- Email: [email protected]
Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues
Gene Expression Patterns xxx (2015) 1e6
Contents lists available at ScienceDirect
Gene Expression Patterns journal homepage: http://www.elsevier.com/locate/gep
Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues Naomi L. Baker, Kerry A. Miller 1, Donald F. Newgreen, Peter G. Farlie* Murdoch Childrens Research Institute, Royal Children's Hospital, Parkville and Department of Paediatrics, University of Melbourne, Parkville, Australia
a r t i c l e i n f o
a b s t r a c t
Article history: Received 22 December 2014 Received in revised form 10 May 2015 Accepted 17 June 2015 Available online xxx
Background: Olfactory receptors were initially believed to be expressed specifically within the olfactory neurons. However, accumulating genome-scale data has recently demonstrated more extensive expression. There are hundreds of olfactory receptor family members and the realisation of their widespread expression provides an opportunity to reveal new biology. However, existing data is predominantly based on RT-PCR, microarray and RNA-seq approaches and the details of tissue and cell-type specific expression are lacking. Results: As a proof of principle, we selected Olfr603 for expression analysis. We generated an antibody against a non-conserved epitope of Olfr603 and characterised its expression in E8.5-E12.5 mouse embryos using immunohistochemistry. This analysis demonstrated a dynamic pattern of expression in diverse cell types within the developing embryo unrelated to the olfactory system. Expression was detected in migrating neural crest, endothelial precursors and vascular endothelium, endocardial cells, smooth muscle, neuroepithelium and within the ocular tissues. This complex distribution does not conform to any apparent germ layer or tissue origin. Conclusions: This initial characterisation of Olfr603 expression highlights the potential for a broad role for this receptor in the development of many tissues. © 2015 Elsevier B.V. All rights reserved.
Keywords: Olfactory receptor Embryonic expression Non-olfactory
The olfactory receptors are a large family of G protein-coupled receptors expressed within olfactory neurons (Buck and Axel, 1991). They bind small odorant molecules present at the surface of the nasal epithelium and are thought to facilitate olfaction through a combinatorial code mechanism in which multiple individual odorant signals are integrated centrally to provide specific recognition of complex smells. There are approximately 400 olfactory receptor genes in humans and 1200 in mice, making the olfactory receptors one of the largest gene families in vertebrates (Godfrey et al., 2004; Malnic et al., 2004). The olfactory receptors are most frequently single exon genes that commonly reside in clusters dispersed throughout the genome but can also exist as single isolated genes. The growth of olfactory receptor diversity appears to have been driven by multiple duplication events during evolution and the majority of highly related olfactory receptor subfamilies reside within a single genomic locus (Godfrey et al., 2004).
* Corresponding author. E-mail address: [email protected] (P.G. Farlie). 1 Present address: Clinical Genetics Group, Weatherall Institute of Molecular Medicine, University of Oxford, UK.
In addition, the olfactory receptor genes are often highly polymorphic and large olfactory receptor gene family clusters typically harbour >20% pseudogenes (Godfrey et al., 2004). Novel G proteincoupled receptors are typically assigned olfactory receptor status on the basis of sequence similarity to pre-existing olfactory receptors. Similarly, while a small proportion of olfactory receptors have had natural or (more typically) synthetic ligands identified, the majority are assigned proposed ligand binding characteristics based on sequence similarity to characterised receptors, although this situation is rapidly evolving with development of new bioinformatic and functional screening approaches (Malnic, 2007; Li et al., 2015). The olfactory receptors were originally believed to be expressed only by olfactory neurons within the olfactory epithelium but sporadic reports have demonstrated expression in other cell types including sperm, muscle, eye, kidney, intestine and heart (Fukuda ski et al., 2005; Braun et al., 2007; Griffin et al., 2004; Durzyn et al., 2009; Pluznick et al., 2009, 2013; Primeaux et al., 2013; Pronin et al., 2014; Kim et al., 2015). A recent systematic study in a panel of 16 adult human tissues demonstrated expression of 28% of all olfactory receptors in one or more tissue (Flegel et al., 2013).
http://dx.doi.org/10.1016/j.gep.2015.06.002 1567-133X/© 2015 Elsevier B.V. All rights reserved.
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
2
N.L. Baker et al. / Gene Expression Patterns xxx (2015) 1e6
Fig. 1. Validation of anti-Olfr603 antibody. (A) The Olfr603 peptide sequence used to raise the polyclonal antibody (bold) aligned with the 3 most closely related Olfr family members. (B) Western blot of crude protein extract from NIH 3T3 fibroblasts using affinity purified anti-Olfr603 with and without addition of a blocking peptide. The same blots were probed with anti-alpha tubulin as a loading control. (C) A miRNA knockdown of Olfr603 in NIH 3T3 fibroblasts. The miRNA expression is linked to GFP, Olfr603 expression is visualised in red. Pre-immune serum staining in parallel cultures produces no specific signal. Scale bar ¼ 10 mm.
Importantly, this study also demonstrated that human olfactory receptor pseudogenes are typically expressed at similar levels to functional olfactory receptors, at least at the RNA level. Similarly, expression data from publically available microarray and RNA-seq studies (NCBI GEO) suggest that expression of many olfactory receptors outside of the olfactory epithelium is common. Moreover, mouse olfactory receptor 23 (MOR23) has been shown to be required for myoblast fusion and muscle regeneration (Griffin et al., 2009) indicating that non-olfactory expression can have functional consequences. G protein-coupled receptors have diverse functions in biology including mediating vision (rhodopsin), blood pressure regulation (angiotensin receptor), embryonic patterning (Shh signalling, Smoothened), immune/haematopoietic function (CXC receptors) and many others (Jackson et al., 1988; Alcedo et al., 1996; Palczewski et al., 2000; Nomiyama and Yoshie, 2015). The ligands triggering signalling from these receptors are similarly diverse, ranging from photons, small molecule metabolites to peptides. Given the large size and largely uncharacterised nature of the
olfactory receptor family along with the diverse signalling functions of G protein-coupled receptors and the prospect of expression outside of the olfactory system, it is possible that some olfactory receptors, despite existing nomenclature, have a significant impact in a wide range of biological systems. As a first step in investigating this possibility we sought to confirm expression of olfactory receptors outside of the olfactory system during embryonic mouse development. The mouse Olfr603 gene, typical of most olfactory receptor genes, is encoded by a single 939 bp exon and is predicted to encode a 312 aa/35.4 kDa protein. The Olfr603 gene is unremarkable within the olfactory receptor family and is a typical example of the hundreds of uncharacterised olfactory receptors. We raised a polyclonal antibody against an extracellular epitope of Olfr603 present in a highly variable domain, minimising the potential for cross reaction with other, related olfactory receptors. The Olfr603 gene resides in a large cluster on chromosome 7, spanning 6.7 Mb which harbours 190 other olfactory receptors. Within this cluster is a very closely related family member Olfr596,
Fig. 2. Olfr603 expression in whole mount E8.5e10.5 embryos. (A) Lateral and (B) Dorsal view of flat-mounted E8.5 embryos, (C) Lateral view of an E9.5 embryo, (D) Lateral view of an E10.5 embryo. AeC are confocal images, D is an epifluorescence image. Arrowhead, allantois. Da, dorsal aorta; NP, neural plate, Hm, Head mesenchyme, Ot, otocyst; So, somite; H, heart; Um, umbilicus; At, atrium; V, ventricle. Scale bars (A) 200um, (B) 150um, (C) 200um, (D) 90um.
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
N.L. Baker et al. / Gene Expression Patterns xxx (2015) 1e6
3
Fig. 3. Transverse sections of E8.5 and E9.5 embryos. (AeC) E8.5, (DeI) E9.5. (I) Pre-immune control. Hm, head mesenchyme; V, vascular precursors; Bvg, bulbo ventricular groove; Lpm, lateral plate mesoderm; Ecp, prospective endocardial cells within the bulbo ventricular canal; Uv, umbilical vein; NC, neural crest; Dm, dermomyotome; Hg, hindgut; Da, dorsal aorta; Co, coelom; Bw; body wall; Al allantois; Np, neural plate. Magnification; AeD 20, E-I 10. Scale bar C ¼ 50 mm, F ¼ 100 mm.
which is highly conserved at the nucleotide level and 99% identical at the amino acid level. It is therefore difficult to distinguish between these two proteins using antibody-based assays (Fig. 1A). However, the epitope used is not predicted to produce an antibody that interacts strongly with any other olfactory receptors. Analysis of Olr603 within embryonic tissues reveals widespread expression in diverse cell types. 1. Results 1.1. Validation of anti-Olfr603 antibody specificity We characterised our custom, affinity purified anti-Olfr603
antibody using western blot of crude cell lysates. Mouse cell lines representing fibroblasts, chondrocytes and myoblasts demonstrated that expression of Olfr603 is widespread (not shown). We further characterised expression in NIH 3T3 cells demonstrating a single band at approximately 55 kDa, larger than the predicted molecular weight of 35 kDa. The specificity of this band was demonstrated through use of a blocking peptide corresponding to the epitope against which the antibody was raised (Fig. 1B). We further validated this antibody through transfection with two independent miRNA knockdown constructs directed against nonoverlapping sequences within Olfr603 using an expression vector in which production of miRNA is linked to GFP expression (Smith et al., 2009). Similar results were obtained with both sequences.
Fig. 4. Transverse sections of the neural tube in E9.5-E12.5 embryos. (A) E9.5, (BeD) E10.5, (EeH) E12.5. (A) Cranial neural tube and otocyst (arrowhead). (B) Thoracic level neural tube and dorsal root ganglion (arrow), (C) Pre-immune control section adjacent to section in B, (D) Caudal neural tube within the tail, (E) Thoracic level neural tube, dorsal root ganglion (arrow) and notochord (arrowhead), (FeH) Higher magnification view of (F) ventral neural tube, (G) notochord, (H) dorsal root ganglion. Magnification; A, D, E 10, B, C 20, G, H 40, Scale bars B ¼ 50 mm, E ¼ 100 mm, G ¼ 25 mm.
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
4
N.L. Baker et al. / Gene Expression Patterns xxx (2015) 1e6
Strongly transfected NIH 3T3 cells demonstrated loss of immunereactivity relative to non-transfected cells within the same culture (Fig. 1C) indicating specificity of the anti-Olfr603 antibody. The pre-immune serum produced no specific staining (Fig. 1C). 1.2. Immunofluorescence detection of Olfr603 in mouse embryos We first examined embryonic expression in whole mount E7.5e10.5 mouse embryos. There was no clear staining detected in E7.5 embryos suggesting that expression of Olfr603 begins between E7.5 and E8.5. Expression of Olfr603 was readily detected in all three stages examined and was widespread throughout embryonic tissues. At E8.5 expression was very strong in the allantois and extra-embryonic membranes (Fig. 2A,B). Moderate expression was detected throughout the neural plate but was strong in some mesodermal cells underlying the neural plate and within the dorsal aorta. At E9.5 expression was widespread and was prominent in the cranial neural tube, heart, somites and umbilicus but was weak in the otocyst (Fig. 2C). At E10.5 expression of Olfr603 was widespread and apparent in cells within most tissues. Sections of both whole mount stained embryos and direct staining of sections confirmed the broad expression of Olfr603 in early embryonic tissues. At E8.5 (Fig. 3AeD) prominently expressing populations include the head mesenchyme, vascular precursors adjacent to the neural tube, paraxial and lateral plate mesoderm and within isolated cells of the ectoderm. At E9.5 (Fig. 3EeI) expression was apparent in the somites, particularly in the dorsal, myotomal compartment and in the apical surface of somitic epithelial cells between adjacent somites. In the neural epithelium, expression was prominent at the basal surface of both the closed neural tube and the more caudal neural plate (Fig. 3G,H). In the most caudal neural plate, expression appeared to be distributed throughout the neuroepithelium (Fig. 3H). Expression was also apparent in endothelial cells lining the dorsal aorta and in the lateral plate (Fig. 3FeH). At cranial level in E9.5 embryos, expression was widespread throughout the neural tube. There is strong expression in cells distributed along the basal surface of the neuroepithelium which form a continuous stream of mesenchyme that can be seen passing over the otocyst, suggesting they are neural crest cells (Fig. 4A). At E10.5, expression remained widespread throughout the neuroepithelium within the junction between individual neuroepithelial cells and was present in the dorsal root ganglia (Fig. 4B,C). The prominent expression over the dorsal neural tube can also be seen in the caudal neural tube within the tail (Fig. 4D). At E12.5 Olfr603 is strongly expressed in the junctions between neuroepithelial cells and within the dorsal root ganglia (Fig. 4E,F,H). Chondrocytes within the prospective vertebrae were negative while the notochord strongly expressed Olfr603 along the entire length of the embryonic axis (Fig. 4E,G). Staining for Olfr603 in E16.5 embryos revealed staining in the dorsal root ganglia and spinal cord similar to that illustrated at E12.5 and in the umbilical mesenchyme (not shown). No staining above background could be detected in other tissues including kidney and intestine where a number of other olfactory receptors have previously been identified (Braun et al., 2007; Pluznick et al., 2009). Olfr603 is expressed in a range of cell types within the developing heart. At E9.5 expression was prominent in endocardial cells within the atria, ventricles and within the endocardial cushion and epicardium (Fig. 5B). At E10.5 the endocardial cushion within the atrio-ventricular canal remained strongly positive as did the endocardial cells of the developing ventricular trabeculae (Fig. 5A,D). At E10.5 the endocardial cells lining the aortic sac were also strongly positive for Olfr603 (Fig. 5C). At E10.5 expression is widespread within the cranial
mesenchyme between the forebrain and ectoderm (Fig. 5E). In addition, a polarized distribution of Olfr603 is apparent within the epithelial cells of both the retina and lens of the eye (Fig. 5E,G). At E11.5, expression is prominent within the epithelial precursor of the optic stalk (Fig. 5F). At E12.5 the expression of Olfr603 remains prominent within the developing lens, retina and optic stalk but can also be seen in the developing cornea (Fig. 5H). The association of Olfr603 expression with a number of vascular structures and endocardial cells prompted an investigation of the co-localization of Olfr603 with endothelial cells. We used PECAM as a marker of endothelial cells and their precursors. In E12.5 embryos
Fig. 5. Olfr603 expression in developing heart and eye. (A) E10.5 cranial neural tube, dorsal aorta (arrows) and heart including the endocardial cushion in atrio-ventricular canal (arrowhead) and trabeculae, (B) E9.5 atrio-ventricular canal (arrowhead) and epicardium (arrow), (C) E10.5 aortic sac lined with endocardial cells (arrowhead), (D) Pre-immune control adjacent to section in A, (E) E10.5 head mesenchyme (arrow), optic cup and lens, (F) E11.5 optic stalk (arrowhead), (G) Pre-immune control adjacent to section in E, (H) E12.5 eye and optic stalk. Magnification; B, C, D, H 10 A, E, F, G 20. Scale bars A, C, H ¼ 100 mm.
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
N.L. Baker et al. / Gene Expression Patterns xxx (2015) 1e6
5
Fig. 6. Co-expression of Olfr603 and PECAM at E12.5. (A) Transverse section through an E12.5 embryo stained for Olfr603 (green) and PECAM (red) illustrating co-expression in endothelial structures (arrows), (B) Aortic arch (arrow) harbouring endothelial cells expressing Olfr603 surrounded by Olfr603 expressing smooth muscle while the trachea and oesophagus (arrowheads) are negative, (C) Dorsal aorta, (D) Endocardial cells lining the trabeculae, (E) Eye in which the vascular plexus underlying the lens (arrowhead) is strongly double positive. (F) Olfr603 staining in a cranial blood vessel (arrow) imaged with FITC filter, (G) autofluorescence associated with image in F (Texas Red filter). Magnification; A, B, E 10, C, D 40. Scale bars A ¼ 100 mm, C ¼ 50 mm.
at trunk level, Olfr603 expression co-localizes with many endothelial lineage cells including precursors of the inter-somitic vessels, the dorsal aorta and the paired vessels underlying the neural tube as well as a number of other forming vascular structures (Fig. 6A). There is also co-localisation with the endothelial cells of the aortic arch which is surrounded by an Olfr603 positive smooth muscle layer (Fig. 6B). Notably, the trachea and oesophagus are negative for Olfr603 expression. At high magnification, the colocalisation of Olfr603 and PECAM in the dorsal aorta is apparent (Fig. 6C). Similarly, the PECAM positive endocardial cells also coexpress Olfr603 (Fig. 6D). In the developing eye, Olfr603 is coexpressed with PECAM positive endothelial cells in the forming vascular plexus underlying the lens and in the vasculature
underlying the retina (Fig 6E). Collectively, these data demonstrate widespread expression of Olfr603 within a range of developing mouse embryonic tissues during organogenesis. A number of studies have provided preliminary demonstration of a potential non-olfactory function for olfactory receptors such as MOR23. These observations together with the growing evidence for extra-olfactory expression of olfactory receptors highlight the potential for diverse functions outside of the olfactory neurons during embryonic development. 2. Experimental procedures Antibody production. A rabbit polyclonal antibody was raised
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
6
N.L. Baker et al. / Gene Expression Patterns xxx (2015) 1e6
against the first extra-cellular domain of olfactory receptor 603 using the peptide MPSNNETASHPSLFHLLGIPGLEA conjugated to KLH (Genscript, USA). The anti-serum was affinity purified using a GST-fusion peptide of the immunising peptide. The affinity purified antibody was used at a 1:300 dilution for both whole mount, sections and cells and was detected using 1:1600 goat anti-rabbit conjugated to Alexa 488 (Jackson Lab, MP A11008). All tissues (derived from C57Bl6 mice) and cells were fixed in 4% PFA for 30 min and blocked with 1% BSA, 0.1% Triton X-100. For western blot, the antibody was used at 1:2500 and detected with a 1:8000 dilution of goat anti-rabbit HRP (Cell Signalling, 7074). Mouse antitubulin (Sigma, T6793) was used at 1:8000 and detected with antimouse HRP (Chemicon AP326P) diluted 1:10000. Western blot detection was performed with ECL Prime (GE Healthcare). miRNA knockdown. Two independent sequences were cloned into the pRmiR2 vector (Smith et al., 2009). The sequences were KD1: TTCAAAGCTTATCTCCCTAAG, KD2: TGCCATGACAGCCACCACTTT and were designed using the Invitrogen Block-It RNAi designer. NIH 3T3 cells were transiently transfected using Fugene HD (Promega Australia) and fixed in 4% PFA 48 h after transfection. Acknowledgements This work was supported by NHMRC Australia grant number 1002660 and the MCRI was supported by the Victorian Government's Operational Infrastructure Support Program. References Alcedo, J., Ayzenzon, M., Von Ohlen, T., Noll, M., Hooper, J.E., 1996. The drosophila smoothened gene encodes a seven-pass membrane protein, a putative receptor for the Hedgehog signal. Cell 86, 221e232. Braun, T., Voland, P., Kunz, L., Prinz, C., Gratzl, M., 2007. Enterochromaffin cells of the human gut: sensors for spices and odorants. Gastroenterology 132, 1890e1901. Buck, L., Axel, R., 1991. A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65, 175e187. ski Ł, Gaudin J-C., Myga, M., Szydłowski, J., Go zefiak, A., Haertle , T., Durzyn zdzicka-Jo
2005. Olfactory-like receptor cDNAs are present in human lingual cDNA libraries. Biochem. Biophys. Res. Commun. 333, 264e272. Flegel, C., Manteniotis, S., Osthold, S., Hatt, H., Gisselmann, G., 2013. Expression profile of ectopic olfactory receptors determined by deep sequencing. PLoS One 8, e55368. Fukuda, N., Yomogida, K., Okabe, M., Touhara, K., 2004. Functional characterization of a mouse testicular olfactory receptor and its role in chemosensing and in regulation of sperm motility. J. Cell Sci. 117, 5835e5845. Godfrey, P.A., Malnic, B., Buck, L.B., 2004. The mouse olfactory receptor gene family. Proc. Natl. Acad. Sci. U. S. A. 101, 2156e2161. Griffin, C.A., Kafadar, K.A., Pavlath, G.K., 2009. MOR23 promotes muscle regeneration and regulates cell adhesion and migration. Dev. Cell. 17, 649e661. Jackson, T.R., Blair, L.A.C., Marshall, J., Goedert, M., Hanley, M.R., 1988. The mas oncogene encodes an angiotensin receptor. Nature 335, 437e440. Kim, S.-H., Yoon, Y.C., Lee, A.S., Kang, N., Koo, J., Rhyu, M.-R., Park, J.-H., 2015. Expression of human olfactory receptor 10J5 in heart aorta, coronary artery, and endothelial cells and its functional role in angiogenesis. Biochem. Biophys. Res. Commun. 460 (2), 404e408. Li, J., Haddad, R., Santos, V., Bavan, S., Luetje, C.W., 2015. Receptive range analysis of a mouse odorant receptor subfamily. J. Neurochem. 134 (1), 47e55. Malnic, B., 2007. Searching for the ligands of odorant receptors. Mol. Neurobiol. 35, 175e181. Malnic, B., Godfrey, P.A., Buck, L.B., 2004. The human olfactory receptor gene family. Proc. Natl. Acad. Sci. U. S. A. 101, 2584e2589. Nomiyama, H., Yoshie, O., 2015. Functional roles of evolutionary conserved motifs and residues in vertebrate chemokine receptors. J. Leukoc. Biol. 97, 39e47. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C.A., Motoshima, H., Fox, B.A., Trong, I.L., Teller, D.C., Okada, T., Stenkamp, R.E., Yamamoto, M., Miyano, M., 2000. Crystal structure of rhodopsin: a G protein-coupled receptor. Science 289, 739e745. Pluznick, J.L., Protzko, R.J., Gevorgyan, H., Peterlin, Z., Sipos, A., Han, J., Brunet, I., Wan, L.-X., Rey, F., Wang, T., Firestein, S.J., Yanagisawa, M., Gordon, J.I., Eichmann, A., Peti-Peterdi, J., Caplan, M.J., 2013. Olfactory receptor responding to gut microbiota-derived signals plays a role in renin secretion and blood pressure regulation. Proc. Natl. Acad. Sci. 110, 4410e4415. Pluznick, J.L., Zou, D.-J., Zhang, X., Yan, Q., Rodriguez-Gil, D.J., Eisner, C., Wells, E., Greer, C.A., Wang, T., Firestein, S., Schnermann, J., Caplan, M.J., 2009. Functional expression of the olfactory signaling system in the kidney. Proc. Natl. Acad. Sci. 106, 2059e2064. Primeaux, S., Braymer, H.D., Bray, G., 2013. High fat diet differentially regulates the expression of olfactory receptors in the duodenum of obesity-prone and obesity-resistant rats. Dig. Dis. Sci. 58, 72e76. Pronin, A., Levay, K., Velmeshev, D., Faghihi, M., Shestopalov, V.I., Slepak, V.Z., 2014. Expression of olfactory signaling genes in the eye. PLoS One 9, e96435. Smith, C.A., Roeszler, K.N., Ohnesorg, T., Cummins, D.M., Farlie, P.G., Doran, T.J., Sinclair, A.H., 2009. The avian Z-linked gene DMRT1 is required for male sex determination in the chicken. Nature 10, 267e271.
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
Contents lists available at ScienceDirect
Gene Expression Patterns journal homepage: http://www.elsevier.com/locate/gep
Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues Naomi L. Baker, Kerry A. Miller 1, Donald F. Newgreen, Peter G. Farlie* Murdoch Childrens Research Institute, Royal Children's Hospital, Parkville and Department of Paediatrics, University of Melbourne, Parkville, Australia
a r t i c l e i n f o
a b s t r a c t
Article history: Received 22 December 2014 Received in revised form 10 May 2015 Accepted 17 June 2015 Available online xxx
Background: Olfactory receptors were initially believed to be expressed specifically within the olfactory neurons. However, accumulating genome-scale data has recently demonstrated more extensive expression. There are hundreds of olfactory receptor family members and the realisation of their widespread expression provides an opportunity to reveal new biology. However, existing data is predominantly based on RT-PCR, microarray and RNA-seq approaches and the details of tissue and cell-type specific expression are lacking. Results: As a proof of principle, we selected Olfr603 for expression analysis. We generated an antibody against a non-conserved epitope of Olfr603 and characterised its expression in E8.5-E12.5 mouse embryos using immunohistochemistry. This analysis demonstrated a dynamic pattern of expression in diverse cell types within the developing embryo unrelated to the olfactory system. Expression was detected in migrating neural crest, endothelial precursors and vascular endothelium, endocardial cells, smooth muscle, neuroepithelium and within the ocular tissues. This complex distribution does not conform to any apparent germ layer or tissue origin. Conclusions: This initial characterisation of Olfr603 expression highlights the potential for a broad role for this receptor in the development of many tissues. © 2015 Elsevier B.V. All rights reserved.
Keywords: Olfactory receptor Embryonic expression Non-olfactory
The olfactory receptors are a large family of G protein-coupled receptors expressed within olfactory neurons (Buck and Axel, 1991). They bind small odorant molecules present at the surface of the nasal epithelium and are thought to facilitate olfaction through a combinatorial code mechanism in which multiple individual odorant signals are integrated centrally to provide specific recognition of complex smells. There are approximately 400 olfactory receptor genes in humans and 1200 in mice, making the olfactory receptors one of the largest gene families in vertebrates (Godfrey et al., 2004; Malnic et al., 2004). The olfactory receptors are most frequently single exon genes that commonly reside in clusters dispersed throughout the genome but can also exist as single isolated genes. The growth of olfactory receptor diversity appears to have been driven by multiple duplication events during evolution and the majority of highly related olfactory receptor subfamilies reside within a single genomic locus (Godfrey et al., 2004).
* Corresponding author. E-mail address: [email protected] (P.G. Farlie). 1 Present address: Clinical Genetics Group, Weatherall Institute of Molecular Medicine, University of Oxford, UK.
In addition, the olfactory receptor genes are often highly polymorphic and large olfactory receptor gene family clusters typically harbour >20% pseudogenes (Godfrey et al., 2004). Novel G proteincoupled receptors are typically assigned olfactory receptor status on the basis of sequence similarity to pre-existing olfactory receptors. Similarly, while a small proportion of olfactory receptors have had natural or (more typically) synthetic ligands identified, the majority are assigned proposed ligand binding characteristics based on sequence similarity to characterised receptors, although this situation is rapidly evolving with development of new bioinformatic and functional screening approaches (Malnic, 2007; Li et al., 2015). The olfactory receptors were originally believed to be expressed only by olfactory neurons within the olfactory epithelium but sporadic reports have demonstrated expression in other cell types including sperm, muscle, eye, kidney, intestine and heart (Fukuda ski et al., 2005; Braun et al., 2007; Griffin et al., 2004; Durzyn et al., 2009; Pluznick et al., 2009, 2013; Primeaux et al., 2013; Pronin et al., 2014; Kim et al., 2015). A recent systematic study in a panel of 16 adult human tissues demonstrated expression of 28% of all olfactory receptors in one or more tissue (Flegel et al., 2013).
http://dx.doi.org/10.1016/j.gep.2015.06.002 1567-133X/© 2015 Elsevier B.V. All rights reserved.
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
2
N.L. Baker et al. / Gene Expression Patterns xxx (2015) 1e6
Fig. 1. Validation of anti-Olfr603 antibody. (A) The Olfr603 peptide sequence used to raise the polyclonal antibody (bold) aligned with the 3 most closely related Olfr family members. (B) Western blot of crude protein extract from NIH 3T3 fibroblasts using affinity purified anti-Olfr603 with and without addition of a blocking peptide. The same blots were probed with anti-alpha tubulin as a loading control. (C) A miRNA knockdown of Olfr603 in NIH 3T3 fibroblasts. The miRNA expression is linked to GFP, Olfr603 expression is visualised in red. Pre-immune serum staining in parallel cultures produces no specific signal. Scale bar ¼ 10 mm.
Importantly, this study also demonstrated that human olfactory receptor pseudogenes are typically expressed at similar levels to functional olfactory receptors, at least at the RNA level. Similarly, expression data from publically available microarray and RNA-seq studies (NCBI GEO) suggest that expression of many olfactory receptors outside of the olfactory epithelium is common. Moreover, mouse olfactory receptor 23 (MOR23) has been shown to be required for myoblast fusion and muscle regeneration (Griffin et al., 2009) indicating that non-olfactory expression can have functional consequences. G protein-coupled receptors have diverse functions in biology including mediating vision (rhodopsin), blood pressure regulation (angiotensin receptor), embryonic patterning (Shh signalling, Smoothened), immune/haematopoietic function (CXC receptors) and many others (Jackson et al., 1988; Alcedo et al., 1996; Palczewski et al., 2000; Nomiyama and Yoshie, 2015). The ligands triggering signalling from these receptors are similarly diverse, ranging from photons, small molecule metabolites to peptides. Given the large size and largely uncharacterised nature of the
olfactory receptor family along with the diverse signalling functions of G protein-coupled receptors and the prospect of expression outside of the olfactory system, it is possible that some olfactory receptors, despite existing nomenclature, have a significant impact in a wide range of biological systems. As a first step in investigating this possibility we sought to confirm expression of olfactory receptors outside of the olfactory system during embryonic mouse development. The mouse Olfr603 gene, typical of most olfactory receptor genes, is encoded by a single 939 bp exon and is predicted to encode a 312 aa/35.4 kDa protein. The Olfr603 gene is unremarkable within the olfactory receptor family and is a typical example of the hundreds of uncharacterised olfactory receptors. We raised a polyclonal antibody against an extracellular epitope of Olfr603 present in a highly variable domain, minimising the potential for cross reaction with other, related olfactory receptors. The Olfr603 gene resides in a large cluster on chromosome 7, spanning 6.7 Mb which harbours 190 other olfactory receptors. Within this cluster is a very closely related family member Olfr596,
Fig. 2. Olfr603 expression in whole mount E8.5e10.5 embryos. (A) Lateral and (B) Dorsal view of flat-mounted E8.5 embryos, (C) Lateral view of an E9.5 embryo, (D) Lateral view of an E10.5 embryo. AeC are confocal images, D is an epifluorescence image. Arrowhead, allantois. Da, dorsal aorta; NP, neural plate, Hm, Head mesenchyme, Ot, otocyst; So, somite; H, heart; Um, umbilicus; At, atrium; V, ventricle. Scale bars (A) 200um, (B) 150um, (C) 200um, (D) 90um.
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
N.L. Baker et al. / Gene Expression Patterns xxx (2015) 1e6
3
Fig. 3. Transverse sections of E8.5 and E9.5 embryos. (AeC) E8.5, (DeI) E9.5. (I) Pre-immune control. Hm, head mesenchyme; V, vascular precursors; Bvg, bulbo ventricular groove; Lpm, lateral plate mesoderm; Ecp, prospective endocardial cells within the bulbo ventricular canal; Uv, umbilical vein; NC, neural crest; Dm, dermomyotome; Hg, hindgut; Da, dorsal aorta; Co, coelom; Bw; body wall; Al allantois; Np, neural plate. Magnification; AeD 20, E-I 10. Scale bar C ¼ 50 mm, F ¼ 100 mm.
which is highly conserved at the nucleotide level and 99% identical at the amino acid level. It is therefore difficult to distinguish between these two proteins using antibody-based assays (Fig. 1A). However, the epitope used is not predicted to produce an antibody that interacts strongly with any other olfactory receptors. Analysis of Olr603 within embryonic tissues reveals widespread expression in diverse cell types. 1. Results 1.1. Validation of anti-Olfr603 antibody specificity We characterised our custom, affinity purified anti-Olfr603
antibody using western blot of crude cell lysates. Mouse cell lines representing fibroblasts, chondrocytes and myoblasts demonstrated that expression of Olfr603 is widespread (not shown). We further characterised expression in NIH 3T3 cells demonstrating a single band at approximately 55 kDa, larger than the predicted molecular weight of 35 kDa. The specificity of this band was demonstrated through use of a blocking peptide corresponding to the epitope against which the antibody was raised (Fig. 1B). We further validated this antibody through transfection with two independent miRNA knockdown constructs directed against nonoverlapping sequences within Olfr603 using an expression vector in which production of miRNA is linked to GFP expression (Smith et al., 2009). Similar results were obtained with both sequences.
Fig. 4. Transverse sections of the neural tube in E9.5-E12.5 embryos. (A) E9.5, (BeD) E10.5, (EeH) E12.5. (A) Cranial neural tube and otocyst (arrowhead). (B) Thoracic level neural tube and dorsal root ganglion (arrow), (C) Pre-immune control section adjacent to section in B, (D) Caudal neural tube within the tail, (E) Thoracic level neural tube, dorsal root ganglion (arrow) and notochord (arrowhead), (FeH) Higher magnification view of (F) ventral neural tube, (G) notochord, (H) dorsal root ganglion. Magnification; A, D, E 10, B, C 20, G, H 40, Scale bars B ¼ 50 mm, E ¼ 100 mm, G ¼ 25 mm.
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
4
N.L. Baker et al. / Gene Expression Patterns xxx (2015) 1e6
Strongly transfected NIH 3T3 cells demonstrated loss of immunereactivity relative to non-transfected cells within the same culture (Fig. 1C) indicating specificity of the anti-Olfr603 antibody. The pre-immune serum produced no specific staining (Fig. 1C). 1.2. Immunofluorescence detection of Olfr603 in mouse embryos We first examined embryonic expression in whole mount E7.5e10.5 mouse embryos. There was no clear staining detected in E7.5 embryos suggesting that expression of Olfr603 begins between E7.5 and E8.5. Expression of Olfr603 was readily detected in all three stages examined and was widespread throughout embryonic tissues. At E8.5 expression was very strong in the allantois and extra-embryonic membranes (Fig. 2A,B). Moderate expression was detected throughout the neural plate but was strong in some mesodermal cells underlying the neural plate and within the dorsal aorta. At E9.5 expression was widespread and was prominent in the cranial neural tube, heart, somites and umbilicus but was weak in the otocyst (Fig. 2C). At E10.5 expression of Olfr603 was widespread and apparent in cells within most tissues. Sections of both whole mount stained embryos and direct staining of sections confirmed the broad expression of Olfr603 in early embryonic tissues. At E8.5 (Fig. 3AeD) prominently expressing populations include the head mesenchyme, vascular precursors adjacent to the neural tube, paraxial and lateral plate mesoderm and within isolated cells of the ectoderm. At E9.5 (Fig. 3EeI) expression was apparent in the somites, particularly in the dorsal, myotomal compartment and in the apical surface of somitic epithelial cells between adjacent somites. In the neural epithelium, expression was prominent at the basal surface of both the closed neural tube and the more caudal neural plate (Fig. 3G,H). In the most caudal neural plate, expression appeared to be distributed throughout the neuroepithelium (Fig. 3H). Expression was also apparent in endothelial cells lining the dorsal aorta and in the lateral plate (Fig. 3FeH). At cranial level in E9.5 embryos, expression was widespread throughout the neural tube. There is strong expression in cells distributed along the basal surface of the neuroepithelium which form a continuous stream of mesenchyme that can be seen passing over the otocyst, suggesting they are neural crest cells (Fig. 4A). At E10.5, expression remained widespread throughout the neuroepithelium within the junction between individual neuroepithelial cells and was present in the dorsal root ganglia (Fig. 4B,C). The prominent expression over the dorsal neural tube can also be seen in the caudal neural tube within the tail (Fig. 4D). At E12.5 Olfr603 is strongly expressed in the junctions between neuroepithelial cells and within the dorsal root ganglia (Fig. 4E,F,H). Chondrocytes within the prospective vertebrae were negative while the notochord strongly expressed Olfr603 along the entire length of the embryonic axis (Fig. 4E,G). Staining for Olfr603 in E16.5 embryos revealed staining in the dorsal root ganglia and spinal cord similar to that illustrated at E12.5 and in the umbilical mesenchyme (not shown). No staining above background could be detected in other tissues including kidney and intestine where a number of other olfactory receptors have previously been identified (Braun et al., 2007; Pluznick et al., 2009). Olfr603 is expressed in a range of cell types within the developing heart. At E9.5 expression was prominent in endocardial cells within the atria, ventricles and within the endocardial cushion and epicardium (Fig. 5B). At E10.5 the endocardial cushion within the atrio-ventricular canal remained strongly positive as did the endocardial cells of the developing ventricular trabeculae (Fig. 5A,D). At E10.5 the endocardial cells lining the aortic sac were also strongly positive for Olfr603 (Fig. 5C). At E10.5 expression is widespread within the cranial
mesenchyme between the forebrain and ectoderm (Fig. 5E). In addition, a polarized distribution of Olfr603 is apparent within the epithelial cells of both the retina and lens of the eye (Fig. 5E,G). At E11.5, expression is prominent within the epithelial precursor of the optic stalk (Fig. 5F). At E12.5 the expression of Olfr603 remains prominent within the developing lens, retina and optic stalk but can also be seen in the developing cornea (Fig. 5H). The association of Olfr603 expression with a number of vascular structures and endocardial cells prompted an investigation of the co-localization of Olfr603 with endothelial cells. We used PECAM as a marker of endothelial cells and their precursors. In E12.5 embryos
Fig. 5. Olfr603 expression in developing heart and eye. (A) E10.5 cranial neural tube, dorsal aorta (arrows) and heart including the endocardial cushion in atrio-ventricular canal (arrowhead) and trabeculae, (B) E9.5 atrio-ventricular canal (arrowhead) and epicardium (arrow), (C) E10.5 aortic sac lined with endocardial cells (arrowhead), (D) Pre-immune control adjacent to section in A, (E) E10.5 head mesenchyme (arrow), optic cup and lens, (F) E11.5 optic stalk (arrowhead), (G) Pre-immune control adjacent to section in E, (H) E12.5 eye and optic stalk. Magnification; B, C, D, H 10 A, E, F, G 20. Scale bars A, C, H ¼ 100 mm.
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
N.L. Baker et al. / Gene Expression Patterns xxx (2015) 1e6
5
Fig. 6. Co-expression of Olfr603 and PECAM at E12.5. (A) Transverse section through an E12.5 embryo stained for Olfr603 (green) and PECAM (red) illustrating co-expression in endothelial structures (arrows), (B) Aortic arch (arrow) harbouring endothelial cells expressing Olfr603 surrounded by Olfr603 expressing smooth muscle while the trachea and oesophagus (arrowheads) are negative, (C) Dorsal aorta, (D) Endocardial cells lining the trabeculae, (E) Eye in which the vascular plexus underlying the lens (arrowhead) is strongly double positive. (F) Olfr603 staining in a cranial blood vessel (arrow) imaged with FITC filter, (G) autofluorescence associated with image in F (Texas Red filter). Magnification; A, B, E 10, C, D 40. Scale bars A ¼ 100 mm, C ¼ 50 mm.
at trunk level, Olfr603 expression co-localizes with many endothelial lineage cells including precursors of the inter-somitic vessels, the dorsal aorta and the paired vessels underlying the neural tube as well as a number of other forming vascular structures (Fig. 6A). There is also co-localisation with the endothelial cells of the aortic arch which is surrounded by an Olfr603 positive smooth muscle layer (Fig. 6B). Notably, the trachea and oesophagus are negative for Olfr603 expression. At high magnification, the colocalisation of Olfr603 and PECAM in the dorsal aorta is apparent (Fig. 6C). Similarly, the PECAM positive endocardial cells also coexpress Olfr603 (Fig. 6D). In the developing eye, Olfr603 is coexpressed with PECAM positive endothelial cells in the forming vascular plexus underlying the lens and in the vasculature
underlying the retina (Fig 6E). Collectively, these data demonstrate widespread expression of Olfr603 within a range of developing mouse embryonic tissues during organogenesis. A number of studies have provided preliminary demonstration of a potential non-olfactory function for olfactory receptors such as MOR23. These observations together with the growing evidence for extra-olfactory expression of olfactory receptors highlight the potential for diverse functions outside of the olfactory neurons during embryonic development. 2. Experimental procedures Antibody production. A rabbit polyclonal antibody was raised
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002
6
N.L. Baker et al. / Gene Expression Patterns xxx (2015) 1e6
against the first extra-cellular domain of olfactory receptor 603 using the peptide MPSNNETASHPSLFHLLGIPGLEA conjugated to KLH (Genscript, USA). The anti-serum was affinity purified using a GST-fusion peptide of the immunising peptide. The affinity purified antibody was used at a 1:300 dilution for both whole mount, sections and cells and was detected using 1:1600 goat anti-rabbit conjugated to Alexa 488 (Jackson Lab, MP A11008). All tissues (derived from C57Bl6 mice) and cells were fixed in 4% PFA for 30 min and blocked with 1% BSA, 0.1% Triton X-100. For western blot, the antibody was used at 1:2500 and detected with a 1:8000 dilution of goat anti-rabbit HRP (Cell Signalling, 7074). Mouse antitubulin (Sigma, T6793) was used at 1:8000 and detected with antimouse HRP (Chemicon AP326P) diluted 1:10000. Western blot detection was performed with ECL Prime (GE Healthcare). miRNA knockdown. Two independent sequences were cloned into the pRmiR2 vector (Smith et al., 2009). The sequences were KD1: TTCAAAGCTTATCTCCCTAAG, KD2: TGCCATGACAGCCACCACTTT and were designed using the Invitrogen Block-It RNAi designer. NIH 3T3 cells were transiently transfected using Fugene HD (Promega Australia) and fixed in 4% PFA 48 h after transfection. Acknowledgements This work was supported by NHMRC Australia grant number 1002660 and the MCRI was supported by the Victorian Government's Operational Infrastructure Support Program. References Alcedo, J., Ayzenzon, M., Von Ohlen, T., Noll, M., Hooper, J.E., 1996. The drosophila smoothened gene encodes a seven-pass membrane protein, a putative receptor for the Hedgehog signal. Cell 86, 221e232. Braun, T., Voland, P., Kunz, L., Prinz, C., Gratzl, M., 2007. Enterochromaffin cells of the human gut: sensors for spices and odorants. Gastroenterology 132, 1890e1901. Buck, L., Axel, R., 1991. A novel multigene family may encode odorant receptors: a molecular basis for odor recognition. Cell 65, 175e187. ski Ł, Gaudin J-C., Myga, M., Szydłowski, J., Go zefiak, A., Haertle , T., Durzyn zdzicka-Jo
2005. Olfactory-like receptor cDNAs are present in human lingual cDNA libraries. Biochem. Biophys. Res. Commun. 333, 264e272. Flegel, C., Manteniotis, S., Osthold, S., Hatt, H., Gisselmann, G., 2013. Expression profile of ectopic olfactory receptors determined by deep sequencing. PLoS One 8, e55368. Fukuda, N., Yomogida, K., Okabe, M., Touhara, K., 2004. Functional characterization of a mouse testicular olfactory receptor and its role in chemosensing and in regulation of sperm motility. J. Cell Sci. 117, 5835e5845. Godfrey, P.A., Malnic, B., Buck, L.B., 2004. The mouse olfactory receptor gene family. Proc. Natl. Acad. Sci. U. S. A. 101, 2156e2161. Griffin, C.A., Kafadar, K.A., Pavlath, G.K., 2009. MOR23 promotes muscle regeneration and regulates cell adhesion and migration. Dev. Cell. 17, 649e661. Jackson, T.R., Blair, L.A.C., Marshall, J., Goedert, M., Hanley, M.R., 1988. The mas oncogene encodes an angiotensin receptor. Nature 335, 437e440. Kim, S.-H., Yoon, Y.C., Lee, A.S., Kang, N., Koo, J., Rhyu, M.-R., Park, J.-H., 2015. Expression of human olfactory receptor 10J5 in heart aorta, coronary artery, and endothelial cells and its functional role in angiogenesis. Biochem. Biophys. Res. Commun. 460 (2), 404e408. Li, J., Haddad, R., Santos, V., Bavan, S., Luetje, C.W., 2015. Receptive range analysis of a mouse odorant receptor subfamily. J. Neurochem. 134 (1), 47e55. Malnic, B., 2007. Searching for the ligands of odorant receptors. Mol. Neurobiol. 35, 175e181. Malnic, B., Godfrey, P.A., Buck, L.B., 2004. The human olfactory receptor gene family. Proc. Natl. Acad. Sci. U. S. A. 101, 2584e2589. Nomiyama, H., Yoshie, O., 2015. Functional roles of evolutionary conserved motifs and residues in vertebrate chemokine receptors. J. Leukoc. Biol. 97, 39e47. Palczewski, K., Kumasaka, T., Hori, T., Behnke, C.A., Motoshima, H., Fox, B.A., Trong, I.L., Teller, D.C., Okada, T., Stenkamp, R.E., Yamamoto, M., Miyano, M., 2000. Crystal structure of rhodopsin: a G protein-coupled receptor. Science 289, 739e745. Pluznick, J.L., Protzko, R.J., Gevorgyan, H., Peterlin, Z., Sipos, A., Han, J., Brunet, I., Wan, L.-X., Rey, F., Wang, T., Firestein, S.J., Yanagisawa, M., Gordon, J.I., Eichmann, A., Peti-Peterdi, J., Caplan, M.J., 2013. Olfactory receptor responding to gut microbiota-derived signals plays a role in renin secretion and blood pressure regulation. Proc. Natl. Acad. Sci. 110, 4410e4415. Pluznick, J.L., Zou, D.-J., Zhang, X., Yan, Q., Rodriguez-Gil, D.J., Eisner, C., Wells, E., Greer, C.A., Wang, T., Firestein, S., Schnermann, J., Caplan, M.J., 2009. Functional expression of the olfactory signaling system in the kidney. Proc. Natl. Acad. Sci. 106, 2059e2064. Primeaux, S., Braymer, H.D., Bray, G., 2013. High fat diet differentially regulates the expression of olfactory receptors in the duodenum of obesity-prone and obesity-resistant rats. Dig. Dis. Sci. 58, 72e76. Pronin, A., Levay, K., Velmeshev, D., Faghihi, M., Shestopalov, V.I., Slepak, V.Z., 2014. Expression of olfactory signaling genes in the eye. PLoS One 9, e96435. Smith, C.A., Roeszler, K.N., Ohnesorg, T., Cummins, D.M., Farlie, P.G., Doran, T.J., Sinclair, A.H., 2009. The avian Z-linked gene DMRT1 is required for male sex determination in the chicken. Nature 10, 267e271.
Please cite this article in press as: Baker, N.L., et al., Olfr603, an orphan olfactory receptor, is expressed in multiple specific embryonic tissues, Gene Expression Patterns (2015), http://dx.doi.org/10.1016/j.gep.2015.06.002