. Contracaecum rudolphii B: gene content, arrangement and composition of its complete mitochondrial genome compared with Anisakis simplex s.l. Experimental Parasitology 130, 135–140. Liu, G.H., Lin, R.Q., Li, M.W., Liu, W., Liu, Y., Yuan, Z.G., Song, H.Q., Zhao, G.H., Zhang, K.X., Zhu, X.Q., 2011. The complete mitochondrial genomes of three cestode species of Taenia infecting animals and humans. Molecular Biology Reports 38, 2249–2256. Liu, G.H., Wu, C.Y., Song, H.Q., Wei, S.J., Xu, M.J., Lin, R.Q., Zhao, G.H., Huang, S.Y., Zhu, X.Q., 2012. Comparative analyses of the complete mitochondrial genomes of Ascaris lumbricoides and Ascaris suum from humans and pigs. Gene 492, 110–116. Lowe, T.M., Eddy, S.R., 1997. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Research 25, 955–964. McCarthy, J., Moore, T.A., 2000. Emerging helminth zoonoses. International Journal for Parasitology 30, 1351–1360. Ojala, D., Montoya, J., Attardi, G., 1981. tRNA punctuation model of RNA processing in human mitochondria. Nature 290, 470–474. Okimoto, R., Macfarlane, J.L., Clary, D.O., 1992. Wolstenholme DR. The mitochondrial genomes of two nematodes. Caenorhabditis elegans and Ascaris suum. Genetics 130, 471–498. Page, R.D., 1996. TREEVIEW: an application to display phylogenetic trees on personal computers. Computer Applied Bioscience 12, 357–358. Romero, H., Zavala, A., Musto, H., 2000. Codon usage in Chlamydia trachomatis is the result of strand-specific mutational biases and a complex pattern of selective force. Nucleic Acids Research 28, 2084–2090. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574.
R.-Q. Lin et al. / Experimental Parasitology 131 (2012) 1–7 Sharp, P.M., Matassi, G., 1994. Codon usage and genome evolution. Current opinion in genetics & development 4, 851–860. Singer, G.A., Hickey, D.A., 2000. Nucleotide bias causes a genomewide bias in the amino acid composition of proteins. Molecular Biology and Evolution 17, 1581–1588. Swofford, D.L., 2002. Paup⁄: Phylogenetic Analysis Using Parsimony, version 4.0b10. Sinauer Associates, Sunderland, MA. 2002. Talavera, G., Castresana, J., 2007. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology 56, 564–577. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28, 2731–2739. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The Clustal X windows interface. Flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876– 4882.
7
Van der Veer, M., de Vries, E., 2004. A single nucleotide polymorphism map of the mitochondrial genome of the parasitic nematode Cooperia oncophora. Parasitology 128, 421–431. Verweij, J.J., Pit, D.S., van Lieshout, L., Baeta, S.M., Dery, G.D., Gasser, R.B., Polderman, A.M., 2001. Determining the prevalence of Oesophagostomum bifurcum and Necator americanus infections using specific PCR amplification of DNA from faecal samples. Tropical Medicine & International Health 6, 726–731. Weng, Y.B., Hu, Y.J., Li, Y., Li, B.S., Lin, R.Q., Xie, D.H., Gasser, R.B., Zhu, X.Q., 2005. Survey of intestinal parasites from intensive pig farms in Guangdong Province, People’s Republic of China. Veterinary Parasitology 127, 333–336. Wolstenholme, D.R., 1992. Animal mitochondrial DNA, structure and evolution. International Review of Cytology 141, 173–216. Xie, Y., Zhang, Z., Wang, C., Lan, J., Li, Y., Chen, Z., Fu, Y., Nie, H., Yan, N., Gu, X., Wang, S., Peng, X., Yang, G., 2011. Complete mitochondrial genomes of Baylisascaris schroederi, Baylisascaris ailuri and Baylisascaris transfuga from giant panda, red panda and polar bear. Gene 482, 59–67.