Oligonucleotide recombination in corynebacteria without the expression of exogenous recombinases

Journal of Microbiological Methods 105 (2014) 109–115

Contents lists available at ScienceDirect

Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth

Oligonucleotide recombination in corynebacteria without the expression of exogenous recombinases Alexander A. Krylov ⁎, Egor E. Kolontaevsky, Sergey V. Mashko Ajinomoto-Genetika Research Institute, 1-st Dorozhny proezd 1, Moscow 117545, Russia

a r t i c l e

i n f o

Article history: Received 30 April 2014 Received in revised form 21 July 2014 Accepted 23 July 2014 Available online 1 August 2014 Keywords: Corynebacteria Recombineering Oligo Recombinases

a b s t r a c t Brevibacterium lactofermentum and Corynebacterium glutamicum are important biotechnology species of the genus Corynebacterium. The single-strand DNA annealing protein (SSAP)-independent oligonucleotidemediated recombination procedure was successfully applied to the commonly used wild-type strains B. lactofermentum AJ1511 and C. glutamicum ATCC13032. When the rpsL gene was used as a target, the optimized protocol yielded up to (1.4 ± 0.3) × 103 and (6.7 ± 1.3) × 103 streptomycin-resistant colonies per 108 viable cells for the corresponding strains. We tested the influence of several parameters that are known to enhance the efficiency of oligonucleotide-mediated recombination in other bacterial species. Among them, increasing the concentration of oligonucleotides and targeting the lagging strand of the chromosome have proven to have positive effects on both of the tested species. No difference in the efficiency of recombination was observed between the oligonucleotides phosphorothiorated at the 5′ ends and the unmodified oligonucleotides or between the oligonucleotides with four mutated nucleotides and those with one mutated nucleotide. The described approach demonstrates that during the adaptation of the recombineering technique, testing SSAP-independent oligonucleotide-mediated recombination could be a good starting point. Such testing could decrease the probability of an incorrect interpretation of the effect of exogenous protein factors (such as SSAP and/or corresponding exonucleases) due to non-optimal experimental conditions. In addition, SSAP-independent recombination itself could be useful in combination with suitable selection/enrichment methods. © 2014 Elsevier B.V. All rights reserved.

1. Introduction During the last decade, the recombineering (Ellis et al., 2001) technique based on phage-encoded proteins has been adapted for use in many Gram-negative bacterial species (Datsenko and Wanner, 2000; Katashkina et al., 2009; Murphy et al., 2000; Swingle et al., 2010a) and more recently in Gram-positive bacteria (Binder et al., 2013; Van Kessel and Hatfull, 2007; Van Pijkeren and Britton, 2012; Wang et al., 2012). For new bacterial species, recombineering adaptation procedures are usually based on the use of well-characterized recombineering protein factors, e.g., Bet/Exo from the Escherichia coli λ phage (Ellis et al., 2001) or RecE/RecT from the Rac prophage (Zhang et al., 1998), or the use of their less characterized orthologous proteins from either the corresponding host or another group of bacteria (Binder et al., 2013; Swingle et al., 2010a; Van Kessel and Hatfull, 2007). The key factor for success in this strategy is testing as many different recombineering protein factors as possible with experimentally proven or predicted activities. The main reason for such an extensive ⁎ Corresponding author at: Ajinomoto-Genetika Research Institute, 1-st Dorozhny proezd, 1, 117545 Moscow, Russian Federation. Tel.: +7 495 780 3378x708; fax: +7 495 315 0640. E-mail address: [email protected] (A.A. Krylov).

http://dx.doi.org/10.1016/j.mimet.2014.07.028 0167-7012/© 2014 Elsevier B.V. All rights reserved.

strategy is a lack of knowledge about the precise molecular mechanism of the recombination event mediated by phage/prophage-encoded factors. The latest hypothesized model of recombineering by doublestranded DNA (dsDNA) includes the following steps (Maresca et al., 2010; Mosberg et al., 2010). The first step involves the action of 5′➔3′specific dsDNA-dependent exonucleases (e.g., Exo or RecE) on the dsDNA fragment, producing single-stranded DNA (ssDNA) that is most likely immediately covered by an assembled corresponding ssDNA annealing protein (SSAP) (e.g., Bet for Exo and RecT for RecE) to protect against subsequent degradation (Muniyappa and Radding, 1986). Then the protein–DNA filament anneals to the complementary ssDNA of a chromosome originating during the replication process. In the case of recombineering by ssDNA, only SSAP activity is needed to promote successful recombination. Therefore, the development of the ssDNA-based recombination method for new host species should be an easier task, which is consistent with the observation that exonucleases are much more species-specific than SSAP, and the two protein factors promote dsDNA-mediated recombination only if they belong to the same system (Datta et al., 2008). However, dsDNA-based recombineering is much more convenient for significant chromosomal editing and thus more desirable as a genetic tool for scientists. Nevertheless, ssDNA-based recombineering could be successfully applied for targeted mutagenesis, and an adjustment of this method to

110

A.A. Krylov et al. / Journal of Microbiological Methods 105 (2014) 109–115

the new host most likely does not demand the selection of suitable SSAPs. Precise modifications can be introduced into a chromosome via a single-stranded oligonucleotide without the addition of any phageencoded proteins as helpers under special experimental conditions, and this phenomenon appears to occur widely in nature (Swingle et al., 2010c). Currently, much is known about the special experimental conditions that promote successful recombination, regardless of whether the process is based on exogenous phage-related protein factors or only on host factors and oligonucleotides (Maresca et al., 2010; Sawitzke et al., 2011; Swingle et al., 2010b).Therefore, for tasks where an appropriate selection system may be established, applying SSAPindependent oligonucleotide recombination is worthwhile because its main disadvantage, a lower efficiency than SSAP-dependent recombination (Swingle et al., 2010a), may not be a significant problem. Additionally, the optimized experimental conditions of SSAP-independent oligonucleotide recombination may be considered a good starting point for initial attempts to adapt SSAP-dependent ssDNA- or dsDNAmediated recombination for the same target bacterial species. The coryneform bacteria are a heterogeneous group of prokaryotic microorganisms, including the important biotechnology species, Brevibacterium lactofermentum and Corynebacterium glutamicum. Moreover, the importance of genetic tool improvement for convenient chromosomal editing is currently of great importance and most likely will increase in the future because these organisms, which are classified as generally recognized as safe (GRAS), are extensively applied for bioproduction in the broadening field of White Biotechnology (Becker and Wittmann, 2012; Buschke et al., 2012). However, until recently, precise chromosomal editing could be performed only with the help of integrative plasmid vectors promoting the integration of cloned fragments via homologous recombination in these bacteria (Nešvera and Pátek, 2011; Schäfer et al., 1994). Notably, the retardation of the development of recombineering approaches has generally occurred for Gram-positive bacteria rather than Gram-negative. Nevertheless, the situation has changed during past years, and the first successful example of SSAP-dependent oligonucleotide-mediated recombination in the C. glutamicum ATCC13032 chromosome via the heterologous expression of RecT recombinase from prophage Rac of E. coli was recently published by Binder et al. (2013). In the present study, SSAP-independent oligonucleotide recombination of the chromosome of B. lactofermentum AJ1511 was successfully applied and optimized, and the applicability of the same approach was shown for C. glutamicum ATCC13032. To achieve the maximum recombination efficiency and investigate the impact of various experimental conditions, the following parameters for the two groups were varied: (i) “internal” parameters that influenced the process of recombination itself (Murphy and Marinus, 2010; Sawitzke et al., 2011) and (ii) “external” parameters (Eggeling and Bott, 2005; Haynes and Britz, 1989; Van der Rest et al., 1999) that had previously been determined to efficiency of DNA uptake by Gram-positive bacterial cells. The developed procedure may help broaden recombineering-based genetic tools for other Gram-positive species by both SSAP-independent and SSAPdependent methods.

been applied to B. lactofermentum strains without any or only with slight modifications. The kanamycin resistant (KmR) vector plasmid, pVK9 (Nakamura et al., 2006) derived from pHM1519 (Miwa et al., 1984), was used for electroporation to estimate the electrocompetency of the prepared cells. pVK9 was isolated from the E. coli DH5α (supE44 ΔlacU169 [Φ80 lacZ ΔM15] hsdR17 recA1 endA1 gyrA96 thi-1 relA1) strain (Hanahan, 1983). All recombineering oligonucleotides (Table 1), with the exception of P9, were 80 nt long and had 46–50 nt of homology at the 5′ arm and 30 nt of homology at the 3′ arm. Such a design was selected because homology at the 5′ end was previously shown to affect the recombination efficiency more than homology at the 3′ end (Li et al., 2013; Maresca et al., 2010; Sawitzke et al., 2011). The P9 oligonucleotide was 73 nt long and incorporated the mutated nucleotide directly at the middle (37 position). For routine purposes, cells were grown in 2YT medium (Sambrook and Russell, 2001). To overcome the problem of the thick cell wall of Gram-positive bacteria, which is considered to greatly influence DNA uptake (Eggeling and Bott, 2005), competent cells were prepared by growth in 2YT* medium (2YT supplied with freshly prepared 0.1% [w/v] Tween 80 [Sigma-Aldrich, USA] and 2% [w/v] glycine [Serva, Germany]). The cell-wall weakening agents Tween 80 and glycine were added because they were used for the electrotransformation of the B. lactofermentum strain BL1 by plasmid DNA in the experiments by Haynes and Britz (1989). When necessary, kanamycin (Km), streptomycin (Str) or erythromycin (Ery) were added to the culture medium at concentrations of 20 μg/ml, 25 μg/ml or 3 μg/ml, respectively. 2.2. Electroporation procedure To prepare an electrocompetent cells, fresh cells from a 2YT plate were inoculated by loop into 5 ml of liquid 2YT and incubated in a 50-ml glass tube with agitation at 200 rpm at 32 °C for 17–18 h overnight (O/N). For experiments with fresh electrocompetent cells, the O/N culture was suspended in 5 ml of freshly prepared 2YT* medium until an optical density (OD595) of 0.2 was achieved. The cells were grown in a 50-ml glass tube in a rotary shaker at 32 °C for 2 h until the OD595 reached 0.50–0.65. It should be noted that prolonged cultivation in 2YT* significantly reduces the efficiency and, thus, the recombinant yield, possibly even to zero, which is most likely due to the harmful influence of cell-weakening compounds (Holo and Nes, 1989; Pyne et al., 2013). After cultivation, 8 ml of culture was harvested and concentrated into a 1.5-ml microcentrifuge tube, and the cells were washed twice Table 1 List of used oligonucleotides. P1 P2 P3 P4 P5

2. Materials and methods 2.1. Bacterial strains, plasmid, oligonucleotides and media

P6 P7 P8

B. lactofermentum AJ1511 (ATCC13869) and C. glutamicum ATCC13032 were used as recipient strains for SSAP-independent oligonucleotidemediated recombination experiments. B. lactofermentum is very closely related to C. glutamicum (Correia et al., 1994; Eikmanns et al., 1991; Lieb et al., 1991), and in many sources, AJ1511 is also referenced as C. glutamicum ATCC13869 (Shimomura-Shimizu and Karube, 2010; Shirai et al., 2007). As a result, a variety of genetic and microbiological information and methods adapted for C. glutamicum can be and have

P9 P10 P11 P12 P13

TGAGGTTGTCCGTGACATGTTTGG CCTTACGAAGAGCAGAGTTAGGCTTCTTA ACGAAGAGCAGAGTTAGGCTTNCGC C⁎C⁎CCTCAGCGTCGTGGCGTATGCACCCGTGTGTACACCACCACCCCGCGNAAGC CTAACTCTGCTCTTCGTAAGGTCGCT A⁎G⁎GTAAGGCGCACACGAGCGACCTTACGAAGAGCAGAGTTAGGC TTNCGCGGGGTGGTGGTGTACACACGGGTGCATACG A⁎G⁎GTAAGGCGCACACGAGCGACCTTACGAAGAGCAGAGTTAGGC TTGCGCGGGGTGGTGGTGTACACACGGGTGCATACG AGGTAAGGCGCACACGAGCGACCTTACGAAGAGCAGAGTTAGGCTTGCGCGGGG TGGTGGTGTACACACGGGTGCATACG C⁎T⁎GCTGCGCTTACGGATCTGGAATGCGCGTCCCTGAGCACGTGGCTGGAAGG TTGGACCTTCGTTGGCGTAAGCCTCGGA ACACGAGCGACCTTACGAAGAGCAGAGTTAGGCTTCCTAGGGGTGGTGGTGTA CACACGGGTGCATACGCCAC GAGCACGTGGCTGGAAGGTTG AGCACGTGGCTGGAAGCGC GATAAGCGATGAGTGACAACATCACCT C⁎C⁎CCTCAGCGTCGTGGCGTATGCACCCGTGTGTACACCACCACCCCGCGCAAGC CTAACTCTGCTCTTCGTAAGGTCGCT

⁎ Indicates that the preceding nucleotide was phosphorothiorated.

A.A. Krylov et al. / Journal of Microbiological Methods 105 (2014) 109–115

with 1 ml of ice-cold sterile distilled H2O and then with 1 ml of icecold 10% (v/v) glycerol. The cell pellet was suspended in 50 μl of icecold 10% (v/v) glycerol and used for electroporation. For experiments with frozen cells, the O/N culture was diluted to an OD595 of 0.2 in 100 ml of freshly prepared 2YT* medium. Cells were grown in 250-ml flasks on a rotary shaker at 32 °C for 2–2.5 h. After this growth, the OD595 was in the range of 0.50–0.65. Then 98 ml of the culture was harvested and concentrated into two chilled 50-ml polypropylene centrifuge tubes (Corning, USA) The cells were washed twice with 5 ml of ice-cold sterile distilled H2O, and finally, the pellets from both tubes was suspended in 1 ml of ice-cold 10% (v/v) glycerol, transferred to a chilled 1.7-ml tube and centrifuged. The cell pellet was suspended in 600 μl of ice-cold 10% (v/v) glycerol. Twelve 50-μl aliquots were prepared and immediately frozen at −76 °C. Just before electroporation, each aliquot was transferred to a + 4 °C water bath, thawed for 5 min and treated with an electric pulse. The aliquots contained approximately (2.0 ± 0.6) × 108 cells in each experiment. Electroporation was performed with the addition of 10 μl of aqueous DNA sample containing from 0.06 to 18 μg of oligonucleotides. After the DNA addition, the aliquot was immediately shaken vigorously by flicking with a fingernail. Then the aliquot was transferred to a 0.2-сm cuvette and exposed to a single pulse (3 kV, 10 μF, 600 Ω in parallel and 30 Ω in series) with a MicroPulser™Electroporator (BIO-RAD LABORATORIES, Hercules, CA, USA). The time constant was in the range of 5.0–5.8 ms for the fresh electrocompetent cells but decreased to 4.3–4.9 ms for the frozen aliquots. Immediately following the pulse, 1 ml of room temperature 2YT medium was added, and the cells were incubated for 3 h at 32 °C before plating of the corresponding dilution on 2YT plates to count the viable cells and on 2YT plates supplied with appropriate antibiotics for the selection of resistant clones. 2.3. Characterization of recombinant cells An rpsL (encoding ribosomal protein S12)-based assay was applied for the simple and reliable screening of recombination events as described by Swingle et al. (2010a). The point mutation A128G (K43R in the amino acid sequence) resulting in StrR was described for C. glutamicum (Kim et al., 2011). To minimize the potential negative effect of the mismatch repair system on the targeted recombination efficiency, oligonucleotides that simultaneously introduced four nucleotide changes to reconstruct the desired amino acid structures were designed (Table 1). Colony forming units (CFU) were counted after cells were grown for 36 h on corresponding plates at 32 °C. The efficiency of SSAP-independent recombination was estimated as the CFU of StrR cells per 108 viable cells. The electrocompetence of the AJ1511 strain cells was estimated as (4 ± 2) × 106 CFU of KmR cells per 108 viable cells per 1 μg of pVK9 used. Tens of StrR clones were replicated onto 2YT/Str plates, and the introduced mutation in some of them was confirmed by mismatch amplification mutation assay PCR (MAMA-PCR) (Cha et al., 1992) with pairs of oligonucleotides for the (P1–P2) wildtype and (P1–P3) mutated allele. Sequencing of the mutated rpsL gene was used for final confirmation of the recombination event occurrence. 3. Results and discussion 3.1. SSAP-independent oligonucleotide-mediated recombination in B. lactofermentum AJ1511 The conceptual design of our study aimed to identify the effect of well-known SSAP-independent oligonucleotide-mediated recombination events at even slightly detectable levels under any highly specific condition. Next, several experimental parameters were changed to make the recombination efficiency acceptable for the performance of routine experiments.

111

First, only freshly prepared competent cells of B. lactofermentum were used in the same fashion as E. coli cells for the initial experiments of Red-dependent recombination (Yu et al., 2000). Second, the StrR phenotype (mutation in the rpsL gene) was chosen as a marker of the recombination event due to the low frequency of spontaneous resistance (Van Kessel and Hatfull, 2008). Only the point mutation A128G (K43R in amino acid sequence) resulting in StrR was described for C. glutamicum at that moment (Kim et al., 2011). However, substitution of one nucleotide was risky. It is well known that the insertion efficiency of a single nucleotide mutation in E. coli is rather low due to action methyl-mediated mismatch repair (MMR) system (Sawitzke et al., 2007). Although direct homologs of the E. coli MMR system were not detected in the genomes of either C. glutamicum (Resende et al., 2011) or Mycobacterium tuberculosis (Mizrahi and Andersen, 1998), which are phylogenetically close to B. lactofermentum, another repair system (e.g., nucleotide excision repair [NER]) might play the same role in repairing single nucleotide mutations in the bacteria of interest (Güthlein et al., 2009). Thus, the oligonucleotides designed for the initial experiments (P4/P5) contained four nucleotide substitutions in the rpsL gene to decrease the putative negative influence of the host repair system on the yield of the desired recombinants. For this purpose, we applied randomization of the arginine codon (CGN) that was introduced instead of the natural lysine codon (AAG) of rpsL along with one silent nucleotide change in the wobble position of the adjacent proline codon. To increase the intracellular half-life of the incorporated oligonucleotides, two consecutive nucleotides at the 5′ end of the oligonucleotides were phosphorothiorated for protection against the activity of host 5′➔3′-exonucleases (Maresca et al., 2010; Wang et al., 2009). Electroporation was performed with 0.6 μg of 80-nt oligonucleotides P4 and P5 targeted to the leading and lagging strands, respectively. As a result, ~9 ± 3 and ~490 ± 110 StrR clones per 108 viable cells, respectively, were obtained. The frequency of spontaneous resistant clone appearance was estimated as ~ (2.0 ± 1.5) × 10−8 for the control in which no oligonucleotide was added. The final confirmation that the mutation obtained in the rpsL gene resulted from the recombination event was shown by MAMA-PCR (Cha et al., 1992) followed by direct sequencing of several independent clones; all analyzed clones had the targeted sense mutation and a silent change in the adjusted proline codon. For the inserted randomized arginine codons, the following distribution of their sequences was detected in the recombinant clones: CGA—43%, CGC—43%, CGG—14% and CGT—0%. Although, such a distribution could be the result of non-random base frequencies in the oligonucleotide manufacturing process, our oligonucleotides of the next generation were designed to introduce the CGC arginine codon into the rpsL gene. The data obtained in the present study show the increased efficiency of oligonucleotide-mediated recombination in the lagging host DNA strand (the so-called effect of “strand bias”) that has been repeatedly described for other bacteria (Ellis et al., 2001; Van Kessel and Hatfull, 2008). To avoid underestimation of the recombination efficiency because of incomplete segregation of the recombinant and wild-type rpsL alleles (Kim et al., 2011) and the effect of asymmetric transcription on inheritance mutations derived from the P4/P5 oligonucleotides, we enhanced the recovery time from 3 h to O/N. No significant increase for P5-mediated recombination and a three-fold increase for P4mediated recombination were observed. Nevertheless, significant strand bias was confirmed for the AJ1511 strain. Surprisingly, such a strand bias was not observed in the recently described process of RecT-dependent oligonucleotide-mediated recombination in the C. glutamicum (closely related to B. lactofermentum) ATCC13032 strain (Binder et al., 2013). 3.2. Optimization of recombination in B. lactofermentum AJ1511 Targeting the lagging strand with an oligonucleotide with a precise sequence (P6) instead of the previously used random one (P5) did not significantly increase the recombination efficiency (the yield of

112

A.A. Krylov et al. / Journal of Microbiological Methods 105 (2014) 109–115

recombinant clones changed from 490 ± 110 to 530 ± 130 CFU/108 viable cells, falling within the confidence interval). A total of 0.6 μg of both oligonucleotides was used in these comparative experiments. The inheritance of the chosen codon variant does not appear to greatly influence the subsequent expression of the mutated rpsL gene. The cultivation time (CT) in 2YT* medium was varied to increase the electrocompetency of the cells. Prolonged cultivation with the cell-wall weakening compounds in 2YT* should be avoided (Holo and Nes, 1989; Pyne et al., 2013). In this study, CT = 3 h completely abolished the appearance of recombinants, indicating that it was one of the critical parameters of the method. Optimal results were obtained at CT = 2 h. Because cell-wall weakening compounds are assumed to make cells more osmotically fragile (Powell et al., 1988),the preparation of competent cells in a hypertonic environment (e.g., with the addition of sucrose to a final concentration of 0.5 M) or even washing in isotonic solution could improve the yield of plasmid transformants (Haynes and Britz, 1989, 1990; Holo and Nes, 1989; Pyne et al., 2013). This approach was tested in a special experiment with the addition of 0.5 M sucrose in 2YT* medium during the initial growth stage (CT 2 h), 0.27 M in the washing solution and 0.5 M in the 2YT medium during growth recovery (the positive effect of sucrose addition was recently described in an electrotransformation protocol for genetic manipulation with Clostridium pasteurianum; Pyne et al., 2013). However, improvement in the recombination efficiency after the addition of sucrose was not detected in the present study (data not shown). We did not vary the cultivation time or test other osmoprotective compounds such as trehalose or betaine, which have a positive effect during osmotic stress as confirmed for C. glutamicum (Eggeling and Bott, 2005). Freshly prepared competent cultures were used to achieve the highest recombination efficiencies in the initial experiments, but using frozen competent cells prepared beforehand was occasionally much more convenient. A decrease in the efficiency when this recombination procedure was used instead of fresh cells no doubt occurred in this case (Sawitzke et al., 2007). The differences in SSAP-independent recombination efficiency and total viability between frozen and fresh cells were quantitatively estimated. Nearly a twenty-fold decrease in the recombination efficiency was observed when 0.6 μg of P6 oligonucleotide was used for the transformation of the frozen sample. This low detected recombination efficiency could not be explained by a decrease in the total cell viability because it was not significantly changed (fresh—2.6 × 108 and frozen—2.5 × 108 viable cells per aliquot prior to electroporation). However, we supposed that, even under optimal conditions, only a minor portion(~ 0.1%) of the total cell number was able to take up DNA (Van Kessel and Hatfull, 2008). Because the Tween 80/glycine treatment made the cells more fragile (see above), high undetectable levels of death of those truly competent cells were

Frozen

1,E+04

SmR (CFU/1.E+08)

the most likely reason for the decreased recombination efficiency of the frozen culture. The effect of increased oligonucleotide (P6) concentration on the recombination efficiency was also tested (Fig. 1). The frozen culture was used in this experiment for convenience. According to the obtained data, the efficiency stably plateaued when ~ 6 μg of oligonucleotide was added; therefore, the addition of this quantity of the oligonucleotide was used for future experiments. Protection of oligonucleotides against degradation by host nucleases via phosphorothioration (Eckstein, 1985) is widely used in recombineering experiments (Wang et al., 2009, 2012). This type of protection was tested for recombination efficiency in the B. lactofermentum AJ1511 strain using P6 protected by two phosphorothiorated nucleotides at the 5′ end and P7 unprotected oligonucleotides. As expected, there was no significant difference between the oligonucleotides when saturating amounts (6 μg) were used (Fig. 2). However, the rather small difference obtained with the addition of an un-saturating amount of the oligonucleotides (0.6 μg) was an unexpected (Fig. 2). Next, we performed an experiment with a mixture of the nonhomologous to target gene P8 oligonucleotide (5.4 μg) and the targetspecific P6 oligonucleotide (0.6 μg). When added in excess, the P8 oligonucleotide, which cannot participate in recombination with the targeted rpsL gene, is usually assigned as a “carrier” and may improve the recombination efficiency due to overloading exonuclease activity (Swingle et al., 2010c). Indeed, an increase in the recombination efficiency was observed in the experiment with a small quantity of the specific oligonucleotide mixed with the carrier, and this efficiency achieved the level detected in the experiment with pure specific oligonucleotide present in excess (Fig. 2). Therefore, we concluded that protection of the two adjusted nucleotides at the 5′ end of the oligonucleotide was not very effective and that some exonuclease barriers in B. lactofermentum were present that could be overcome by increasing the amount of a specific oligonucleotide or by the addition of a carrier oligonucleotide. One possible explanation for the low efficiency of the chosen protection method could be the observation that among the four exonucleases that play a significant role in ssDNA stability in E. coli (Burdett et al., 2001), only the ortholog of ExoVII was identified in C. glutamicum (Resende et al., 2011 ). E. coli ExoVII initiates hydrolysis at both the 3′ and 5′ ends of ssDNA (Chase and Richardson, 1974). Additionally, the products of the action of E. coli ExoVII are oligonucleotides predominantly in the range of tetramers to dodecamers (Chase and Richardson, 1974), and its activity most likely results in the cleavage of phosphorothiorated termini of invading oligonucleotides (Mosberg et al., 2012). Therefore, more than two phosphorothiorated nucleotides at the 5′ or 3′ ends or even at both ends may have a positive effect in the future. Nevertheless, the absence of a positive effect when using

Fresh

1,E+03 1,E+02 1,E+01 1,E+00

0

2

4

6

8

10

12

14

16

18

Oligonucleotide (μg) Fig. 1. Dependency of the recombination efficiency on the amount of oligonucleotide (P6) added to the frozen samples of competent cells. A few fresh samples of the same competent cells were used to estimate the effect of freezing. Each point represents the average of three replicates of electroporation experiments on the same frozen competent culture, and the standard deviation is indicated by the error bars.

A.A. Krylov et al. / Journal of Microbiological Methods 105 (2014) 109–115

Fig. 2. Examination of the role of oligonucleotide protection for different oligonucleotide amounts. The difference between protected (P6) and unprotected (P7) oligonucleotides was rather small. An increase in the recombination efficiency when the nonhomologous carrier P8 oligonucleotide was added to 0.6 μg of target-specific P6 oligonucleotide is shown. Error bars represent the standard deviation of the efficiencies obtained from 3 independent experiments.

protected oligonucleotides with up to five adjusted modified nucleotides is also possible, as was shown by Van Pijkeren et al. (2012) in Lactobacillus species. Because the developed protocol was based on a protocol for efficient plasmid transformation, the influence of 46 °C heat shock on SSAPindependent oligonucleotide-mediated recombination was evaluated. Usually, the necessity of heat shock for plasmid transformation is explained by the thermo-dependent inactivation of restriction systems in different organisms (Bailey and Winstanley, 1986; Holloway, 1965). However, the reason for keeping this step for developing oligonucleotide-mediated recombination protocol is unclear. In the initial experiment, 6-min heat shock at 46 °C was performed directly after pulsing according to recommendations for efficient plasmid transformation in C. glutamicum (Van der Rest et al., 1999). Because heat shock is a signal for inducing global regulatory factor-mediated responses, its direct influence on exonuclease activity could be unpredictable. Therefore, this additional step was tested with protected and unprotected oligonucleotides (P6 and P7 at 0.6 μg each), and there was no significant difference in the recombineering efficiency between the two tested conditions (with/without heat shock) for either oligonucleotide. Consequently, heat shock was excluded from the final, optimized procedure. Finally, we tested the efficiency of a single nucleotide change (e.g., (A128G) in the rpsL gene that resulted in the StrR phenotype for C. glutamicum (Kim et al., 2011)). For this purpose, a fresh culture of the B. lactofermentum AJ1511 strain was electroporated with 6 μg of the oligonucleotide P9, which was not protected by phosphorothioration and targeted to the lagging strand. In the case of the MMR system in E. coli, the originating C•A mismatch pair had been successfully identified and repaired (Sawitzke et al., 2007). If the mismatch repair system in B. lactofermentum has nearly the same properties, we expected to observe a decrease in the recombination efficiency. Surprisingly, the efficiency of recombineering by P9(1510 ± 190) was comparable with that mediated by the P7 (four nucleotides changed) oligonucleotide (1320 ± 220). The properties of the mismatch repair system in B. lactofermentum most likely differ greatly from the well-known MMR of E. coli. The same conclusion was made by Binder et al. (2013) for the C. glutamicum ATCC13032 strain. We next tested the oligonucleotide-mediated introduction of short deletions in the B. lactofermentum genome. The rplV ribosomal gene of AJ1511 encoding the L22 protein was chosen as a new target for

113

recombination. A published study showed that the deletion of 9 base pairs (removing codons 82–84 of L22) leads to Ery resistance (EryR) in E. coli (Chittum and Champney, 1994.). The amino acid sequences of the L22 protein from E. coli and B. lactofermentum were aligned, and we found that this region was conserved (data not shown). Based on this analysis, the introduction of a 9-bp deletion (removing codons M87-K88-R89) in the rplV gene of the AJ1511 strain by SSAP-independent oligonucleotide(P8)mediated recombination was performed. The lagging strand was targeted in that case. The mutants possessing such a deletion were expected to be resistant to inhibitory concentrations (3 μg/ml) of Ery in the medium. The number of CFUs on Ery per 108 viable cell was (410 ± 170), but at the same time, there was nearly the same level of spontaneous mutation in the control in which no oligonucleotide was added. MAMA-PCR (P10–P12 for the deletion and P11–P12 for the wild type) confirmed the presence of the desired deletion in approximately 10% of the tested EryR clones, and some of these deletions were ultimately confirmed by sequencing. Therefore, the real efficiency of recombination could be estimated as ≈ 40 CFU/108. Interestingly, all clones with the desired deletion formed small colonies compared with the spontaneously obtained EryR clones, which were rather large in size. No mutation in the rplV gene was identified for the spontaneous clones by sequencing. Therefore, the resistance to Ery was suggested to be determined by mutation in another locus, with those mutations conferring a different growth rate after the recombineering procedure in medium supplied with 3 μg/ml Ery. The observed difference in the growth rate under selective conditions was described for E. coli EryR mutants, which had changes in either the L22 protein encoded by the rplV gene or the L4 protein encoded by the rplD gene (Zaman et al., 2007). 3.3. Applying SSAP-independent oligonucleotide-mediated recombination in C. glutamicum ATCC13032 To investigate the conditions appropriate for the introduction of mutations in the closely related C. glutamicum species, an experiment with SSAP-independent recombination in the chromosome of the ATCC13032 strain was conducted in parallel with that in the B. lactofermentum AJ1511 strain. Oligonucleotides previously used for recombineering into the B. lactofermentum gene rpsL were also suitable for recombineering in the C. glutamicum strain. The phosphorothiorated P6 oligonucleotide (6 μg) targeted to the lagging strand of the rpsL gene was used and successfully resulted in the appearance of StrR clones (recovery time was 3 h). Interestingly, the efficiency of recombination for ATCC13032 (6700 ± 1300 CFU/108) was even higher than that for AJ1511 (1430 ± 310 CFU/108) but was around 15-fold lower than that recently shown for RecT-dependent recombination of the same strain, as expected (Binder et al., 2013). At the same time, the estimated electrocompetency of the ATCC13032 strain for plasmid transformation was approximately 10-fold lower than that for the AJ1511 strain, or (1.4 ± 0.7) × 105 and (4 ± 2) × 106 CFU of KmR cells per 108 viable cells per 1 μg of plasmid, respectively. If the recombination efficiency was normalized by electrocompetency (Van Kessel and Hatfull, 2008), the ATCC13032 strain appeared even more proficient at recombineering than the AJ1511 strain. The reason for such oligonucleotide-mediated recombination differences requires further investigation. The detected strand bias in the process of oligonucleotide-mediated recombination in ATCC13032 was verified, as was previously confirmed for B. lactofermentum, with an experiment using P6 and its complementary oligonucleotide P13. Both oligonucleotides were protected by two phosphorothiorated nucleotides at the 5′ ends, and 6 μg of each was added. The recovery time was 3 h. There was a significant difference between the oligonucleotides targeted to the leading and lagging strands of 560 ± 130 vs. 6700 ± 1300 CFU/108, respectively. Thus, there is a strand bias during SSAP-independent recombineering in C. glutamicum

114

A.A. Krylov et al. / Journal of Microbiological Methods 105 (2014) 109–115

ATCC13032, which is in contrast to the RecT-dependent recombineering of the same strain demonstrated by Binder et al. (Binder et al., 2013). However, this could be explained by the different target genes. Indeed, even the greatest strand bias (N10,000-fold) was observed for one target gene of mycobacteria, but in the same work, the bias was significantly lower and practically disappeared for other targets (Van Kessel and Hatfull, 2008), as was the case for SSAP-dependent recombination. Note that in E. coli, the strand bias is mostly, but not solely, mediated by the properties of the mismatch repair system (Li et al., 2003). Unfortunately, little is known about the properties of repair systems in C. glutamicum and B. lactofermentum. However, the choice of the lagging strand as a target in the recombineering experiments with coryneform bacteria seems preferable. 4. Conclusion Since the development of Red/RecET-dependent recombination methods for E. coli (Ellis et al., 2001), recombineering has been adapted for several other microorganisms. In the present study, we initiated adaptation by evaluating the conditions that could provide successful oligonucleotide recombination in the absence of any additional protein factors (Swingle et al., 2010c). For the B. lactofermentum AJ1511 and C. glutamicum ATCC13032 strains, the proposed SSAP-independent oligonucleotide recombination procedure includes initial growth in rich medium supplied with cellwall weakening agents (Tween 80 and glycine; Haynes and Britz, 1989) for 2 h, the addition of 6 μg (saturation amount) of oligonucleotide targeted to the lagging strand, electroporation with a 15-kV/cm electric field and growth recovery for 3 h (sufficient for the rpsL-based model system). The effect of 6-min heat shock at 46 °C, which had been shown to positively influence plasmid transformation, was not detected in our experiments. The efficiency of oligonucleotide recombination for AJ1511 was four times lower under optimized conditions compared with ATCC13032, or (1.4 ± 0.3) × 103 and (6.7 ± 1.3) × 103 of CFU/108 viable cells, respectively. No significant difference in the recombination efficiency was observed between the displacement of one and four adjusted nucleotides in the rpsL gene of the AJ1511 strain. Nevertheless, the efficiency with the deletion of nine nucleotides into the cells of the same strain in another target gene, rplV, was significantly (~30 times) lower. In general, an optimized protocol of ssDNA-based recombineering in coryneform bacteria has been obtained. Testing SSAP-dependent oligonucleotide-mediated recombination under those optimized conditions was our next task. When this study was in its final stages, information concerning successful RecT (E. coli)-dependent oligonucleotidemediated recombination in C. glutamicum ATCC13032 was published (Binder et al., 2013). A more than ten-fold increase in the efficiency of RecT-dependent recombination was expected (Swingle et al., 2010a), and our results correlated well with this proposition and with our data concerning the recombination efficiency, the threshold of oligonucleotide saturation and the observation of the probable different properties of the mismatch repair systems of C. glutamicum and E. coli. Significant strand bias was detected in the present study for SSAP-independent recombination in both tested strains, AJ1511 and ATCC13032. In contrast, the bias was not mentioned for RecT-dependent recombineering in C. glutamicum (Binder et al., 2013). The reason for this contradiction is unclear; many conditions and the recombinant yields were different between these two studies. Nevertheless, using the lagging DNA strand as a target for any recombineering-mediated experiment is recommended for higher recombination efficiency in corynebacterium species. In summary, the successful adaptation of recombineering to new microorganisms depends on assessing variation of many experimental conditions. Starting with the optimization of conditions for SSAPindependent oligonucleotide-mediated recombineering is recommended as the simplest procedure based on the widespread phenomenon in nature. This approach combined with modern selection/enrichment

methods (Carr et al., 2012; Jiang et al., 2013) could be useful by itself and could also be a good platform for the next stage of adjustment of more efficient SSAP-dependent ssDNA- or dsDNA-mediated recombineering. Acknowledgments We thank Konstantin Rybak for his contribution to this manuscript and for many invaluable discussions. References Bailey, C.R., Winstanley, D.J., 1986. Inhibition of restriction in Streptomyces clavuligerus by heat treatment. J. Gen. Microbiol. 132, 2945–2947. Becker, J.,Wittmann, C., 2012. Bio-based production of chemicals, materials and fuels—Corynebacterium glutamicum as versatile cell factory. Curr. Opin. Biotechnol. 23, 631–640. http://dx.doi.org/10.1016/j.copbio.2011.11.012. Binder, S., Siedler, S., Marienhagen, J., Bott, M., Eggeling, L., 2013. Recombineering in Corynebacterium glutamicum combined with optical nanosensors: a general strategy for fast producer strain generation. Nucleic Acids Res. 41, 6360–6369. http://dx.doi.org/ 10.1093/nar/gkt312. Burdett, V., Baitinger, C., Viswanathan, Lovett, S.T., Modrich, P., 2001. In vivo reauirement for RecJ, ExoVII, ExoI, and ExoX in methyl-directed mismatch repair. Proc. Natl. Acad. Sci. U. S. A. 98, 6765–6770. http://dx.doi.org/10.1073/pnas.121183298. Buschke, N., Schäfer, R., Becker, J., Wittmann, C., 2012. Metabolic engineering of industrial platform microorganisms for biorefinery applications—optimization of substrate spectrum and process robustness by rational and evolutive strategies. Bioresour. Technol. 135, 544–554. http://dx.doi.org/10.1016/j.biortech.2012.11.047. Carr, P.A.,Wang, H.H.,Sterling, B., Isaacs, F.J., Lajoie, M.J., Xu, G.,Church, G.M.,Jacobson, J.M., 2012. Enhanced multiplex genome engineering through co-operative oligonucleotide co-selection. Nucleic Acids Res. 40, e132. Cha, R.S., Zarbl, H., Keohavong, P., Thilly, W.G., 1992. Mismatch amplification mutation assay (MAMA): application to the c-H-ras gene. PCR Methods Appl. 2, 14–20. Chase, J.W., Richardson, C.C., 1974. Exonuclease VII of Escherichia coli. Mechanism of action. J. Biol. Chem. 249, 4553–4561. Chittum, H.S., Champney, W.S., 1994. Ribosomal protein gene sequence changes in erythromycin-resistant mutants of Escherichia coli. J. Bacteriol. 176, 6192–6198. Correia, A., Martin, J.F., Castro, J.M., 1994. Pulsed-field gel electrophoresis analysis of the genome of amino acid producing corynebacteria: chromosome sizes and diversity of restriction patterns. Microbiology 140, 2841–2847. Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97, 6640–6645. Datta, S., Costantino, N., Zhou, X., Court, D.L., 2008. Identification and analysis of recombineering functions from Gram-negative and Gram-positive bacteria and their phages. Proc. Natl. Acad. Sci. U. S. A. 105, 1626–1631. http://dx.doi.org/10. 1073/pnas.0709089105. Eckstein, F., 1985. Nucleoside phosphorothiotes. Ann. Rev. Biochem. 54, 367–402. Eggeling, L., Bott, M., 2005. Handbook of Corynebacterium glutamicum. CRC Press, New York. Eikmanns, B.J., Kircher, M., Reinscheid, D.J., 1991. Discrimination of Corynebacterium glutamicum, Brevibacterium flavum and Brevibacterium lactofermentum by restriction pattern analysis of DNA adjacent to the hom gene. FEMS Microbiol. Lett. 66, 203–207. Ellis, H.M.,Yu, D., DiTizio, T.,Court, D.L., 2001. High efficiency mutagenesis, repair, and engineering of chromosomal DNA using single-stranded oligonucleotides. Proc. Natl. Acad. Sci. U. S. A. 98, 6742–6746. Güthlein, C., Wanner, R.M., Sander, P., Davis, E.O., Bosshard, M., Jiricny, J., Böttger, E.C., Springer, B., 2009. Characterization of the mycobacterial NER system reveals novel functions of the uvrD1 helicase. J. Bacteriol. 191, 555–562. http://dx.doi.org/10. 1128/JB.00216-08. Hanahan, D., 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166, 557–580. Haynes, J.A.,Britz, M.L., 1989. Electrotransformation of Brevibacterium lactofermentum and Corynebacterium glutamicum: growth in tween 80 increases transformation frequencies. FEMS Microbiol. Lett. 61, 329–333. http://dx.doi.org/10.1111/j.1574-6968.1989. tb03646.x. Haynes, J.A., Britz, M.L., 1990. The effect of growth conditions of Corynebacterium glutamicum on the transformation frequency obtained by electroporation. Microbiology 136, 255–263. http://dx.doi.org/10.1099/00221287-136-2-255. Holloway, B.W., 1965. Variations in restriction and modification following increase of growth temperature in Pseudomonas aeruginosa. Virology 25, 634–642. Holo, H., Nes, I.F., 1989. High-frequencytransformation, by electroporation, of Lactococcus lactis subsp. cremoris grown with glycine in osmotically stabilized media. Appl. Environ. Microbiol. 55, 3119–3123. Jiang, W.,Bikard, D.,Cox, D.,Zhang, F.,Marraffini, L.A., 2013. RNA-guided editing of bacterial genomes using CRISPR-Cas system. Nat. Biotechnol. 31, 233–239. http://dx.doi.org/ 10.1038/nbt.2508. Katashkina, J.I.,Hara, Y.,Golubeva, L.I.,Andreeva, I.G.,Kuvaeva, T.M.,Mashko, S.V., 2009. Use of the lambda Red-recombineering method for genetic engineering of Pantoea ananatis. BMC Mol. Biol. 10, 34. http://dx.doi.org/10.1186/1471-2199-10-34. Kim, I.K., Jeong, W.K., Lim, S.H., Hwang, I.K., Kim, Y.H., 2011. The small ribosomal protein S12P gene rpsL as an efficient positive selection marker in allelic exchange mutation systems for Corynebacterium glutamicum. J. Microbiol. Methods 84, 128–130. http:// dx.doi.org/10.1016/j.mimet.2010.10.007.

A.A. Krylov et al. / Journal of Microbiological Methods 105 (2014) 109–115 Li, X.T.,Costantino, N.,Lu, L.Y.,Liu, D.P.,Watt, R.M.,Cheah, K.S.,Court, D.L.,Huang, J.D., 2003. Identification of factors influencing strand bias in oligonucleotide-mediated recombination in Escherichia coli. Nucleic Acids Res. 31, 6674–6687. Li, X.T., Thomason, L.C., Sawitzke, J.A., Costantino, N., Court, D.L., 2013. Bacterial DNA polymerases participate in oligonucleotide recombination. Mol. Microbiol. 88, 906–920. http://dx.doi.org/10.1111/mmi.12231. Lieb, W., Ehrmann, M., Ludwig, W., Schleifer, K.H., 1991. Transfer of Brevibacterium divaricatum DSM 20297T, “Brevibacterium flavum” DSM 20411, “Brevibacterium lactofermentum” DSM 20412 and DSM 1412, and Corynebacterium glutamicum and their distinction by rRNA gene restriction patterns. Int. J. Syst. Bacteriol. 41, 255–260. Maresca, M.,Erler, A.,Fu, J.,Friedrich, A.,Zhang, Y.,Stewart, A.F., 2010. Single-stranded heteroduplex intermediates in λRed homologous recombination. BMC Mol. Biol. 11, 54. http://dx.doi.org/10.1186/1471-2199-11-54. Miwa, K., Matsui, K., Terabe, M., Ito, K., Nakamori, S., Sano, K., Momose, H., 1984. Cryptic plasmid in glutamic acid producing bacteria. Agric. Biol. Chem. 48, 2901–2903. Mizrahi, V.,Andersen, S.J., 1998. DNA repair in Mycobacterium tuberculosis. What have we learnt from the genome sequence? Mol. Microbiol. 29, 1331–1339. Mosberg, J.A., Lajoie, M.J., Church, G.M., 2010. Lambda Red recombineering in Escherichia coli occurs through a fully single-stranded intermediate. Genetics 186, 791–799. http://dx.doi.org/10.1534/genetics.110.120782. Mosberg, J.A., Gregg, C.J., Lajoie, M.J., Wang, H.H., Church, G.M., 2012. Improving lambda Red genome engineering in Escherichia coli via rational removal of endogenous nucleases. PLoS One 7, e44638. http://dx.doi.org/10.1371/journal.pone.0044638. Muniyappa, K., Radding, C.M., 1986. The homologous recombination system of phage lambda. Pairing activities of beta protein. J. Biol. Chem. 261, 7472–7478. Murphy, K.C.,Marinus, M.G., 2010. RecA-independent single-stranded DNA oligonucleotidemediated mutagenesis. Biol. Rep. 2, 56. http://dx.doi.org/10.3410/B2-56 (F1000). Murphy, K.C., Campellone, K.G., Poteete, A.R., 2000. PCR-mediated gene replacement in Escherichia coli. Gene 246, 321–330. Nakamura J., Hirano S., Ito H., June 2006. L-glutamic acid producing microorganism and a method for producing L-glutamic acid. U.S. patent US20060141588A1. Nešvera, J., Pátek, M., 2011. Tools for genetic manipulations in Corynebacterium glutamicum and their applications. Appl. Microbiol. Biotechnol. 90, 1641–1654. http://dx.doi.org/10.1007/s00253-011-3272-9. Powell, I.B., Achen, M.G., Hillier, A.J., Davidson, B.E., 1988. A simple and rapid method for genetic transformation of lactic streptococci by electroporation. Appl. Environ. Microbiol. 54, 655–660. Pyne, M.E., Moo-Young, M., Chung, D.A., Chou, C.P., 2013. Development of an electrotransformation protocol for genetic manipulation of Clostridium pasteurianum. Biotechnol. Biofuels 6, 50. http://dx.doi.org/10.1186/1754-6834-6-50. Resende, B.C.,Rebelato, A.B.,D'Afonseca, V.,Santos, A.R.,Stutzman, T.,Azevedo, V.A.,Santos, L.L., Miyoshi, A., Lopes, D.O., 2011. DNA repair in Corynebacterium model. Gene 482, 1–7. http://dx.doi.org/10.1016/j.gene.2011.03.008. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: a laboratory manual, third ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sawitzke, J.A., Thomason, L.C., Costantino, N., Bubunenko, M., Datta, S., Court, D.L., 2007. Recombineering: in vivo genetic engineering in E. coli, S. enterica, and beyond. Methods Enzymol. 421, 171–199. Sawitzke, J.A., Costantino, N., Li, X.T., Thomason, L.C., Bubunenko, M., Court, C., Court, D.L., 2011. Probing cellular processes with oligo-mediated recombination and using the

115

knowledge gained to optimize recombineering. J. Mol. Biol. 407, 45–59. http://dx. doi.org/10.1016/j.jmb.2011.01.030. Schäfer, A., Tauch, A., Jäger, W., Kalinowski, J., Thierbach, G., Pühler, A., 1994. Small mobilizable multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 145 (1), 69–73. Shimomura-Shimizu, M., Karube, I., 2010. Applications of microbial cell sensors. Adv. Biochem. Eng. Biotechnol. 118, 1–30. http://dx.doi.org/10.1007/10_2009_19. Shirai, T., Fujimura, K., Furusawa, C., Nagahisa, K., Shioya, S., Shimizu, H., 2007. Study on roles of anaplerotic pathways in glutamate overproduction of Corynebacterium glutamicum by metabolic flux analysis. Microb. Cell Fact. 6, 19. Swingle, B., Bao, Z., Markel, E., Chambers, A., Cartinhour, S., 2010a. Recombineering using RecTE from Pseudomonas syringae. Appl. Environ. Microbiol. 76, 4960–4968. http:// dx.doi.org/10.1128/AEM.00911-10. Swingle, B., Markel, E., Cartinhour, S., 2010b. Oligonucleotide recombination: a hidden treasure. Bioeng. Bugs 1, 263–266. http://dx.doi.org/10.4161/bbug.1.4.12098. Swingle, B., Markel, E., Costantino, N., Bubunenko, M.G., Cartinhour, S., Court, D.L., 2010c. Oligonucleotide recombination in Gram-negative bacteria. Mol. Microbiol. 75, 138–148. http://dx.doi.org/10.1111/j.1365-2958.2009.06976.x. Van der Rest, M.E., Lange, C., Molenaar, D., 1999. A heat shock following electroporation induces highly efficient transformation of Corynebacterium glutamicum with xenogeneic plasmid DNA. Appl. Microbiol. Biotechnol. 52, 541–545. Van Kessel, J.C., Hatfull, G.F., 2007. Recombineering in Mycobacterium tuberculosis. Nat. Methods 4, 147–152. http://dx.doi.org/10.1038/nmeth996. Van Kessel, J.C., Hatfull, G.F., 2008. Efficient point mutagenesis in mycobacteria using single-stranded DNA recombineering: characterization of antimycobacterial drug targets. Mol. Microbiol. 67, 1094–1107. http://dx.doi.org/10.1111/j.1365-2958.2008. 06109.x. Van Pijkeren, J.P.,Britton, R.A., 2012. High efficiency recombineering in lactic acid bacteria. Nucleic Acids Res. 40, e76. http://dx.doi.org/10.1093/nar/gks147. Van Pijkeren, J.P.,Neoh, K.M.,Sirias, D.,Findley, A.S.,Britton, R.A., 2012. Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri. Bioengineered 3, 209–217. http://dx.doi.org/10.4161/bioe.21049. Wang, H.H.,Isaacs, F.J., Carr, P.A., Sun, Z.Z.,Xu, G., Forest, C.R.,Church, G.M., 2009. Programming cells by multiplex genome engineering and accelerated evolution. Nature 460, 894–898. http://dx.doi.org/10.1038/nature08187. Wang, Y., Weng, J., Waseem, R., Yin, X., Zhang, R., Shen, Q., 2012. Bacillus subtilis genome editing using ssDNA with short homology regions. Nucleic Acids Res. 40, e91. http://dx.doi.org/10.1093/nar/gks248. Yu, D., Ellis, H.M., Lee, E.C., Jenkins, N.A., Copeland, N.G., Court, D.L., 2000. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 97, 5978–5983. Zaman, S., Fitzpatrick, M., Lindahl, L., Zengel, J., 2007. Novel mutations in ribosomal proteins L4 and L22 that confer erythromycin resistance in Escherichia coli. Mol. Microbiol. 66, 1039–1050. Zhang, Y., Buchholz, F., Muyrers, J.P., Stewart, A.F., 1998. A new logic for DNA engineering using recombination in Escherichia coli. Nat. Genet. 20, 123–128.