- Email: [email protected]
Oligodendrocyte differentiation from human neural stem cells: A novel role for c-Src
Neurochemistry International 120 (2018) 21–32
Contents lists available at ScienceDirect
Neurochemistry International journal homepage: www.elsevier.com/locate/neuint
Oligodendrocyte differentiation from human neural stem cells: A novel role for c-Src
T
Le Wanga,c, Caitlin R. Schlagala, Junling Gaoa, Yan Haoa,d, Tiffany J. Dunna, Erica L. McGratha, Javier Allende Labastidaa, Yongjia Yub, Shi-qing Fengd, Shao-yu Liuc, Ping Wua,∗ a
Department of Neuroscience, Cell Biology and Anatomy, University of Texas Medical Branch, 301 University Blvd, Galveston, TX, 77555, USA Department of Radiation Oncology, University of Texas Medical Branch, 301 University Blvd, Galveston, TX, 77555, USA c Department of Spine Surgery, The First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan Er Rd, Yuexiu Qu, Guangzhou Shi, Guangdong Sheng, China d Department of Orthopedics, Tianjin Medical University General Hospital, 154 Anshan Rd, Heping Qu, 300051, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Oligodendrocyte precursor cells Remyelination Src family kinases Differentiation Human neural stem cells
Human neural stem cells (hNSCs) can differentiate into an oligodendrocyte lineage to facilitate remyelination in patients. Molecular mechanisms underlying oligodendrocyte fate specification remains unknown, hindering the development of efficient methods to generate oligodendrocytes from hNSCs. We have found that Neurobasal-A medium (NB) is capable of inducing hNSCs to oligodendrocyte progenitor cells (OPCs). We identified several signaling molecules are altered after cultivation in NB medium, including Akt, ERK1/2 and c-Src. While sustained activation of Akt and ERK1/2 during both NB induction and subsequent differentiation was required for OPC differentiation, c-Src phosphorylation was increased temporally during the period of NB induction. Both pharmacological inhibition and RNA interference confirmed that a transient elevation of phospho-c-Src is critical for OPC induction. Furthermore, inactivation of c-Src inhibited phosphorylation of Akt and ERK1/2. In summary, we identified a novel and critical role of c-Src in guiding hNSC differentiation to an oligodendrocyte lineage.
1. Introduction Remyelination, important for demyelinating diseases and following neurotrauma, involves the restoration of myelin through the generation of oligodendrocytes from oligodendrocyte progenitor cells (OPCs) (Menn et al., 2006). As a potential source for replacing lost oligodendrocytes and facilitating remyelination in patients, human neural stem cells (hNSCs) have been tested for their capacity to generate oligodendrocytes. Although most previous studies show only a small percentage of oligodendrocytes produced from hNSCs, either in culture dishes or after transplantation into animal brains or spinal cords (Brüstle et al., 1998; Flax et al., 1998; Fricker et al., 1999; Vescovi et al., 1999; Caldwell et al., 2001; Tarasenko et al., 2007), a few studies reported significant induction of hNSCs into oligodendrocyte lineage by various strategies such as Dulbecco's modified Eagle's medium with F12
(DF) medium plus N2 components, triiodo-L-thyronine (T3), sonic hedgehog (Shh), neurotrophin-3 (NT-3), basic fibroblast growth factor (bFGF), and platelet-derived growth factor-AA (PDGF-AA) (Neri et al., 2010; Monaco et al., 2012). We investigated the role of Neurobasal-A (NB) medium, and not the regular hNSC cultivation medium DF, to induce hNSCs toward OPC differentiation. In terms of media, NB is a type of basic medium that provides all necessary electrolytes, amino acids and vitamins and was developed to optimize the maintenance of hippocampal neurons in cultures with low levels of astrocytes. NB in combination with B27 medium was reported to enhance the survival of primary cultured rat OPCs (Yang et al., 2005). During early development of oligodendrocytes, cells went through several successtive stages that can be distinquished by surface markers such as A2B5 and O4 (Gard and Pfeiffer, 1990). A2B5+O4- cells represent the earliest polupation of this
Abbreviations: hNSCs, human neural stem cells; OPC, oligodendrocyte precursor cell; NB, neurobasal-A medium; DF, Dulbecco's modified Eagle's medium with F12, triiodo-L-thyronine (T3), sonic hedgehog (Shh), neurotrophin-3 (NT3), basic fibroblast growth factor (bFGF), and platelet-derived growth factor-AA (PDGF-AA); EGF, epidermal growth factor; bFGF, basic fibroblast growth factor; LIF, leukemia inhibitory factor; PI3K, phosphoinositide 3-kinase; AKT, RAC-alpha serine/threonineprotein kinase; ERK, extracellular signal-regulated kinase ∗ Corresponding author. John S. Dunn Distinguished Chair in Neurological Recovery, Department of Neuroscience, Cell Biology & Anatomy, University of Texas Medical Branch, 301 University Blvd., Bldg. 17, Rm 4.212-B, Galveston, TX, 77555-0620, USA. E-mail address: [email protected] (P. Wu). https://doi.org/10.1016/j.neuint.2018.07.006 Received 14 March 2018; Received in revised form 28 June 2018; Accepted 18 July 2018 Available online 21 July 2018 0197-0186/ © 2018 Elsevier Ltd. All rights reserved.
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
lineage; whereas O4+ cells are OPCs that are refractory to astroglial and meningeal signals, and programed to become oligodendrocytes. Although physiologically, hNSCs are capable of differentiation into oligodendrocytes, inducing them to generate a large quantity of oligodendrocytes in a timely manner has proven difficult (Armstrong and Svendsen, 2000). In addition, the molecular mechanisms underlying NSC differentiation and maturation into oligodendrocytes are complex and remain largely unknown, thus hindering the effective use of stem cell-derived oligodendrocytes for basic research and clinical applications. Our study aimed to characterize the role and underlying mechanisms of NB in OPC differentiation as this has not been investigated. Here, we used several methods to investigate the mechanisms of NB mediated-oligodendrocyte differentiation from hNSCs. Additionally, cSrc, a non-receptor protein tyrosine kinase, has been reported to be associated with cell survival and proliferation, but its role in oligodendrocyte differentiation from NSCs has not been studied (Colognato et al., 2004; Wang et al., 2014b). We therefore explored c-Src activation in OPC induction.
overnight, followed by addition of the Detection Antibody Cocktail, washes, and addition of streptavidin-conjugated horseradish peroxidase. The arrays were then developed using an enhanced chemiluminescence (ECL) system. 2.3. Western blot analyses To evaluate cell signaling activation levels, Western blot analyses of different protein samples were performed in all of the groups as previously described (Tarasenko et al., 2004). Briefly, cells were lysed with sodium dodecyl sulfate (SDS) lysis buffer and then sonicated briefly before centrifugation for 10 min at 4 °C. Supernatant was removed and quantified by using a BCA protein quantification kit (Pierce, Rockford, IL). The specific primary antibodies used were as follows: rabbit polyclonal anti-AKT, anti-phospho-AKT (Ser473), anti-p44/42 MAP kinase, and anti-phospho-p44/42 MAP kinase (Thr202/Tyr204) (Cell Signaling Technology, USA), as well as rabbit anti-c-Src and anti-p-c-Src (Tyr 419) IgG (Santa Cruz, USA). All antibodies were used at a dilution of 1:500. The Western blot analysis procedures were performed as previously described with slight modifications. Briefly, total protein was extracted and separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis. The bands were visualized using an enhanced chemiluminescence detection system. All blots were first probed for the phosphorylated proteins. Then, the blots were stripped (Restore; Pierce Biotechnology, Rockford, IL) and re-probed for the corresponding unphosphorylated proteins. Finally, the blots were probed for GAPDH as a loading control (1:1000). The protein bands were compared using ImageJ version 1.32 (NIH, USA).
2. Materials and methods 2.1. Cell culture All of the experimental protocols and procedures used in this study were approved by the Experimental Ethics Committee of the University of Texas Medical Branch. The NSC cell line K048, which was originally obtained from cortical brain tissue of human fetuses (10 weeks), was derived and provided by Dr. C.N. Svendsen (Svendsen et al., 1998; Wu et al., 2002). These cells were expanded as neurospheres in DMEM/F12 (DF medium) containing epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), and leukemia inhibitory factor (LIF)(R&D Systems, Minneapolis, MN) according to a previously reported procedure and were passaged every 10 days as previously described (Tarasenko et al., 2004). For cell FHL priming, 2 × 106 K048 cells were cultured for 3 days in T25 flasks to form small hNSCs spheres. The 3-day spheres were plated in T25 flasks that had been precoated with 0.01% poly-D-lysine and 1 μg/cm2 mouse laminin (Invitrogen/Gibco, Carlsbad, CA) and were incubated with FHL priming medium containing 10 ng/ml bFGF, 2.5 μg/ml heparin (Sigma, St. Louis, MO), and 1 μg/ml laminin (Tarasenko et al., 2004). For OPC differentiation induction, K048 cells that had been cultured in DF medium were cultured in NB medium for 1 passage (10 days) as a pre-differentiation phase and then in FHL priming medium for 4 days. After the cells were primed, the medium was replaced with differentiation medium (DM), which was based on NB medium but contained a reduced amount of N2 supplement (25μg/ml bovine insulin, 58 μg/ml transferrin, 58 μM putrescine, 11.6 nM progesterone, 17.4 nM sodium selenite (Sigma)) and 20 ng/ml T3(Sigma). The cells were then cultured for 14–21 days (Fig. 1A). For immunostaining, cells were plated on precoated German glass coverslips (Carolina Biological Supply) at a density of 1.5 × 105 cells/ well in 24-well plates.
2.4. Inhibitor treatments To investigate the cell signaling pathways and the role of c-Src, phosphoinositide 3-kinase (PI3K)/Akt and extracellular signal-regulated kinases (ERK) 1/2 activation in the induction of hNSC differentiation into OPCs, K048 cells were treated with 3 types of inhibitors at specific time points. Saracatinib (a c-Src inhibitor, 10 nM), LY294002 (a specific PI3K inhibitor, 1 μM), and U0126 (a MEK1/2 kinase activity inhibitor, 5 μM) were administered on day 7 of NB culturing or at 12 h into the 3 days of NB/FHL priming in NB medium. Dose of Saracatinib was chosen after testing different concentrations in K048 cells based on the literature (from 10 nM to 1 μM) (Simpkins et al., 2012; Nam et al., 2013; Rutledge et al., 2014). A concentration of 10 nM was selected due to an effect on the K048 cells with no detrimental effect on cell number. Concentration of inhibitor, LY294002 and U0126, was based on our previous experiments (Jordan et al., 2009). 2.5. Short hairpin RNA knockdown Sigma Mission shRNA plasmids were screened and used to knock down the expression of the human SRC gene in hNSCs through lentiviral (LV) transduction as described previously (Ojeda et al., 2011). Green fluorescent protein (GFP) was linked to the shRNA sequence as a visible marker. LV-GFP was included as a control. After the cells underwent 4-day FHL priming, they were fixed for immunofluorescent staining or collected for RNA analyses. Inducible LV-SRC was constructed based on pLK0.1puro (Sigma).
2.2. Protein array Protein samples of K048 cells cultured in DF medium or cultured and pre-primed in NB medium were identified and screened using a PathScan® RTK Signaling Antibody Array Kit (CST), which detects the indicated RTKs and key signaling nodes only when they are phosphorylated at tyrosine or other specified residues. Briefly, cells from T25 flasks in different groups were extracted with Cell Lysis Buffer (with PMSF) according to the PathScan® Antibody Array Kit protocol, and washed with PBS. Then the lysed cells were micro-centrifuged, and the supernatant was diluted to 1.0 mg/ml in Array Diluent Buffer. Proteins from each group was incubated with the blocking buffer
2.6. RNA analyses Total RNA was extracted and subjected to real-time RT-PCR as previously described (Jordan et al., 2009). The primer sequences for oligodendrocyte lineage transcription factors and internal controls were as follows: GAPDH: GAAGGTGAAG GTCGGAGTC (forward), GAAGATGGTGATGGGATTTC (reverse); Olig2: AAGCTAGGAGGCAGTGGCTTCAAGTC (forward), CCGTCACCAGTCGC 22
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
(caption on next page)
23
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 1. Induction of OPCs from hNSCs cultured in DF or NB medium. (a) Schematic of the procedures for OPC induction: hNSCs in the NB or DF group were cultured in NB or DF medium, respectively, for 1 passage (10 days), and then FHL priming was performed for 4 days. (b) After the cells underwent 1 passage (10 days) in NB medium (NB group) followed by 4-day priming with FHL, more hNSCs differentiated into OPC-like cells than those cells that were cultured in DF medium (DF group). OPC-like cells were quantitated by morphology which was defined as small cell body compared to neurons and bipolar/multipolar morphology with tertiary branches. (c) Immunostaining with O4+ and A2B5+ reveals that NB promoted the differentiation of hNSCs into OPCs. (e) Real-time RT-PCR reveals an increase in the expression levels of early oligodendrocyte lineage transcription factors Olig2, Sox10, and Nkx2.2 in NB-cultured hNSCs compared to cells cultured in DF medium. GAPDH was used as the internal control. *p < 0.05, **p < 0.01, mean ± SD, Student's t-test or one-way ANOVA with post hoc tests. Scale bar, 50 μm.
hNSC-differentiated OPC-like cells was greater in the NB group than that in the DF group. Next, we used immunofluorescent staining for A2B5 (a marker for glial cells or oligodendrocyte precursor cells) and O4 (a premature or mature oligodendrocyte marker) to confirm oligodendrocyte lineage differentiation on day 4 of the NB/FHL priming phase. The percentages of A2B5+ cells were 85.2% in the NB group and 45.8% in the DF group (Fig. 1c). Similarly, the percentage of O4+ cells was 51.6% in the NB group and 9.7% in the DF group (Fig. 1d). Overall, NB group showed significantly higher percentages of both O4+ and A2B5+ cells, which is consistent with the morphological results. Using real-time RT-PCR we examined the expression levels of oligodendrocyte-related transcription factors. Specifically, we evaluated the levels of Olig2, Sox10 and Nkx2.2 gene expression at day 7 of culturing the proliferating cells in either DF medium (DF7) or NB medium (NB7), as well as on day 1 or day 4 of NB/FHL priming in the DF group (DP1 and DP4) and the NB group (NP1 and NP4) (red asterisks; Fig. 1a). Our results showed a significant increase of the expression of the early oligodendrocyte lineage transcription factor Olig2 after NB/FHL priming in both groups (Fig. 1e). The normalized fold increases of DP1 and DP4 over DF7 were 8.7 and 5.4, respectively (Fig. 1e). More interestingly, using the NB medium resulted in a higher increase in Olig2 expression (Fig. 1e). The normalized fold changes over DF7 were as follows: NB7, 463 ± 198.9; NP1, 286.6 ± 144.4; and NP4, 157.9 ± 34.7. Increased expression of Sox10, a marker for the early oligodendrocyte lineage, was also evident in the NB-cultivated hNSCs (Fig. 1e, left). Compared to cells cultured in DF medium (DF7), there were no significant changes in Sox10 expression in the DP1 and DP4 samples. In contrast, the normalized fold changes over DF7 were significant in cells treated with NB medium: NB7, 2.3 ± 0.3; NP1, 2.77 ± 0.21; and NP4, 2.8 ± 0.4 (Fig. 1e, middle). Nkx2.2, an oligodendrocyte lineage marker regulated by Olig 2 and Sox10, was not detectable in the DF7, DP1 or DP4 groups but could be detected in the NB7, NP1 and NP4 samples (Fig. 1e, right).
TTCATC (reverse); Nkx2.2: TCTACGACAGCAGCGACAAC (forward), GAACCAGATCTTGACCTGCG (reverse); SOX10: CCTCACAGATCGCCT ACACC (forward), CATATAGGAGAAGGCCGAGTAGA (reverse); and SRC: GAGCGGCTCCAGATTGTCAA (forward), CTGGGGATGTAGCCTG TCTGT (reverse). Real-time quantitative RT-PCR to analyze the genes listed above was performed by the Real-Time PCR Core Facility at UTMB using the Applied Biosystems (ABI) Prism 7000 Sequence Detection System. PCR was performed on an ABI 7000 PCR machine with the following cycling parameters: uracil N-glycosylase (UNG) activation at 50 °C for 2 min, AmpliTaq activation at 95 °C for 10 min, denaturation at 95 °C for 15 s, and annealing/extension at 60 °C for 1 min (repeated 40 times). Duplicate CT values were analyzed in Microsoft Excel using the comparative CT (ΔΔCT) method as described by the manufacturer (Applied Biosystems). Values for Olig2 or other products (2–ΔΔCT) were normalized to the value for the endogenous reference (GAPDH) and then to a calibrator (one of the experimental samples). 2.7. Immunofluorescence and imaging Immunofluorescent staining was performed according to our previous descriptions (Jordan et al., 2009). Cells were fixed for 30 min in 4% paraformaldehyde for cytoplasmic antigens and for 20 min in 4% paraformaldehyde for surface antigens. The primary antibodies used were mouse monoclonal anti-O4, 1:500 (R&D Systems); anti-A2B5, 1:250 (R&D Systems); anti-Olig2, 1:500 (Abcam); and anti-SOX10, 1:500 (Abcam). Secondary antibodies included Alexa 488 goat-anti rabbit and Alexa 594 goat-anti mouse at 1:500 dilutions (Abcam). Images were acquired using either a Nikon 80i epifluorescence microscope or a Nikon D-Eclipse C1 confocal system. Image J software was used for immunofluorescence quantification. Double labeling of A2B5 or O4 (red) and DAPI (blue) was counted, and considered positive if nucleated cells were confirmed for each staining in the mono-labeling panels. 2.8. Statistical analyses
3.2. NB-mediated sustained activation of Akt, ERK1/2, and transient increase of c-Src during OPC differentiation
All analyses included at least three independent experiments unless otherwise stated. For immunofluorescent staining of cultured cells, specific labeling was counted from 9 randomly selected fields from three coverslips. All statistical analyses were performed using Student's t-test and one-way ANOVA with the aid of GraphPad Prism software (GraphPad Software, Inc., CA, USA) or SPSS 17.0 (IBM, USA).
To identify the pathway(s) responsible for the NB-mediated induction of hNSC differentiation into OPCs, we performed an initial screen using a Signaling Antibody Array Kit, which detects receptor tyrosine kinases (RTKs) and key signaling molecules when they are phosphorylated at tyrosine or other specified residues. This initial screen showed that compared to cells cultured in DF medium, the phosphorylation levels of ERK1/2 and Akt remained elevated after NB cultivation (NB7) and FHL priming (NP1), whereas phospho-c-Src temporarily increased after NB cultivation and then decreased after FHL priming (Supplemental Fig. 1). After the initial screen was performed, we focused on the three pathways with detectable changes in phosphorylation and used Western blot analysis to first validate the phosphorylation of Akt and ERK1/2 in protein samples at various time points (Fig. 2a–c). We chose days 1, 4 and 7 of culturing the proliferating cells in DF or NB medium (labeled as DF1, DF4, and DF7 or as NB1, NB4, and NB7, respectively); and days 1, 2 and 4 during NB/FHL priming for the DF group (DP1, DP2 and DP4, respectively) and the NB group (NP1, NP2 and NP4, respectively).
3. Results 3.1. NB medium induces OPC differentiation from human NSCs We separated human fetal forebrain-derived K048 cells into 2 groups, DF and NB. Cells in the DF group were cultured in DF medium for 10 days and then transferred to NB/FHL medium in accordance with the priming procedures. Cells in the NB group were cultured in NB media for 10 days and then transferred to priming media (Fig. 1a). From the NB group, the percentage of cells classified as OPC-like based on their morphology (small, nearly round cell body, multiple processes with tertiary branches) was 57.7%, whereas this percentage was only 12.2% in the DF group (Fig. 1b). Our data indicated that the number of 24
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 2. Using Western blotting, the levels of (a) ERK1/2 and (b) Akt phosphorylation were increased during NB culturing and were sustained throughout the subsequent FHL priming procedure to promote OPC differentiation. Levels of c-Src phosphorylation (c) increased during NB culturing but then decreased during FHL priming. *p < 0.05 and **p < 0.01 compared with DF1; #p < 0.05 compared with DP1; mean ± SD, one-way ANOVA with post hoc tests.
period compared with DF1, and ERK1/2 phosphorylation peaked at NB7 (Fig. 2a). This increase in ERK1/2 phosphorylation was sustained throughout the subsequent FHL priming procedure, although it showed a slight decrease after NP1. We also show a similar trend for Akt activation following OPC
As shown in Fig. 2a, ERK1/2 phosphorylation levels remained relatively low during the DF cultivation stage (DF1, DF4 and DF7) but increased significantly following FHL priming (DP1, DP2 and DP4). In contrast, switching hNSCs to NB medium resulted in a much higher increase in ERK1/2 phosphorylation throughout the NB cultivation 25
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
with LV-SRC resulted in an 88% reduction in c-Src mRNA expression as analyzed by real-time RT-PCR (Fig. 4a). c-Src knockdown was accompanied by significant decreases in the expression levels of the oligodendrocyte-determining transcription factors Olig2, Sox10 and Nkx2.2 (Fig. 4a). Second, we used immunohistochemistry to assess the effect of c-Src knockdown on OPC differentiation. LV-SRC-mediated c-Src interference significantly decreased the number of hNSC-derived OPCs, shown as 27.8% OLIG2+/GFP+, 22.8% SOX10+/GFP+ and 25.8% O4+/GFP+, compared to 70% OLIG2+/GFP+, 60% SOX10+/GFP+ and 78% O4+/GFP+ cells in the GFP control group (Fig. 4b–d).
induction. The levels of Akt phosphorylation in the DP2 and DP4 samples were higher than that in the DF1 sample (Fig. 2b). Notably, earlier and higher increases in Akt activation were evident in the NB group as shown in the NB4 and NB7 samples, as compared to the DF cultivation stage, and sustained throughout the subsequent FHL priming procedure, with the peak increase at NP1 (Fig. 2b). We then assessed the levels of c-Src phosphorylation at the same time points as described above (Fig. 2c). There were no significant differences in the c-Src phosphorylation (Tyr419) levels among all DF groups. In contrast, the c-Src phosphorylation level increased after cultivating hNSCs in NB and peaked in the NB7 sample. The levels of phospho-c-Src decreased in the NP1, NP2 and NP4 samples and returned to the level of DF1. Thus, NB cultivation resulted in transient cSrc activation, which was accompanied by NB-mediated induction of OPCs from hNSCs.
3.5. Pharmacological inhibition of Akt decreases the induction of OPC differentiation Our results show Akt phosphorylation was altered following the NB induction of hNSCs. We then asked whether modulating Akt activity affects OPC differentiation. LY294002, a specific inhibitor of the Akt upstream signal molecule PI3K, was administered starting either on day 7 of NB culturing or at 12 h after NB/FHL priming (Fig. 3a). This inhibitor was also added once daily for 3 days, and then the primed cells were fixed and immune-stained for O4 and A2B5. As shown in Fig. 5a–b, inhibiting the PI3K/Akt pathway during the NB stage (NB7 LY) of OPC induction significantly lowered the percentages of O4+ and A2B5+ cells: 9.8% O4+ and 15.6% A2B5+ cells compared to 51.8% O4+ and 46.8% A2B5+ cells in the NB7 Control group. The administration of LY294002 starting at the later stage of OPC induction, i.e., 12 h after NB/FHL priming (Priming LY), also significantly decreased the percentages of O4 and A2B5 cells in hNSCs: 11.7% O4+ and 15.5% A2B5+ cells compared to 55.8% O4+ and 56.8% A2B5+ cells in the Priming Control group (Fig. 5a–b). Such reductions in OPC differentiation from hNSCs were accompanied by significant decreases in the OPC transcription factors (Olig2 Nkx2.2 and Sox10) as evaluated by qRT-PCR. The levels of Olig2, Nkx2.2 and Sox10 mRNA expression in the NB7 LY and Priming LY group were significantly lower than those in the NB7 Control group and Priming Control group, respectively (Fig. 5c).
3.3. Elevation of phosphorylated c-Src in a narrow time window is critical for OPC induction To establish a cause-effect role of c-Src in NB-mediated OPC differentiation, we utilized pharmacology to inhibit c-Src activity during the pre-priming (NB) or priming (NP) phase (Fig. 3a). Saracatinib, a cSrc inhibitor, was administered once daily for 3 days; on day 7 of NB culturing (NB7, the time point with peak c-Src phosphorylation) or at 12 h after the NB/FHL priming (Priming). Western blot analysis was conducted 1 day following the last administration of saracatinib or DMSO (Supplemental Fig. 2). Our results showed that the inhibitor significantly suppressed c-Src phosphorylation, demonstrating the efficacy of saracatinib. Following saracatinib (NB7 Sara) or control (NB7 Ctrl) treatment, cells were primed for 4 days. We then fixed the cells and examined expression of O4, A2B5, OLIG2 and SOX10 using immunohistochemistry (Fig. 3b–e). Saracatinib-mediated c-Src inhibition resulted in a significant reduction of OPC differentiation from hNSCs, as shown by lower percentages of A2B5+, O4+, OLIG2+ and SOX10+ cells in the NB7 Sara group (21.5% A2B5+, 11.5% O4+, 27.3% OLIG2+, and 21.4% SOX10+) compared to the percentages in the NB7 Ctrl group (46.8% A2B5+, 51.8% O4+, 67.3% OLIG2+, and 39% SOX10+) (Fig. 3b–e). We then examined the effects of saracatinib administration 12 h after NB/FHL priming and saw that it did not inhibit A2B5, OLIG2 or SOX10 expression. There were 58.8% A2B5+ cells in the Priming Sara group, compared to 56.8% in the Priming Control group (Fig. 3f). Interestingly, saracatinib significantly increased the percentage of O4+ cells in the Priming Sara group at 67.1% O4+, compared to 55.8% O4+ cells in the Priming Control group (Fig. 3g). For OLIG2, the Priming Sara group had 65.5% OLIG2+ cells, while Priming Control had 62.6% OLIG2+ cells (Fig. 3h). SOX10 also followed this trend with 39.4% SOX10+ in Priming Sara and 40.2% SOX10+ cells in Priming Control (Fig. 3i). We then conducted real-time RT-PCR to evaluate the mRNA levels of the OPC-related transcription factors Olig2, Nkx2.2 and Sox10 following saracatinib treatment. Our results were consistent with our histochemical data. As shown in Fig. 3j, saracatinib treatment during the NB induction stage (NB7 Sara) significantly reduced the mRNA levels of Olig2, Nkx2.2 and Sox10. In contrast, delayed saracatinib treatment in the priming stage (Priming Sara) did not affect the expression of these OPC transcription factors.
3.6. Pharmacological inhibition of ERK1/2 decreases the induction of OPC differentiation Due to the increase of ERK1/2 phosphorylation following OPC induction in hNSCs, we wanted to investigate whether ERK1/2 activation is important for OPC differentiation. U0126, a selective inhibitor for the ERK1/2 upstream signal MEK1/2, was administered at day 7 of NB culturing (NB7 U0126) or 12 h after NB/FHL priming (Priming U0126) (Fig. 6). The inhibitor was also added once daily for 3 days, and the primed cells were then fixed and immune-stained for O4 and A2B5. Inhibiting ERK1/2 starting at NB-7 significantly reduced OPC differentiation with 10.5% O4+ and 14.5% A2B5+ cells in the NB7 U0126 group compared to 51.8% O4+ and 46.8% A2B5+ cells in the NB7 Control group (Fig. 6a–b). The administration of U0126 at 12 h after NB/FHL priming also decreased the percentages of O4 and A2B5 cells in the Priming U0126 group by 55.8% and 46.9%, respectively (Fig. 6a–b). Furthermore, changes in the levels of the transcription factors Olig2, Nkx2.2, and Sox10 mRNA expression as evaluated by qRT-PCR were consistent with the above-mentioned histochemical data. Specifically, the levels of Olig2, Nkx2.2 and Sox10 mRNA expression in the NB7 U0126 and the Priming U0126 groups were significantly lower than those in the corresponding controls (Fig. 6c).
3.4. RNA interference confirms the critical role of c-Src in NB-mediated OPC induction from hNSCs
3.7. Crosstalk between the Akt and ERK1/2 signaling pathways To further confirm the role of c-Src in OPC differentiation of hNSCs, we used a lentiviral (LV) vector containing a c-Src short hairpin RNA (LV-SRC) to knock down expression of the human c-Src gene in hNSCs that were cultured in NB for 7 days. First, treating NB-cultured hNSCs
We used specific inhibitors of c-Src, Akt and ERK1/2 to investigate the relationship among these three key signaling molecules during the differentiation of hNSCs into OPCs. As shown in Fig. 7a, c-Src 26
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 3. Pharmacological inhibition of c-Src by inhibitors during the pre-priming phase. (a) Saracatinib, a specific c-Src inhibitor, was administered on day 7 of NB culturing (NB7 Sara) or at 12 h into NB/FHL priming (Priming Sara). After the cells underwent FHL priming for 4 days, the cells were fixed and stained for (b) A2B5, (c) O4, (d) Olig2 and (e) SOX10 on the last day of the NB/FHL priming procedure. (f-i) Administration of saracatinib at 12 h on NB/FHL priming stained for (f) A2B5, (g) O4, (h) Olig2 or (i) SOX10 expression. (j) RNA expression levels following treatment with saracatinib during the NB induction stage (NB7 Sara) or priming (Priming Sara). Treatment at NB7 significantly reduced the mRNA levels of Olig2, Nkx2.2 and Sox10. Delayed treatment in the priming stage did not affect the expression of these OPC transcription factors. *p < 0.05, **p < 0.01 mean ± SD, Student's t-test or one-way ANOVA with post hoc tests. Scale bar, 50 μm. 27
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 4. SRC shRNA silencing of c-Src mRNA during NB culturing. (a) RT-PCR was conducted to analyze the levels of the transcription factor SRC and of the oligodendrocyte-determining factors Olig2, Nkx2.2, and SOX10. (b-d) In the GFP group, the percentage of GFP+ cells that were also O4+ was 78.15 ± 9.25%, and the percentages of Olig2+/ GFP+ and SOX10+/GFP+ cells were 69.95 ± 11.25% and 59.85 ± 9.82%, respectively. In the LV group, the percentage of GFP+ cells that were also O4+ was 25.78 ± 8.28%, and the percentages of Olig2+/GFP+ and SOX10+/GFP+ cells were 22.75 ± 5.46% and 27.78 ± 8.75%, respectively. **p < 0.01; mean ± SD, Student's ttest. Scale bar, 50 μm.
28
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
phosphorylation was significantly reduced only by c-Src inhibitor saracatinib but not by Akt inhibitor LY294002 or ERK1/2 inhibitor U0126. The phosphorylation level of Akt was significantly decreased by both saracatinib and LY294002 (Fig. 7b). All three inhibitors significantly lowered the level of ERK1/2 phosphorylation (Fig. 7c). Taken together, our data indicate that there is sequential activation of c-Src, Akt and ERK1/2 following NB-induced OPC differentiation of hNSCs. 4. Discussion and conclusion The present study demonstrates a NB medium-based method to efficiently induce hNSCs toward the oligodendrocyte lineage. Several groups have previously reported various methods to induce hNSC differentiation into OPCs or oligodendrocytes. These methods used DF medium and required the addition of FGF2, PDGF-AA and NT-3 (Neri et al., 2010; Almad et al., 2011; Monaco et al., 2012). The latter two supplements have been well documented as oligodendrocyte-promoting factors (Raff et al., 1988; Lachyankar et al., 1997). Here, we further demonstrate that NB medium in combination with FGF2 without PDGF and NT-3 is sufficient to induce the majority of hNSCs (nearly 60%) to become O4+ OPCs within 2 weeks of induction, a result compatible with the effectiveness of other methods. Under the same culture conditions, however, DMEM significantly reduced OPC differentiation from hNSCs. Taken together, these studies indicate that both growth/trophic factors and culture media contribute to oligodendrocyte fate specification from hNSCs in vitro. NB medium has also been demonstrated to inhibit the proliferation of certain cell types (Kleinsimlinghaus et al., 2013) and to allow the culture of OPCs under conditions of low cell density (Yang et al., 2005). Here, we further demonstrate that NB medium has the ability to promote hNSC differentiation toward the oligodendrocyte lineage. To better understand the molecular control of oligodendrocyte fate specification, it is important to investigate the mechanisms underlying the impact of NB medium on hNSC differentiation into oligodendrocytes. Mechanistically, we identified several signaling molecules/ pathways, namely, c-Src, Akt, and ERK1/2, that contribute to this NB medium-induced OPC differentiation of hNSCs. Our findings of Akt and ERK1/2 phosphorylation are consistent with previous reports demonstrating the importance of the PI3K/Akt and MEK/ERK signaling cascades in OPC differentiation (Cui et al., 2005; Bibollet-Bahena and Almazan, 2009; Fyffe-Maricich et al., 2011). The discovery of c-Src here made it a novel candidate for a role in oligodendrocyte progenitor formation. As a member of the Src family of non-receptor protein tyrosine kinases (Ballaré et al., 2003; Colognato et al., 2004; Wang et al., 2014b), c-Src was previously known to be an important signaling molecule for survival and proliferation in cancer cells (Jin et al., 2008). Although several members of the Src family (Fyn, Lyn and Src) are expressed by oligodendrocytes (Colognato et al., 2004), only Fyn was previously reported to mediate various oligodendrocyte functions, such as migration, differentiation, axonal contact and myelination initiation (Brewer and Cotman, 1989; Umemori et al., 1994; Pérez et al., 2013). c-Src is encoded by the SRC gene, comprising a SH2 domain, an SH3 domain and a tyrosine kinase domain (Ballaré et al., 2003). Thus far c-Src has been reported in association with cell survival and proliferation, but most researches focused on cancer cells and the underlying relationship is still not completely clear (Jin et al., 2008). Studies have reported that c-Src activates the PI3K/Akt and MAPK intracellular pathway, primarily through FAK pathway-dependent or non-dependent pathway (Jones et al., 2000). c-Src in PC12 cells are thought to be related to NGF-mediated down-regulation of EGF receptor expression, and this study also found that c-Src was involved in the activation of the MAPK pathway (Kremer et al., 1991). In COS-7 cells, another research showed that c-Src activation could activate Erk1/2 pathway through Ras/Raf (Kremer et al., 1991). In addition, it was demonstrated that in a variety of tumor cells, c-Src could activate PI3K pathway by the TrkC/c-Src
Fig. 5. Pharmacological inhibition of Akt decreased the induction of OPC differentiation. (a–b) The primed cells were fixed and stained for O4 and A2B5 after FHL priming for 4 days. The results showed that the percentages of O4+ and A2B5+ cells in the NB7 LY group were significantly lower than those in the NB7 DMSO group. (c) RNA expression levels of Olig2, Nkx2.2 and SOX10 in the NB7D LY group were lower than were those in the NB7D Control group, and those in the Priming LY group were lower than were those in the Priming Control group. **p < 0.01; mean ± SD, Student's t-test. Scale bar, 50 μm.
29
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 6. Pharmacological inhibition of ERK1/2 decreased the induction of OPC differentiation. U0126, a specific MEK1/2 inhibitor, was administered on day 7 of NB culturing (NB7 U0126) or at 12 h into NB/FHL priming (Priming U0126). (a-b) The primed cells were fixed and stained for O4 and A2B5 after FHL priming for 4 days. The results showed that the percentages of O4+ and A2B5+ cells in the NB7 U0126 group were significantly lower than those in the NB7 DMSO group. The primed cells were fixed and stained for O4 and A2B5 after FHL priming for 4 days. (c) RNA levels of Olig2, Nkx2.2 and SOX10 in the NB7 U0126 group were lower than were those in the NB7 Control group, and those in the Priming U0126 group were lower than were those in the Priming Control group. *p < 0.05, **p < 0.01; mean ± SD, Student's t-test. Scale bar, 50 μm.
the regulation of c-Src. The critical timing of c-Src activation during oligodendrocyte induction was further confirmed by its effect on the expression of oligodendrocyte-related transcription factors. Specifically, we discovered that inhibition of c-Src kinase activity or knockdown of c-Src expression by RNA interference significantly reduced the expression levels of Olig2, Nkx2.2 and SOX10. All these transcription factors are known to play important roles in oligodendrocyte differentiation (Sun et al., 2001; Lu et al., 2002; Takebayashi et al., 2002; Talbott et al., 2005; Wang et al., 2014a). In contrast, we found that sustained activation of Akt and ERK1/2 pathways was required for NB-induced elevation of Olig2, Nkx2.2 and SOX10 expression, whereas inhibiting these signaling pathways resulted in reduced expression of these transcription factors accompanied by decreased hNSC differentiation into OPCs. Along this line, our finding that the ERK1/2 pathway is required for the expression of oligodendrocyte-related transcription factors and oligodendrocyte differentiation is consistent with previous reports. Specifically, several studies have shown that ERK1/2 activation was required to up-regulate the level of Olig2 expression and/or promote oligodendrocyte differentiation from NSCs (Bhat and Zhang, 1996; Hu et al., 2008). Furthermore, Akt signaling has been found to be important for Sox10 expression in OPCs (Watatani et al., 2012).
complex (Jin et al., 2008). The results of this study show that NSC differentiation to oligodendrocyte requires activation of c-Src, PI3K/Akt and Erk1/2. More importantly, we discovered a novel role of c-Src in OPC specification, which requires a transient activation of c-Src within a limited time window. Inhibition of c-Src, Akt and Erk1/2 phosphorylation could inhibit NSC differentiation into oligodendrocytes. Our study further indicated that c-Src is upstream from the Akt and ERK1/2 pathways during the NB-induced oligodendrocyte differentiation from hNSCs. This conclusion is drawn from the fact that inhibition of c-Src phosphorylation also blocked Akt and ERK1/2 phosphorylation, whereas the level of c-Src phosphorylation was not suppressed by blocking Akt and ERK1/2 activation. Similar relations among c-Src, Akt and ERK1/2 have also been demonstrated in other cellular events, such as cancer cell motility and neurite outgrowth (Kremer et al., 1991; Jones et al., 2000; Wu et al., 2012; Wang et al., 2014b). Furthermore, we identified a crosstalk between the Akt and ERK1/2 pathways during the NB-induced OPC induction, i.e. inhibiting Akt activity resulted in a significant reduction in ERK1/2 phosphorylation. This type of crosstalk has been increasingly appreciated recently as a common phenomenon that ensures a fine balance of parallel signaling pathways (Aksamitiene et al., 2012). These results indicated that Akt and Erk1/2 pathway activation is subject to
30
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 7. Specific inhibition of key signaling molecules to determine pathway crosstalk. (a) c-Src phosphorylation was significantly reduced by c-Src inhibitor, saracatinib, but was unaffected by Akt inhibitor LY294002 or ERK1/2 inhibitor U0126. (b) Akt phosphorylation was significantly decreased by both saracatinib and LY294002. (c) ERK1/2 phosphorylation was significantly affected by all three inhibitors, *p < 0.05, mean ± SD, one-way ANOVA with post hoc tests.
Based on the data presented in this study we conclude that Neurobasal medium induces human neural stem cells toward the oligodendrocyte lineage via a transient activation of c-Src signaling molecule and the subsequent sustained activation of the Akt and ERK1/2 pathways. This study may shed lights on developing novel strategies to promote stem cell-based therapy for oligodendrocyte-related neurological disorders. Conflicts of interest We have no conflicts of interest to disclose. All authors have read and approved the final version of the manuscript. Acknowledgments This work was supported by TIRR Mission Connect, the Gillson Longenbaugh Foundation (#012-103), the Chinese Scholar Council, and the John S. Dunn Research Foundation. Appendix A. Supplementary data Supplementary data related to this article can be found at https:// doi.org/10.1016/j.neuint.2018.07.006. References Aksamitiene, E., Kiyatkin, A., Kholodenko, B.N., 2012. Cross-talk between mitogenic Ras/ MAPK and survival PI3K/Akt pathways: a fine balance. Biochem. Soc. Trans. 40 (1), 139–146. Almad, A., Sahinkaya, F.R., McTigue, D.M., 2011. Oligodendrocyte fate after spinal cord injury. Neurotherapeutics 8 (2), 262–273. Armstrong, R.J., Svendsen, C.N., 2000. Neural stem cells: from cell biology to cell replacement. Cell Transplant. 9 (2), 139–152. Ballaré, C., Uhrig, M., Bechtold, T., Sancho, E., Di Domenico, M., Migliaccio, A., Auricchio, F., Beato, M., 2003. Two domains of the progesterone receptor interact with the estrogen receptor and are required for progesterone activation of the c-Src/ Erk pathway in mammalian cells. Mol. Cell Biol. 23 (6), 1994–2008. Bhat, N.R., Zhang, P., 1996. Activation of mitogen-activated protein kinases in oligodendrocytes. J. Neurochem. 66 (5), 1986–1994. Bibollet-Bahena, O., Almazan, G., 2009. IGF-1-stimulated protein synthesis in oligodendrocyte progenitors requires PI3K/mTOR/Akt and MEK/ERK pathways. J. Neurochem. 109 (5), 1440–1451. Brewer, G.J., Cotman, C.W., 1989. Survival and growth of hippocampal neurons in defined medium at low density: advantages of a sandwich culture technique or low oxygen. Brain Res. 494 (1), 65–74. Brüstle, O., Choudhary, K., Karram, K., Hüttner, A., Murray, K., Dubois-Dalcq, M., McKay, R.D., 1998. Chimeric brains generated by intraventricular transplantation of fetal human brain cells into embryonic rats. Nat. Biotechnol. 16 (11), 1040–1044. Caldwell, M.A., He, X., Wilkie, N., Pollack, S., Marshall, G., Wafford, K.A., Svendsen, C.N., 2001. Growth factors regulate the survival and fate of cells derived from human neurospheres. Nat. Biotechnol. 19 (5), 475–479. Colognato, H., Ramachandrappa, S., Olsen, I.M., ffrench-Constant, C., 2004. Integrins direct Src family kinases to regulate distinct phases of oligodendrocyte development. J. Cell Biol. 167 (2), 365–375. Cui, Q.L., Zheng, W.H., Quirion, R., Almazan, G., 2005. Inhibition of Src-like kinases reveals Akt-dependent and -independent pathways in insulin-like growth factor Imediated oligodendrocyte progenitor survival. J. Biol. Chem. 280 (10), 8918–8928. Flax, J.D., Aurora, S., Yang, C., Simonin, C., Wills, A.M., Billinghurst, L.L., Jendoubi, M., Sidman, R.L., Wolfe, J.H., Kim, S.U., Snyder, E.Y., 1998. Engraftable human neural stem cells respond to developmental cues, replace neurons, and express foreign genes. Nat. Biotechnol. 16 (11), 1033–1039. Fricker, R.A., Carpenter, M.K., Winkler, C., Greco, C., Gates, M.A., Björklund, A., 1999. Site-specific migration and neuronal differentiation of human neural progenitor cells after transplantation in the adult rat brain. J. Neurosci. 19 (14), 5990–6005. Fyffe-Maricich, S.L., Karlo, J.C., Landreth, G.E., Miller, R.H., 2011. The ERK2 mitogenactivated protein kinase regulates the timing of oligodendrocyte differentiation. J. Neurosci. 31 (3), 843–850.
31
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
reduces arrhythmia inducibility and connexin43 dysregulation after myocardial infarction. J. Am. Coll. Cardiol. 63 (9), 928–934. Simpkins, F., Hevia-Paez, P., Sun, J., Ullmer, W., Gilbert, C.A., da Silva, T., Pedram, A., Levin, E.R., Reis, I.M., Rabinovich, B., Azzam, D., Xu, X.X., Ince, T.A., Yang, J.Y., Verhaak, R.G., Lu, Y., Mills, G.B., Slingerland, J.M., 2012. Src Inhibition with saracatinib reverses fulvestrant resistance in ER-positive ovarian cancer models in vitro and in vivo. Clin. Canc. Res. 18 (21), 5911–5923. Sun, T., Echelard, Y., Lu, R., Yuk, D.I., Kaing, S., Stiles, C.D., Rowitch, D.H., 2001. Olig bHLH proteins interact with homeodomain proteins to regulate cell fate acquisition in progenitors of the ventral neural tube. Curr. Biol. 11 (18), 1413–1420. Svendsen, C.N., ter Borg, M.G., Armstrong, R.J., Rosser, A.E., Chandran, S., Ostenfeld, T., Caldwell, M.A., 1998. A new method for the rapid and long term growth of human neural precursor cells. J. Neurosci. Meth. 85 (2), 141–152. Takebayashi, H., Nabeshima, Y., Yoshida, S., Chisaka, O., Ikenaka, K., 2002. The basic helix-loop-helix factor olig2 is essential for the development of motoneuron and oligodendrocyte lineages. Curr. Biol. 12 (13), 1157–1163. Talbott, J.F., Loy, D.N., Liu, Y., Qiu, M.S., Bunge, M.B., Rao, M.S., Whittemore, S.R., 2005. Endogenous Nkx2.2+/Olig2+ oligodendrocyte precursor cells fail to remyelinate the demyelinated adult rat spinal cord in the absence of astrocytes. Exp. Neurol. 192 (1), 11–24. Tarasenko, Y.I., Gao, J., Nie, L., Johnson, K.M., Grady, J.J., Hulsebosch, C.E., McAdoo, D.J., Wu, P., 2007. Human fetal neural stem cells grafted into contusion-injured rat spinal cords improve behavior. J. Neurosci. Res. 85 (1), 47–57. Tarasenko, Y.I., Yu, Y., Jordan, P.M., Bottenstein, J., Wu, P., 2004. Effect of growth factors on proliferation and phenotypic differentiation of human fetal neural stem cells. J. Neurosci. Res. 78 (5), 625–636. Umemori, H., Sato, S., Yagi, T., Aizawa, S., Yamamoto, T., 1994. Initial events of myelination involve Fyn tyrosine kinase signalling. Nature 367 (6463), 572–576. Vescovi, A.L., Parati, E.A., Gritti, A., Poulin, P., Ferrario, M., Wanke, E., FrölichsthalSchoeller, P., Cova, L., Arcellana-Panlilio, M., Colombo, A., Galli, R., 1999. Isolation and cloning of multipotential stem cells from the embryonic human CNS and establishment of transplantable human neural stem cell lines by epigenetic stimulation. Exp. Neurol. 156 (1), 71–83. Wang, J., Pol, S.U., Haberman, A.K., Wang, C., O'Bara, M.A., Sim, F.J., 2014a. Transcription factor induction of human oligodendrocyte progenitor fate and differentiation. Proc. Natl. Acad. Sci. U. S. A. 111 (28), E2885–E2894. Wang, L., Wei, F.X., Cen, J.S., Ping, S.N., Li, Z.Q., Chen, N.N., Cui, S.B., Wan, Y., Liu, S.Y., 2014b. Early administration of tumor necrosis factor-alpha antagonist promotes survival of transplanted neural stem cells and axon myelination after spinal cord injury in rats. Brain Res. 1575, 87–100. Watatani, K., Hirabayashi, Y., Itoh, Y., Gotoh, Y., 2012. PDK1 regulates the generation of oligodendrocyte precursor cells at an early stage of mouse telencephalic development. Gene Cell. 17 (4), 326–335. Wu, P., Tarasenko, Y.I., Gu, Y., Huang, L.Y., Coggeshall, R.E., Yu, Y., 2002. Region-specific generation of cholinergic neurons from fetal human neural stem cells grafted in adult rat. Nat. Neurosci. 5 (12), 1271–1278. Wu, W., Sun, Z., Wu, J., Peng, X., Gan, H., Zhang, C., Ji, L., Xie, J., Zhu, H., Ren, S., Gu, J., Zhang, S., 2012. Trihydrophobin 1 phosphorylation by c-Src regulates MAPK/ERK signaling and cell migration. PLoS One 7 (1), e29920. Yang, Z., Watanabe, M., Nishiyama, A., 2005. Optimization of oligodendrocyte progenitor cell culture method for enhanced survival. J. Neurosci. Meth. 149 (1), 50–56.
Gard, A.L., Pfeiffer, S.E., 1990. Two proliferative stages of the oligodendrocyte lineage (A2B5+O4- and O4+GalC-) under different mitogenic control. Neuron 5 (5), 615–625. Hu, J.G., Fu, S.L., Wang, Y.X., Li, Y., Jiang, X.Y., Wang, X.F., Qiu, M.S., Lu, P.H., Xu, X.M., 2008. Platelet-derived growth factor-AA mediates oligodendrocyte lineage differentiation through activation of extracellular signal-regulated kinase signaling pathway. Neuroscience 151 (1), 138–147. Jin, W., Yun, C., Jeong, J., Park, Y., Lee, H.D., Kim, S.J., 2008. c-Src is required for tropomyosin receptor kinase C (TrkC)-induced activation of the phosphatidylinositol 3-kinase (PI3K)-AKT pathway. J. Biol. Chem. 283 (3), 1391–1400. Jones, R.J., Brunton, V.G., Frame, M.C., 2000. Adhesion-linked kinases in cancer; emphasis on src, focal adhesion kinase and PI 3-kinase. Eur. J. Canc. 36 (13 Spec No), 1595–1606. Jordan, P.M., Ojeda, L.D., Thonhoff, J.R., Gao, J., Boehning, D., Yu, Y., Wu, P., 2009. Generation of spinal motor neurons from human fetal brain-derived neural stem cells: role of basic fibroblast growth factor. J. Neurosci. Res. 87 (2), 318–332. Kleinsimlinghaus, K., Marx, R., Serdar, M., Bendix, I., Dietzel, I.D., 2013. Strategies for repair of white matter: influence of osmolarity and microglia on proliferation and apoptosis of oligodendrocyte precursor cells in different basal culture media. Front. Cell. Neurosci. 7, 277. Kremer, N.E., D'Arcangelo, G., Thomas, S.M., DeMarco, M., Brugge, J.S., Halegoua, S., 1991. Signal transduction by nerve growth factor and fibroblast growth factor in PC12 cells requires a sequence of src and ras actions. J. Cell Biol. 115 (3), 809–819. Lachyankar, M.B., Condon, P.J., Quesenberry, P.J., Litofsky, N.S., Recht, L.D., Ross, A.H., 1997. Embryonic precursor cells that express Trk receptors: induction of different cell fates by NGF, BDNF, NT-3, and CNTF. Exp. Neurol. 144 (2), 350–360. Lu, Q.R., Sun, T., Zhu, Z., Ma, N., Garcia, M., Stiles, C.D., Rowitch, D.H., 2002. Common developmental requirement for Olig function indicates a motor neuron/oligodendrocyte connection. Cell 109 (1), 75–86. Menn, B., Garcia-Verdugo, J.M., Yaschine, C., Gonzalez-Perez, O., Rowitch, D., AlvarezBuylla, A., 2006. Origin of oligodendrocytes in the subventricular zone of the adult brain. J. Neurosci. 26 (30), 7907–7918. Monaco, M.C., Maric, D., Bandeian, A., Leibovitch, E., Yang, W., Major, E.O., 2012. Progenitor-derived oligodendrocyte culture system from human fetal brain. JoVE 70. Nam, H.J., Im, S.A., Oh, D.Y., Elvin, P., Kim, H.P., Yoon, Y.K., Min, A., Song, S.H., Han, S.W., Kim, T.Y., Bang, Y.J., 2013. Antitumor activity of saracatinib (AZD0530), a cSrc/Abl kinase inhibitor, alone or in combination with chemotherapeutic agents in gastric cancer. Mol. Canc. Therapeut. 12 (1), 16–26. Neri, M., Maderna, C., Ferrari, D., Cavazzin, C., Vescovi, A.L., Gritti, A., 2010. Robust generation of oligodendrocyte progenitors from human neural stem cells and engraftment in experimental demyelination models in mice. PLoS One 5 (4), e10145. Ojeda, L., Gao, J., Hooten, K.G., Wang, E., Thonhoff, J.R., Dunn, T.J., Gao, T., Wu, P., 2011. Critical role of PI3K/Akt/GSK3β in motoneuron specification from human neural stem cells in response to FGF2 and EGF. PLoS One 6 (8), e23414. Pérez, M.J., Fernandez, N., Pasquini, J.M., 2013. Oligodendrocyte differentiation and signaling after transferrin internalization: a mechanism of action. Exp. Neurol. 248, 262–274. Raff, M.C., Lillien, L.E., Richardson, W.D., Burne, J.F., Noble, M.D., 1988. Platelet-derived growth factor from astrocytes drives the clock that times oligodendrocyte development in culture. Nature 333 (6173), 562–565. Rutledge, C.A., Ng, F.S., Sulkin, M.S., Greener, I.D., Sergeyenko, A.M., Liu, H., Gemel, J., Beyer, E.C., Sovari, A.A., Efimov, I.R., Dudley, S.C., 2014. c-Src kinase inhibition
32
Contents lists available at ScienceDirect
Neurochemistry International journal homepage: www.elsevier.com/locate/neuint
Oligodendrocyte differentiation from human neural stem cells: A novel role for c-Src
T
Le Wanga,c, Caitlin R. Schlagala, Junling Gaoa, Yan Haoa,d, Tiffany J. Dunna, Erica L. McGratha, Javier Allende Labastidaa, Yongjia Yub, Shi-qing Fengd, Shao-yu Liuc, Ping Wua,∗ a
Department of Neuroscience, Cell Biology and Anatomy, University of Texas Medical Branch, 301 University Blvd, Galveston, TX, 77555, USA Department of Radiation Oncology, University of Texas Medical Branch, 301 University Blvd, Galveston, TX, 77555, USA c Department of Spine Surgery, The First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan Er Rd, Yuexiu Qu, Guangzhou Shi, Guangdong Sheng, China d Department of Orthopedics, Tianjin Medical University General Hospital, 154 Anshan Rd, Heping Qu, 300051, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Oligodendrocyte precursor cells Remyelination Src family kinases Differentiation Human neural stem cells
Human neural stem cells (hNSCs) can differentiate into an oligodendrocyte lineage to facilitate remyelination in patients. Molecular mechanisms underlying oligodendrocyte fate specification remains unknown, hindering the development of efficient methods to generate oligodendrocytes from hNSCs. We have found that Neurobasal-A medium (NB) is capable of inducing hNSCs to oligodendrocyte progenitor cells (OPCs). We identified several signaling molecules are altered after cultivation in NB medium, including Akt, ERK1/2 and c-Src. While sustained activation of Akt and ERK1/2 during both NB induction and subsequent differentiation was required for OPC differentiation, c-Src phosphorylation was increased temporally during the period of NB induction. Both pharmacological inhibition and RNA interference confirmed that a transient elevation of phospho-c-Src is critical for OPC induction. Furthermore, inactivation of c-Src inhibited phosphorylation of Akt and ERK1/2. In summary, we identified a novel and critical role of c-Src in guiding hNSC differentiation to an oligodendrocyte lineage.
1. Introduction Remyelination, important for demyelinating diseases and following neurotrauma, involves the restoration of myelin through the generation of oligodendrocytes from oligodendrocyte progenitor cells (OPCs) (Menn et al., 2006). As a potential source for replacing lost oligodendrocytes and facilitating remyelination in patients, human neural stem cells (hNSCs) have been tested for their capacity to generate oligodendrocytes. Although most previous studies show only a small percentage of oligodendrocytes produced from hNSCs, either in culture dishes or after transplantation into animal brains or spinal cords (Brüstle et al., 1998; Flax et al., 1998; Fricker et al., 1999; Vescovi et al., 1999; Caldwell et al., 2001; Tarasenko et al., 2007), a few studies reported significant induction of hNSCs into oligodendrocyte lineage by various strategies such as Dulbecco's modified Eagle's medium with F12
(DF) medium plus N2 components, triiodo-L-thyronine (T3), sonic hedgehog (Shh), neurotrophin-3 (NT-3), basic fibroblast growth factor (bFGF), and platelet-derived growth factor-AA (PDGF-AA) (Neri et al., 2010; Monaco et al., 2012). We investigated the role of Neurobasal-A (NB) medium, and not the regular hNSC cultivation medium DF, to induce hNSCs toward OPC differentiation. In terms of media, NB is a type of basic medium that provides all necessary electrolytes, amino acids and vitamins and was developed to optimize the maintenance of hippocampal neurons in cultures with low levels of astrocytes. NB in combination with B27 medium was reported to enhance the survival of primary cultured rat OPCs (Yang et al., 2005). During early development of oligodendrocytes, cells went through several successtive stages that can be distinquished by surface markers such as A2B5 and O4 (Gard and Pfeiffer, 1990). A2B5+O4- cells represent the earliest polupation of this
Abbreviations: hNSCs, human neural stem cells; OPC, oligodendrocyte precursor cell; NB, neurobasal-A medium; DF, Dulbecco's modified Eagle's medium with F12, triiodo-L-thyronine (T3), sonic hedgehog (Shh), neurotrophin-3 (NT3), basic fibroblast growth factor (bFGF), and platelet-derived growth factor-AA (PDGF-AA); EGF, epidermal growth factor; bFGF, basic fibroblast growth factor; LIF, leukemia inhibitory factor; PI3K, phosphoinositide 3-kinase; AKT, RAC-alpha serine/threonineprotein kinase; ERK, extracellular signal-regulated kinase ∗ Corresponding author. John S. Dunn Distinguished Chair in Neurological Recovery, Department of Neuroscience, Cell Biology & Anatomy, University of Texas Medical Branch, 301 University Blvd., Bldg. 17, Rm 4.212-B, Galveston, TX, 77555-0620, USA. E-mail address: [email protected] (P. Wu). https://doi.org/10.1016/j.neuint.2018.07.006 Received 14 March 2018; Received in revised form 28 June 2018; Accepted 18 July 2018 Available online 21 July 2018 0197-0186/ © 2018 Elsevier Ltd. All rights reserved.
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
lineage; whereas O4+ cells are OPCs that are refractory to astroglial and meningeal signals, and programed to become oligodendrocytes. Although physiologically, hNSCs are capable of differentiation into oligodendrocytes, inducing them to generate a large quantity of oligodendrocytes in a timely manner has proven difficult (Armstrong and Svendsen, 2000). In addition, the molecular mechanisms underlying NSC differentiation and maturation into oligodendrocytes are complex and remain largely unknown, thus hindering the effective use of stem cell-derived oligodendrocytes for basic research and clinical applications. Our study aimed to characterize the role and underlying mechanisms of NB in OPC differentiation as this has not been investigated. Here, we used several methods to investigate the mechanisms of NB mediated-oligodendrocyte differentiation from hNSCs. Additionally, cSrc, a non-receptor protein tyrosine kinase, has been reported to be associated with cell survival and proliferation, but its role in oligodendrocyte differentiation from NSCs has not been studied (Colognato et al., 2004; Wang et al., 2014b). We therefore explored c-Src activation in OPC induction.
overnight, followed by addition of the Detection Antibody Cocktail, washes, and addition of streptavidin-conjugated horseradish peroxidase. The arrays were then developed using an enhanced chemiluminescence (ECL) system. 2.3. Western blot analyses To evaluate cell signaling activation levels, Western blot analyses of different protein samples were performed in all of the groups as previously described (Tarasenko et al., 2004). Briefly, cells were lysed with sodium dodecyl sulfate (SDS) lysis buffer and then sonicated briefly before centrifugation for 10 min at 4 °C. Supernatant was removed and quantified by using a BCA protein quantification kit (Pierce, Rockford, IL). The specific primary antibodies used were as follows: rabbit polyclonal anti-AKT, anti-phospho-AKT (Ser473), anti-p44/42 MAP kinase, and anti-phospho-p44/42 MAP kinase (Thr202/Tyr204) (Cell Signaling Technology, USA), as well as rabbit anti-c-Src and anti-p-c-Src (Tyr 419) IgG (Santa Cruz, USA). All antibodies were used at a dilution of 1:500. The Western blot analysis procedures were performed as previously described with slight modifications. Briefly, total protein was extracted and separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis. The bands were visualized using an enhanced chemiluminescence detection system. All blots were first probed for the phosphorylated proteins. Then, the blots were stripped (Restore; Pierce Biotechnology, Rockford, IL) and re-probed for the corresponding unphosphorylated proteins. Finally, the blots were probed for GAPDH as a loading control (1:1000). The protein bands were compared using ImageJ version 1.32 (NIH, USA).
2. Materials and methods 2.1. Cell culture All of the experimental protocols and procedures used in this study were approved by the Experimental Ethics Committee of the University of Texas Medical Branch. The NSC cell line K048, which was originally obtained from cortical brain tissue of human fetuses (10 weeks), was derived and provided by Dr. C.N. Svendsen (Svendsen et al., 1998; Wu et al., 2002). These cells were expanded as neurospheres in DMEM/F12 (DF medium) containing epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), and leukemia inhibitory factor (LIF)(R&D Systems, Minneapolis, MN) according to a previously reported procedure and were passaged every 10 days as previously described (Tarasenko et al., 2004). For cell FHL priming, 2 × 106 K048 cells were cultured for 3 days in T25 flasks to form small hNSCs spheres. The 3-day spheres were plated in T25 flasks that had been precoated with 0.01% poly-D-lysine and 1 μg/cm2 mouse laminin (Invitrogen/Gibco, Carlsbad, CA) and were incubated with FHL priming medium containing 10 ng/ml bFGF, 2.5 μg/ml heparin (Sigma, St. Louis, MO), and 1 μg/ml laminin (Tarasenko et al., 2004). For OPC differentiation induction, K048 cells that had been cultured in DF medium were cultured in NB medium for 1 passage (10 days) as a pre-differentiation phase and then in FHL priming medium for 4 days. After the cells were primed, the medium was replaced with differentiation medium (DM), which was based on NB medium but contained a reduced amount of N2 supplement (25μg/ml bovine insulin, 58 μg/ml transferrin, 58 μM putrescine, 11.6 nM progesterone, 17.4 nM sodium selenite (Sigma)) and 20 ng/ml T3(Sigma). The cells were then cultured for 14–21 days (Fig. 1A). For immunostaining, cells were plated on precoated German glass coverslips (Carolina Biological Supply) at a density of 1.5 × 105 cells/ well in 24-well plates.
2.4. Inhibitor treatments To investigate the cell signaling pathways and the role of c-Src, phosphoinositide 3-kinase (PI3K)/Akt and extracellular signal-regulated kinases (ERK) 1/2 activation in the induction of hNSC differentiation into OPCs, K048 cells were treated with 3 types of inhibitors at specific time points. Saracatinib (a c-Src inhibitor, 10 nM), LY294002 (a specific PI3K inhibitor, 1 μM), and U0126 (a MEK1/2 kinase activity inhibitor, 5 μM) were administered on day 7 of NB culturing or at 12 h into the 3 days of NB/FHL priming in NB medium. Dose of Saracatinib was chosen after testing different concentrations in K048 cells based on the literature (from 10 nM to 1 μM) (Simpkins et al., 2012; Nam et al., 2013; Rutledge et al., 2014). A concentration of 10 nM was selected due to an effect on the K048 cells with no detrimental effect on cell number. Concentration of inhibitor, LY294002 and U0126, was based on our previous experiments (Jordan et al., 2009). 2.5. Short hairpin RNA knockdown Sigma Mission shRNA plasmids were screened and used to knock down the expression of the human SRC gene in hNSCs through lentiviral (LV) transduction as described previously (Ojeda et al., 2011). Green fluorescent protein (GFP) was linked to the shRNA sequence as a visible marker. LV-GFP was included as a control. After the cells underwent 4-day FHL priming, they were fixed for immunofluorescent staining or collected for RNA analyses. Inducible LV-SRC was constructed based on pLK0.1puro (Sigma).
2.2. Protein array Protein samples of K048 cells cultured in DF medium or cultured and pre-primed in NB medium were identified and screened using a PathScan® RTK Signaling Antibody Array Kit (CST), which detects the indicated RTKs and key signaling nodes only when they are phosphorylated at tyrosine or other specified residues. Briefly, cells from T25 flasks in different groups were extracted with Cell Lysis Buffer (with PMSF) according to the PathScan® Antibody Array Kit protocol, and washed with PBS. Then the lysed cells were micro-centrifuged, and the supernatant was diluted to 1.0 mg/ml in Array Diluent Buffer. Proteins from each group was incubated with the blocking buffer
2.6. RNA analyses Total RNA was extracted and subjected to real-time RT-PCR as previously described (Jordan et al., 2009). The primer sequences for oligodendrocyte lineage transcription factors and internal controls were as follows: GAPDH: GAAGGTGAAG GTCGGAGTC (forward), GAAGATGGTGATGGGATTTC (reverse); Olig2: AAGCTAGGAGGCAGTGGCTTCAAGTC (forward), CCGTCACCAGTCGC 22
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
(caption on next page)
23
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 1. Induction of OPCs from hNSCs cultured in DF or NB medium. (a) Schematic of the procedures for OPC induction: hNSCs in the NB or DF group were cultured in NB or DF medium, respectively, for 1 passage (10 days), and then FHL priming was performed for 4 days. (b) After the cells underwent 1 passage (10 days) in NB medium (NB group) followed by 4-day priming with FHL, more hNSCs differentiated into OPC-like cells than those cells that were cultured in DF medium (DF group). OPC-like cells were quantitated by morphology which was defined as small cell body compared to neurons and bipolar/multipolar morphology with tertiary branches. (c) Immunostaining with O4+ and A2B5+ reveals that NB promoted the differentiation of hNSCs into OPCs. (e) Real-time RT-PCR reveals an increase in the expression levels of early oligodendrocyte lineage transcription factors Olig2, Sox10, and Nkx2.2 in NB-cultured hNSCs compared to cells cultured in DF medium. GAPDH was used as the internal control. *p < 0.05, **p < 0.01, mean ± SD, Student's t-test or one-way ANOVA with post hoc tests. Scale bar, 50 μm.
hNSC-differentiated OPC-like cells was greater in the NB group than that in the DF group. Next, we used immunofluorescent staining for A2B5 (a marker for glial cells or oligodendrocyte precursor cells) and O4 (a premature or mature oligodendrocyte marker) to confirm oligodendrocyte lineage differentiation on day 4 of the NB/FHL priming phase. The percentages of A2B5+ cells were 85.2% in the NB group and 45.8% in the DF group (Fig. 1c). Similarly, the percentage of O4+ cells was 51.6% in the NB group and 9.7% in the DF group (Fig. 1d). Overall, NB group showed significantly higher percentages of both O4+ and A2B5+ cells, which is consistent with the morphological results. Using real-time RT-PCR we examined the expression levels of oligodendrocyte-related transcription factors. Specifically, we evaluated the levels of Olig2, Sox10 and Nkx2.2 gene expression at day 7 of culturing the proliferating cells in either DF medium (DF7) or NB medium (NB7), as well as on day 1 or day 4 of NB/FHL priming in the DF group (DP1 and DP4) and the NB group (NP1 and NP4) (red asterisks; Fig. 1a). Our results showed a significant increase of the expression of the early oligodendrocyte lineage transcription factor Olig2 after NB/FHL priming in both groups (Fig. 1e). The normalized fold increases of DP1 and DP4 over DF7 were 8.7 and 5.4, respectively (Fig. 1e). More interestingly, using the NB medium resulted in a higher increase in Olig2 expression (Fig. 1e). The normalized fold changes over DF7 were as follows: NB7, 463 ± 198.9; NP1, 286.6 ± 144.4; and NP4, 157.9 ± 34.7. Increased expression of Sox10, a marker for the early oligodendrocyte lineage, was also evident in the NB-cultivated hNSCs (Fig. 1e, left). Compared to cells cultured in DF medium (DF7), there were no significant changes in Sox10 expression in the DP1 and DP4 samples. In contrast, the normalized fold changes over DF7 were significant in cells treated with NB medium: NB7, 2.3 ± 0.3; NP1, 2.77 ± 0.21; and NP4, 2.8 ± 0.4 (Fig. 1e, middle). Nkx2.2, an oligodendrocyte lineage marker regulated by Olig 2 and Sox10, was not detectable in the DF7, DP1 or DP4 groups but could be detected in the NB7, NP1 and NP4 samples (Fig. 1e, right).
TTCATC (reverse); Nkx2.2: TCTACGACAGCAGCGACAAC (forward), GAACCAGATCTTGACCTGCG (reverse); SOX10: CCTCACAGATCGCCT ACACC (forward), CATATAGGAGAAGGCCGAGTAGA (reverse); and SRC: GAGCGGCTCCAGATTGTCAA (forward), CTGGGGATGTAGCCTG TCTGT (reverse). Real-time quantitative RT-PCR to analyze the genes listed above was performed by the Real-Time PCR Core Facility at UTMB using the Applied Biosystems (ABI) Prism 7000 Sequence Detection System. PCR was performed on an ABI 7000 PCR machine with the following cycling parameters: uracil N-glycosylase (UNG) activation at 50 °C for 2 min, AmpliTaq activation at 95 °C for 10 min, denaturation at 95 °C for 15 s, and annealing/extension at 60 °C for 1 min (repeated 40 times). Duplicate CT values were analyzed in Microsoft Excel using the comparative CT (ΔΔCT) method as described by the manufacturer (Applied Biosystems). Values for Olig2 or other products (2–ΔΔCT) were normalized to the value for the endogenous reference (GAPDH) and then to a calibrator (one of the experimental samples). 2.7. Immunofluorescence and imaging Immunofluorescent staining was performed according to our previous descriptions (Jordan et al., 2009). Cells were fixed for 30 min in 4% paraformaldehyde for cytoplasmic antigens and for 20 min in 4% paraformaldehyde for surface antigens. The primary antibodies used were mouse monoclonal anti-O4, 1:500 (R&D Systems); anti-A2B5, 1:250 (R&D Systems); anti-Olig2, 1:500 (Abcam); and anti-SOX10, 1:500 (Abcam). Secondary antibodies included Alexa 488 goat-anti rabbit and Alexa 594 goat-anti mouse at 1:500 dilutions (Abcam). Images were acquired using either a Nikon 80i epifluorescence microscope or a Nikon D-Eclipse C1 confocal system. Image J software was used for immunofluorescence quantification. Double labeling of A2B5 or O4 (red) and DAPI (blue) was counted, and considered positive if nucleated cells were confirmed for each staining in the mono-labeling panels. 2.8. Statistical analyses
3.2. NB-mediated sustained activation of Akt, ERK1/2, and transient increase of c-Src during OPC differentiation
All analyses included at least three independent experiments unless otherwise stated. For immunofluorescent staining of cultured cells, specific labeling was counted from 9 randomly selected fields from three coverslips. All statistical analyses were performed using Student's t-test and one-way ANOVA with the aid of GraphPad Prism software (GraphPad Software, Inc., CA, USA) or SPSS 17.0 (IBM, USA).
To identify the pathway(s) responsible for the NB-mediated induction of hNSC differentiation into OPCs, we performed an initial screen using a Signaling Antibody Array Kit, which detects receptor tyrosine kinases (RTKs) and key signaling molecules when they are phosphorylated at tyrosine or other specified residues. This initial screen showed that compared to cells cultured in DF medium, the phosphorylation levels of ERK1/2 and Akt remained elevated after NB cultivation (NB7) and FHL priming (NP1), whereas phospho-c-Src temporarily increased after NB cultivation and then decreased after FHL priming (Supplemental Fig. 1). After the initial screen was performed, we focused on the three pathways with detectable changes in phosphorylation and used Western blot analysis to first validate the phosphorylation of Akt and ERK1/2 in protein samples at various time points (Fig. 2a–c). We chose days 1, 4 and 7 of culturing the proliferating cells in DF or NB medium (labeled as DF1, DF4, and DF7 or as NB1, NB4, and NB7, respectively); and days 1, 2 and 4 during NB/FHL priming for the DF group (DP1, DP2 and DP4, respectively) and the NB group (NP1, NP2 and NP4, respectively).
3. Results 3.1. NB medium induces OPC differentiation from human NSCs We separated human fetal forebrain-derived K048 cells into 2 groups, DF and NB. Cells in the DF group were cultured in DF medium for 10 days and then transferred to NB/FHL medium in accordance with the priming procedures. Cells in the NB group were cultured in NB media for 10 days and then transferred to priming media (Fig. 1a). From the NB group, the percentage of cells classified as OPC-like based on their morphology (small, nearly round cell body, multiple processes with tertiary branches) was 57.7%, whereas this percentage was only 12.2% in the DF group (Fig. 1b). Our data indicated that the number of 24
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 2. Using Western blotting, the levels of (a) ERK1/2 and (b) Akt phosphorylation were increased during NB culturing and were sustained throughout the subsequent FHL priming procedure to promote OPC differentiation. Levels of c-Src phosphorylation (c) increased during NB culturing but then decreased during FHL priming. *p < 0.05 and **p < 0.01 compared with DF1; #p < 0.05 compared with DP1; mean ± SD, one-way ANOVA with post hoc tests.
period compared with DF1, and ERK1/2 phosphorylation peaked at NB7 (Fig. 2a). This increase in ERK1/2 phosphorylation was sustained throughout the subsequent FHL priming procedure, although it showed a slight decrease after NP1. We also show a similar trend for Akt activation following OPC
As shown in Fig. 2a, ERK1/2 phosphorylation levels remained relatively low during the DF cultivation stage (DF1, DF4 and DF7) but increased significantly following FHL priming (DP1, DP2 and DP4). In contrast, switching hNSCs to NB medium resulted in a much higher increase in ERK1/2 phosphorylation throughout the NB cultivation 25
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
with LV-SRC resulted in an 88% reduction in c-Src mRNA expression as analyzed by real-time RT-PCR (Fig. 4a). c-Src knockdown was accompanied by significant decreases in the expression levels of the oligodendrocyte-determining transcription factors Olig2, Sox10 and Nkx2.2 (Fig. 4a). Second, we used immunohistochemistry to assess the effect of c-Src knockdown on OPC differentiation. LV-SRC-mediated c-Src interference significantly decreased the number of hNSC-derived OPCs, shown as 27.8% OLIG2+/GFP+, 22.8% SOX10+/GFP+ and 25.8% O4+/GFP+, compared to 70% OLIG2+/GFP+, 60% SOX10+/GFP+ and 78% O4+/GFP+ cells in the GFP control group (Fig. 4b–d).
induction. The levels of Akt phosphorylation in the DP2 and DP4 samples were higher than that in the DF1 sample (Fig. 2b). Notably, earlier and higher increases in Akt activation were evident in the NB group as shown in the NB4 and NB7 samples, as compared to the DF cultivation stage, and sustained throughout the subsequent FHL priming procedure, with the peak increase at NP1 (Fig. 2b). We then assessed the levels of c-Src phosphorylation at the same time points as described above (Fig. 2c). There were no significant differences in the c-Src phosphorylation (Tyr419) levels among all DF groups. In contrast, the c-Src phosphorylation level increased after cultivating hNSCs in NB and peaked in the NB7 sample. The levels of phospho-c-Src decreased in the NP1, NP2 and NP4 samples and returned to the level of DF1. Thus, NB cultivation resulted in transient cSrc activation, which was accompanied by NB-mediated induction of OPCs from hNSCs.
3.5. Pharmacological inhibition of Akt decreases the induction of OPC differentiation Our results show Akt phosphorylation was altered following the NB induction of hNSCs. We then asked whether modulating Akt activity affects OPC differentiation. LY294002, a specific inhibitor of the Akt upstream signal molecule PI3K, was administered starting either on day 7 of NB culturing or at 12 h after NB/FHL priming (Fig. 3a). This inhibitor was also added once daily for 3 days, and then the primed cells were fixed and immune-stained for O4 and A2B5. As shown in Fig. 5a–b, inhibiting the PI3K/Akt pathway during the NB stage (NB7 LY) of OPC induction significantly lowered the percentages of O4+ and A2B5+ cells: 9.8% O4+ and 15.6% A2B5+ cells compared to 51.8% O4+ and 46.8% A2B5+ cells in the NB7 Control group. The administration of LY294002 starting at the later stage of OPC induction, i.e., 12 h after NB/FHL priming (Priming LY), also significantly decreased the percentages of O4 and A2B5 cells in hNSCs: 11.7% O4+ and 15.5% A2B5+ cells compared to 55.8% O4+ and 56.8% A2B5+ cells in the Priming Control group (Fig. 5a–b). Such reductions in OPC differentiation from hNSCs were accompanied by significant decreases in the OPC transcription factors (Olig2 Nkx2.2 and Sox10) as evaluated by qRT-PCR. The levels of Olig2, Nkx2.2 and Sox10 mRNA expression in the NB7 LY and Priming LY group were significantly lower than those in the NB7 Control group and Priming Control group, respectively (Fig. 5c).
3.3. Elevation of phosphorylated c-Src in a narrow time window is critical for OPC induction To establish a cause-effect role of c-Src in NB-mediated OPC differentiation, we utilized pharmacology to inhibit c-Src activity during the pre-priming (NB) or priming (NP) phase (Fig. 3a). Saracatinib, a cSrc inhibitor, was administered once daily for 3 days; on day 7 of NB culturing (NB7, the time point with peak c-Src phosphorylation) or at 12 h after the NB/FHL priming (Priming). Western blot analysis was conducted 1 day following the last administration of saracatinib or DMSO (Supplemental Fig. 2). Our results showed that the inhibitor significantly suppressed c-Src phosphorylation, demonstrating the efficacy of saracatinib. Following saracatinib (NB7 Sara) or control (NB7 Ctrl) treatment, cells were primed for 4 days. We then fixed the cells and examined expression of O4, A2B5, OLIG2 and SOX10 using immunohistochemistry (Fig. 3b–e). Saracatinib-mediated c-Src inhibition resulted in a significant reduction of OPC differentiation from hNSCs, as shown by lower percentages of A2B5+, O4+, OLIG2+ and SOX10+ cells in the NB7 Sara group (21.5% A2B5+, 11.5% O4+, 27.3% OLIG2+, and 21.4% SOX10+) compared to the percentages in the NB7 Ctrl group (46.8% A2B5+, 51.8% O4+, 67.3% OLIG2+, and 39% SOX10+) (Fig. 3b–e). We then examined the effects of saracatinib administration 12 h after NB/FHL priming and saw that it did not inhibit A2B5, OLIG2 or SOX10 expression. There were 58.8% A2B5+ cells in the Priming Sara group, compared to 56.8% in the Priming Control group (Fig. 3f). Interestingly, saracatinib significantly increased the percentage of O4+ cells in the Priming Sara group at 67.1% O4+, compared to 55.8% O4+ cells in the Priming Control group (Fig. 3g). For OLIG2, the Priming Sara group had 65.5% OLIG2+ cells, while Priming Control had 62.6% OLIG2+ cells (Fig. 3h). SOX10 also followed this trend with 39.4% SOX10+ in Priming Sara and 40.2% SOX10+ cells in Priming Control (Fig. 3i). We then conducted real-time RT-PCR to evaluate the mRNA levels of the OPC-related transcription factors Olig2, Nkx2.2 and Sox10 following saracatinib treatment. Our results were consistent with our histochemical data. As shown in Fig. 3j, saracatinib treatment during the NB induction stage (NB7 Sara) significantly reduced the mRNA levels of Olig2, Nkx2.2 and Sox10. In contrast, delayed saracatinib treatment in the priming stage (Priming Sara) did not affect the expression of these OPC transcription factors.
3.6. Pharmacological inhibition of ERK1/2 decreases the induction of OPC differentiation Due to the increase of ERK1/2 phosphorylation following OPC induction in hNSCs, we wanted to investigate whether ERK1/2 activation is important for OPC differentiation. U0126, a selective inhibitor for the ERK1/2 upstream signal MEK1/2, was administered at day 7 of NB culturing (NB7 U0126) or 12 h after NB/FHL priming (Priming U0126) (Fig. 6). The inhibitor was also added once daily for 3 days, and the primed cells were then fixed and immune-stained for O4 and A2B5. Inhibiting ERK1/2 starting at NB-7 significantly reduced OPC differentiation with 10.5% O4+ and 14.5% A2B5+ cells in the NB7 U0126 group compared to 51.8% O4+ and 46.8% A2B5+ cells in the NB7 Control group (Fig. 6a–b). The administration of U0126 at 12 h after NB/FHL priming also decreased the percentages of O4 and A2B5 cells in the Priming U0126 group by 55.8% and 46.9%, respectively (Fig. 6a–b). Furthermore, changes in the levels of the transcription factors Olig2, Nkx2.2, and Sox10 mRNA expression as evaluated by qRT-PCR were consistent with the above-mentioned histochemical data. Specifically, the levels of Olig2, Nkx2.2 and Sox10 mRNA expression in the NB7 U0126 and the Priming U0126 groups were significantly lower than those in the corresponding controls (Fig. 6c).
3.4. RNA interference confirms the critical role of c-Src in NB-mediated OPC induction from hNSCs
3.7. Crosstalk between the Akt and ERK1/2 signaling pathways To further confirm the role of c-Src in OPC differentiation of hNSCs, we used a lentiviral (LV) vector containing a c-Src short hairpin RNA (LV-SRC) to knock down expression of the human c-Src gene in hNSCs that were cultured in NB for 7 days. First, treating NB-cultured hNSCs
We used specific inhibitors of c-Src, Akt and ERK1/2 to investigate the relationship among these three key signaling molecules during the differentiation of hNSCs into OPCs. As shown in Fig. 7a, c-Src 26
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 3. Pharmacological inhibition of c-Src by inhibitors during the pre-priming phase. (a) Saracatinib, a specific c-Src inhibitor, was administered on day 7 of NB culturing (NB7 Sara) or at 12 h into NB/FHL priming (Priming Sara). After the cells underwent FHL priming for 4 days, the cells were fixed and stained for (b) A2B5, (c) O4, (d) Olig2 and (e) SOX10 on the last day of the NB/FHL priming procedure. (f-i) Administration of saracatinib at 12 h on NB/FHL priming stained for (f) A2B5, (g) O4, (h) Olig2 or (i) SOX10 expression. (j) RNA expression levels following treatment with saracatinib during the NB induction stage (NB7 Sara) or priming (Priming Sara). Treatment at NB7 significantly reduced the mRNA levels of Olig2, Nkx2.2 and Sox10. Delayed treatment in the priming stage did not affect the expression of these OPC transcription factors. *p < 0.05, **p < 0.01 mean ± SD, Student's t-test or one-way ANOVA with post hoc tests. Scale bar, 50 μm. 27
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 4. SRC shRNA silencing of c-Src mRNA during NB culturing. (a) RT-PCR was conducted to analyze the levels of the transcription factor SRC and of the oligodendrocyte-determining factors Olig2, Nkx2.2, and SOX10. (b-d) In the GFP group, the percentage of GFP+ cells that were also O4+ was 78.15 ± 9.25%, and the percentages of Olig2+/ GFP+ and SOX10+/GFP+ cells were 69.95 ± 11.25% and 59.85 ± 9.82%, respectively. In the LV group, the percentage of GFP+ cells that were also O4+ was 25.78 ± 8.28%, and the percentages of Olig2+/GFP+ and SOX10+/GFP+ cells were 22.75 ± 5.46% and 27.78 ± 8.75%, respectively. **p < 0.01; mean ± SD, Student's ttest. Scale bar, 50 μm.
28
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
phosphorylation was significantly reduced only by c-Src inhibitor saracatinib but not by Akt inhibitor LY294002 or ERK1/2 inhibitor U0126. The phosphorylation level of Akt was significantly decreased by both saracatinib and LY294002 (Fig. 7b). All three inhibitors significantly lowered the level of ERK1/2 phosphorylation (Fig. 7c). Taken together, our data indicate that there is sequential activation of c-Src, Akt and ERK1/2 following NB-induced OPC differentiation of hNSCs. 4. Discussion and conclusion The present study demonstrates a NB medium-based method to efficiently induce hNSCs toward the oligodendrocyte lineage. Several groups have previously reported various methods to induce hNSC differentiation into OPCs or oligodendrocytes. These methods used DF medium and required the addition of FGF2, PDGF-AA and NT-3 (Neri et al., 2010; Almad et al., 2011; Monaco et al., 2012). The latter two supplements have been well documented as oligodendrocyte-promoting factors (Raff et al., 1988; Lachyankar et al., 1997). Here, we further demonstrate that NB medium in combination with FGF2 without PDGF and NT-3 is sufficient to induce the majority of hNSCs (nearly 60%) to become O4+ OPCs within 2 weeks of induction, a result compatible with the effectiveness of other methods. Under the same culture conditions, however, DMEM significantly reduced OPC differentiation from hNSCs. Taken together, these studies indicate that both growth/trophic factors and culture media contribute to oligodendrocyte fate specification from hNSCs in vitro. NB medium has also been demonstrated to inhibit the proliferation of certain cell types (Kleinsimlinghaus et al., 2013) and to allow the culture of OPCs under conditions of low cell density (Yang et al., 2005). Here, we further demonstrate that NB medium has the ability to promote hNSC differentiation toward the oligodendrocyte lineage. To better understand the molecular control of oligodendrocyte fate specification, it is important to investigate the mechanisms underlying the impact of NB medium on hNSC differentiation into oligodendrocytes. Mechanistically, we identified several signaling molecules/ pathways, namely, c-Src, Akt, and ERK1/2, that contribute to this NB medium-induced OPC differentiation of hNSCs. Our findings of Akt and ERK1/2 phosphorylation are consistent with previous reports demonstrating the importance of the PI3K/Akt and MEK/ERK signaling cascades in OPC differentiation (Cui et al., 2005; Bibollet-Bahena and Almazan, 2009; Fyffe-Maricich et al., 2011). The discovery of c-Src here made it a novel candidate for a role in oligodendrocyte progenitor formation. As a member of the Src family of non-receptor protein tyrosine kinases (Ballaré et al., 2003; Colognato et al., 2004; Wang et al., 2014b), c-Src was previously known to be an important signaling molecule for survival and proliferation in cancer cells (Jin et al., 2008). Although several members of the Src family (Fyn, Lyn and Src) are expressed by oligodendrocytes (Colognato et al., 2004), only Fyn was previously reported to mediate various oligodendrocyte functions, such as migration, differentiation, axonal contact and myelination initiation (Brewer and Cotman, 1989; Umemori et al., 1994; Pérez et al., 2013). c-Src is encoded by the SRC gene, comprising a SH2 domain, an SH3 domain and a tyrosine kinase domain (Ballaré et al., 2003). Thus far c-Src has been reported in association with cell survival and proliferation, but most researches focused on cancer cells and the underlying relationship is still not completely clear (Jin et al., 2008). Studies have reported that c-Src activates the PI3K/Akt and MAPK intracellular pathway, primarily through FAK pathway-dependent or non-dependent pathway (Jones et al., 2000). c-Src in PC12 cells are thought to be related to NGF-mediated down-regulation of EGF receptor expression, and this study also found that c-Src was involved in the activation of the MAPK pathway (Kremer et al., 1991). In COS-7 cells, another research showed that c-Src activation could activate Erk1/2 pathway through Ras/Raf (Kremer et al., 1991). In addition, it was demonstrated that in a variety of tumor cells, c-Src could activate PI3K pathway by the TrkC/c-Src
Fig. 5. Pharmacological inhibition of Akt decreased the induction of OPC differentiation. (a–b) The primed cells were fixed and stained for O4 and A2B5 after FHL priming for 4 days. The results showed that the percentages of O4+ and A2B5+ cells in the NB7 LY group were significantly lower than those in the NB7 DMSO group. (c) RNA expression levels of Olig2, Nkx2.2 and SOX10 in the NB7D LY group were lower than were those in the NB7D Control group, and those in the Priming LY group were lower than were those in the Priming Control group. **p < 0.01; mean ± SD, Student's t-test. Scale bar, 50 μm.
29
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 6. Pharmacological inhibition of ERK1/2 decreased the induction of OPC differentiation. U0126, a specific MEK1/2 inhibitor, was administered on day 7 of NB culturing (NB7 U0126) or at 12 h into NB/FHL priming (Priming U0126). (a-b) The primed cells were fixed and stained for O4 and A2B5 after FHL priming for 4 days. The results showed that the percentages of O4+ and A2B5+ cells in the NB7 U0126 group were significantly lower than those in the NB7 DMSO group. The primed cells were fixed and stained for O4 and A2B5 after FHL priming for 4 days. (c) RNA levels of Olig2, Nkx2.2 and SOX10 in the NB7 U0126 group were lower than were those in the NB7 Control group, and those in the Priming U0126 group were lower than were those in the Priming Control group. *p < 0.05, **p < 0.01; mean ± SD, Student's t-test. Scale bar, 50 μm.
the regulation of c-Src. The critical timing of c-Src activation during oligodendrocyte induction was further confirmed by its effect on the expression of oligodendrocyte-related transcription factors. Specifically, we discovered that inhibition of c-Src kinase activity or knockdown of c-Src expression by RNA interference significantly reduced the expression levels of Olig2, Nkx2.2 and SOX10. All these transcription factors are known to play important roles in oligodendrocyte differentiation (Sun et al., 2001; Lu et al., 2002; Takebayashi et al., 2002; Talbott et al., 2005; Wang et al., 2014a). In contrast, we found that sustained activation of Akt and ERK1/2 pathways was required for NB-induced elevation of Olig2, Nkx2.2 and SOX10 expression, whereas inhibiting these signaling pathways resulted in reduced expression of these transcription factors accompanied by decreased hNSC differentiation into OPCs. Along this line, our finding that the ERK1/2 pathway is required for the expression of oligodendrocyte-related transcription factors and oligodendrocyte differentiation is consistent with previous reports. Specifically, several studies have shown that ERK1/2 activation was required to up-regulate the level of Olig2 expression and/or promote oligodendrocyte differentiation from NSCs (Bhat and Zhang, 1996; Hu et al., 2008). Furthermore, Akt signaling has been found to be important for Sox10 expression in OPCs (Watatani et al., 2012).
complex (Jin et al., 2008). The results of this study show that NSC differentiation to oligodendrocyte requires activation of c-Src, PI3K/Akt and Erk1/2. More importantly, we discovered a novel role of c-Src in OPC specification, which requires a transient activation of c-Src within a limited time window. Inhibition of c-Src, Akt and Erk1/2 phosphorylation could inhibit NSC differentiation into oligodendrocytes. Our study further indicated that c-Src is upstream from the Akt and ERK1/2 pathways during the NB-induced oligodendrocyte differentiation from hNSCs. This conclusion is drawn from the fact that inhibition of c-Src phosphorylation also blocked Akt and ERK1/2 phosphorylation, whereas the level of c-Src phosphorylation was not suppressed by blocking Akt and ERK1/2 activation. Similar relations among c-Src, Akt and ERK1/2 have also been demonstrated in other cellular events, such as cancer cell motility and neurite outgrowth (Kremer et al., 1991; Jones et al., 2000; Wu et al., 2012; Wang et al., 2014b). Furthermore, we identified a crosstalk between the Akt and ERK1/2 pathways during the NB-induced OPC induction, i.e. inhibiting Akt activity resulted in a significant reduction in ERK1/2 phosphorylation. This type of crosstalk has been increasingly appreciated recently as a common phenomenon that ensures a fine balance of parallel signaling pathways (Aksamitiene et al., 2012). These results indicated that Akt and Erk1/2 pathway activation is subject to
30
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
Fig. 7. Specific inhibition of key signaling molecules to determine pathway crosstalk. (a) c-Src phosphorylation was significantly reduced by c-Src inhibitor, saracatinib, but was unaffected by Akt inhibitor LY294002 or ERK1/2 inhibitor U0126. (b) Akt phosphorylation was significantly decreased by both saracatinib and LY294002. (c) ERK1/2 phosphorylation was significantly affected by all three inhibitors, *p < 0.05, mean ± SD, one-way ANOVA with post hoc tests.
Based on the data presented in this study we conclude that Neurobasal medium induces human neural stem cells toward the oligodendrocyte lineage via a transient activation of c-Src signaling molecule and the subsequent sustained activation of the Akt and ERK1/2 pathways. This study may shed lights on developing novel strategies to promote stem cell-based therapy for oligodendrocyte-related neurological disorders. Conflicts of interest We have no conflicts of interest to disclose. All authors have read and approved the final version of the manuscript. Acknowledgments This work was supported by TIRR Mission Connect, the Gillson Longenbaugh Foundation (#012-103), the Chinese Scholar Council, and the John S. Dunn Research Foundation. Appendix A. Supplementary data Supplementary data related to this article can be found at https:// doi.org/10.1016/j.neuint.2018.07.006. References Aksamitiene, E., Kiyatkin, A., Kholodenko, B.N., 2012. Cross-talk between mitogenic Ras/ MAPK and survival PI3K/Akt pathways: a fine balance. Biochem. Soc. Trans. 40 (1), 139–146. Almad, A., Sahinkaya, F.R., McTigue, D.M., 2011. Oligodendrocyte fate after spinal cord injury. Neurotherapeutics 8 (2), 262–273. Armstrong, R.J., Svendsen, C.N., 2000. Neural stem cells: from cell biology to cell replacement. Cell Transplant. 9 (2), 139–152. Ballaré, C., Uhrig, M., Bechtold, T., Sancho, E., Di Domenico, M., Migliaccio, A., Auricchio, F., Beato, M., 2003. Two domains of the progesterone receptor interact with the estrogen receptor and are required for progesterone activation of the c-Src/ Erk pathway in mammalian cells. Mol. Cell Biol. 23 (6), 1994–2008. Bhat, N.R., Zhang, P., 1996. Activation of mitogen-activated protein kinases in oligodendrocytes. J. Neurochem. 66 (5), 1986–1994. Bibollet-Bahena, O., Almazan, G., 2009. IGF-1-stimulated protein synthesis in oligodendrocyte progenitors requires PI3K/mTOR/Akt and MEK/ERK pathways. J. Neurochem. 109 (5), 1440–1451. Brewer, G.J., Cotman, C.W., 1989. Survival and growth of hippocampal neurons in defined medium at low density: advantages of a sandwich culture technique or low oxygen. Brain Res. 494 (1), 65–74. Brüstle, O., Choudhary, K., Karram, K., Hüttner, A., Murray, K., Dubois-Dalcq, M., McKay, R.D., 1998. Chimeric brains generated by intraventricular transplantation of fetal human brain cells into embryonic rats. Nat. Biotechnol. 16 (11), 1040–1044. Caldwell, M.A., He, X., Wilkie, N., Pollack, S., Marshall, G., Wafford, K.A., Svendsen, C.N., 2001. Growth factors regulate the survival and fate of cells derived from human neurospheres. Nat. Biotechnol. 19 (5), 475–479. Colognato, H., Ramachandrappa, S., Olsen, I.M., ffrench-Constant, C., 2004. Integrins direct Src family kinases to regulate distinct phases of oligodendrocyte development. J. Cell Biol. 167 (2), 365–375. Cui, Q.L., Zheng, W.H., Quirion, R., Almazan, G., 2005. Inhibition of Src-like kinases reveals Akt-dependent and -independent pathways in insulin-like growth factor Imediated oligodendrocyte progenitor survival. J. Biol. Chem. 280 (10), 8918–8928. Flax, J.D., Aurora, S., Yang, C., Simonin, C., Wills, A.M., Billinghurst, L.L., Jendoubi, M., Sidman, R.L., Wolfe, J.H., Kim, S.U., Snyder, E.Y., 1998. Engraftable human neural stem cells respond to developmental cues, replace neurons, and express foreign genes. Nat. Biotechnol. 16 (11), 1033–1039. Fricker, R.A., Carpenter, M.K., Winkler, C., Greco, C., Gates, M.A., Björklund, A., 1999. Site-specific migration and neuronal differentiation of human neural progenitor cells after transplantation in the adult rat brain. J. Neurosci. 19 (14), 5990–6005. Fyffe-Maricich, S.L., Karlo, J.C., Landreth, G.E., Miller, R.H., 2011. The ERK2 mitogenactivated protein kinase regulates the timing of oligodendrocyte differentiation. J. Neurosci. 31 (3), 843–850.
31
Neurochemistry International 120 (2018) 21–32
L. Wang et al.
reduces arrhythmia inducibility and connexin43 dysregulation after myocardial infarction. J. Am. Coll. Cardiol. 63 (9), 928–934. Simpkins, F., Hevia-Paez, P., Sun, J., Ullmer, W., Gilbert, C.A., da Silva, T., Pedram, A., Levin, E.R., Reis, I.M., Rabinovich, B., Azzam, D., Xu, X.X., Ince, T.A., Yang, J.Y., Verhaak, R.G., Lu, Y., Mills, G.B., Slingerland, J.M., 2012. Src Inhibition with saracatinib reverses fulvestrant resistance in ER-positive ovarian cancer models in vitro and in vivo. Clin. Canc. Res. 18 (21), 5911–5923. Sun, T., Echelard, Y., Lu, R., Yuk, D.I., Kaing, S., Stiles, C.D., Rowitch, D.H., 2001. Olig bHLH proteins interact with homeodomain proteins to regulate cell fate acquisition in progenitors of the ventral neural tube. Curr. Biol. 11 (18), 1413–1420. Svendsen, C.N., ter Borg, M.G., Armstrong, R.J., Rosser, A.E., Chandran, S., Ostenfeld, T., Caldwell, M.A., 1998. A new method for the rapid and long term growth of human neural precursor cells. J. Neurosci. Meth. 85 (2), 141–152. Takebayashi, H., Nabeshima, Y., Yoshida, S., Chisaka, O., Ikenaka, K., 2002. The basic helix-loop-helix factor olig2 is essential for the development of motoneuron and oligodendrocyte lineages. Curr. Biol. 12 (13), 1157–1163. Talbott, J.F., Loy, D.N., Liu, Y., Qiu, M.S., Bunge, M.B., Rao, M.S., Whittemore, S.R., 2005. Endogenous Nkx2.2+/Olig2+ oligodendrocyte precursor cells fail to remyelinate the demyelinated adult rat spinal cord in the absence of astrocytes. Exp. Neurol. 192 (1), 11–24. Tarasenko, Y.I., Gao, J., Nie, L., Johnson, K.M., Grady, J.J., Hulsebosch, C.E., McAdoo, D.J., Wu, P., 2007. Human fetal neural stem cells grafted into contusion-injured rat spinal cords improve behavior. J. Neurosci. Res. 85 (1), 47–57. Tarasenko, Y.I., Yu, Y., Jordan, P.M., Bottenstein, J., Wu, P., 2004. Effect of growth factors on proliferation and phenotypic differentiation of human fetal neural stem cells. J. Neurosci. Res. 78 (5), 625–636. Umemori, H., Sato, S., Yagi, T., Aizawa, S., Yamamoto, T., 1994. Initial events of myelination involve Fyn tyrosine kinase signalling. Nature 367 (6463), 572–576. Vescovi, A.L., Parati, E.A., Gritti, A., Poulin, P., Ferrario, M., Wanke, E., FrölichsthalSchoeller, P., Cova, L., Arcellana-Panlilio, M., Colombo, A., Galli, R., 1999. Isolation and cloning of multipotential stem cells from the embryonic human CNS and establishment of transplantable human neural stem cell lines by epigenetic stimulation. Exp. Neurol. 156 (1), 71–83. Wang, J., Pol, S.U., Haberman, A.K., Wang, C., O'Bara, M.A., Sim, F.J., 2014a. Transcription factor induction of human oligodendrocyte progenitor fate and differentiation. Proc. Natl. Acad. Sci. U. S. A. 111 (28), E2885–E2894. Wang, L., Wei, F.X., Cen, J.S., Ping, S.N., Li, Z.Q., Chen, N.N., Cui, S.B., Wan, Y., Liu, S.Y., 2014b. Early administration of tumor necrosis factor-alpha antagonist promotes survival of transplanted neural stem cells and axon myelination after spinal cord injury in rats. Brain Res. 1575, 87–100. Watatani, K., Hirabayashi, Y., Itoh, Y., Gotoh, Y., 2012. PDK1 regulates the generation of oligodendrocyte precursor cells at an early stage of mouse telencephalic development. Gene Cell. 17 (4), 326–335. Wu, P., Tarasenko, Y.I., Gu, Y., Huang, L.Y., Coggeshall, R.E., Yu, Y., 2002. Region-specific generation of cholinergic neurons from fetal human neural stem cells grafted in adult rat. Nat. Neurosci. 5 (12), 1271–1278. Wu, W., Sun, Z., Wu, J., Peng, X., Gan, H., Zhang, C., Ji, L., Xie, J., Zhu, H., Ren, S., Gu, J., Zhang, S., 2012. Trihydrophobin 1 phosphorylation by c-Src regulates MAPK/ERK signaling and cell migration. PLoS One 7 (1), e29920. Yang, Z., Watanabe, M., Nishiyama, A., 2005. Optimization of oligodendrocyte progenitor cell culture method for enhanced survival. J. Neurosci. Meth. 149 (1), 50–56.
Gard, A.L., Pfeiffer, S.E., 1990. Two proliferative stages of the oligodendrocyte lineage (A2B5+O4- and O4+GalC-) under different mitogenic control. Neuron 5 (5), 615–625. Hu, J.G., Fu, S.L., Wang, Y.X., Li, Y., Jiang, X.Y., Wang, X.F., Qiu, M.S., Lu, P.H., Xu, X.M., 2008. Platelet-derived growth factor-AA mediates oligodendrocyte lineage differentiation through activation of extracellular signal-regulated kinase signaling pathway. Neuroscience 151 (1), 138–147. Jin, W., Yun, C., Jeong, J., Park, Y., Lee, H.D., Kim, S.J., 2008. c-Src is required for tropomyosin receptor kinase C (TrkC)-induced activation of the phosphatidylinositol 3-kinase (PI3K)-AKT pathway. J. Biol. Chem. 283 (3), 1391–1400. Jones, R.J., Brunton, V.G., Frame, M.C., 2000. Adhesion-linked kinases in cancer; emphasis on src, focal adhesion kinase and PI 3-kinase. Eur. J. Canc. 36 (13 Spec No), 1595–1606. Jordan, P.M., Ojeda, L.D., Thonhoff, J.R., Gao, J., Boehning, D., Yu, Y., Wu, P., 2009. Generation of spinal motor neurons from human fetal brain-derived neural stem cells: role of basic fibroblast growth factor. J. Neurosci. Res. 87 (2), 318–332. Kleinsimlinghaus, K., Marx, R., Serdar, M., Bendix, I., Dietzel, I.D., 2013. Strategies for repair of white matter: influence of osmolarity and microglia on proliferation and apoptosis of oligodendrocyte precursor cells in different basal culture media. Front. Cell. Neurosci. 7, 277. Kremer, N.E., D'Arcangelo, G., Thomas, S.M., DeMarco, M., Brugge, J.S., Halegoua, S., 1991. Signal transduction by nerve growth factor and fibroblast growth factor in PC12 cells requires a sequence of src and ras actions. J. Cell Biol. 115 (3), 809–819. Lachyankar, M.B., Condon, P.J., Quesenberry, P.J., Litofsky, N.S., Recht, L.D., Ross, A.H., 1997. Embryonic precursor cells that express Trk receptors: induction of different cell fates by NGF, BDNF, NT-3, and CNTF. Exp. Neurol. 144 (2), 350–360. Lu, Q.R., Sun, T., Zhu, Z., Ma, N., Garcia, M., Stiles, C.D., Rowitch, D.H., 2002. Common developmental requirement for Olig function indicates a motor neuron/oligodendrocyte connection. Cell 109 (1), 75–86. Menn, B., Garcia-Verdugo, J.M., Yaschine, C., Gonzalez-Perez, O., Rowitch, D., AlvarezBuylla, A., 2006. Origin of oligodendrocytes in the subventricular zone of the adult brain. J. Neurosci. 26 (30), 7907–7918. Monaco, M.C., Maric, D., Bandeian, A., Leibovitch, E., Yang, W., Major, E.O., 2012. Progenitor-derived oligodendrocyte culture system from human fetal brain. JoVE 70. Nam, H.J., Im, S.A., Oh, D.Y., Elvin, P., Kim, H.P., Yoon, Y.K., Min, A., Song, S.H., Han, S.W., Kim, T.Y., Bang, Y.J., 2013. Antitumor activity of saracatinib (AZD0530), a cSrc/Abl kinase inhibitor, alone or in combination with chemotherapeutic agents in gastric cancer. Mol. Canc. Therapeut. 12 (1), 16–26. Neri, M., Maderna, C., Ferrari, D., Cavazzin, C., Vescovi, A.L., Gritti, A., 2010. Robust generation of oligodendrocyte progenitors from human neural stem cells and engraftment in experimental demyelination models in mice. PLoS One 5 (4), e10145. Ojeda, L., Gao, J., Hooten, K.G., Wang, E., Thonhoff, J.R., Dunn, T.J., Gao, T., Wu, P., 2011. Critical role of PI3K/Akt/GSK3β in motoneuron specification from human neural stem cells in response to FGF2 and EGF. PLoS One 6 (8), e23414. Pérez, M.J., Fernandez, N., Pasquini, J.M., 2013. Oligodendrocyte differentiation and signaling after transferrin internalization: a mechanism of action. Exp. Neurol. 248, 262–274. Raff, M.C., Lillien, L.E., Richardson, W.D., Burne, J.F., Noble, M.D., 1988. Platelet-derived growth factor from astrocytes drives the clock that times oligodendrocyte development in culture. Nature 333 (6173), 562–565. Rutledge, C.A., Ng, F.S., Sulkin, M.S., Greener, I.D., Sergeyenko, A.M., Liu, H., Gemel, J., Beyer, E.C., Sovari, A.A., Efimov, I.R., Dudley, S.C., 2014. c-Src kinase inhibition
32