- Email: [email protected]
Ontogenic changes in placental transthyretin
Placenta 32 (2011) 817e822
Contents lists available at SciVerse ScienceDirect
Placenta journal homepage: www.elsevier.com/locate/placenta
Ontogenic changes in placental transthyretin J. Patela, b, K.A. Landersb, H. Lib, R.H. Mortimera, b, c, K. Richarda, b, * a
School of Medicine, The University of Queensland, Herston 4006, Brisbane, Australia Conjoint Endocrine Laboratory, Royal Brisbane and Women’s Hospital, 300 Herston Rd, Herston, Brisbane, Queensland 4029, Australia c Disciplines of Medicine, Obstetrics and Gynaecology, The University of Queensland, Herston 4006, Brisbane, Australia b
a r t i c l e i n f o
a b s t r a c t
Article history: Accepted 6 September 2011
Objectives: Before secretion of fetal thyroid hormone at around 16 weeks gestation normal fetal development depends on a constant supply of maternal thyroid hormone (TH), particularly thyroxine (T4). The detailed mechanisms of transplacental delivery of TH are still uncertain. The TH binding protein, transthyretin (TTR), is produced and secreted by placenta and may play a role in this process. The ontogeny of placental TTR is unknown. Our aim was to study changes in placental TTR in early and late pregnancy. Study design: We collected placentas from surgically terminated pregnancies between 6 and 17 weeks gestation (n ¼ 44) and from normal term (38e39 weeks) pregnancies following caesarean section (n ¼ 5). Real time-PCR, western blotting and immunohistochemistry were used to determine TTR mRNA and protein levels. Results: There were highly significant correlations between gestational age and TTR mRNA (r ¼ 0.974; p < 0.0001) and between gestational age and TTR protein (r ¼ 0.901; p < 0.001) levels between weeks 6 and 13 of gestation. TTR expression did not increase between 13 and 17 weeks and was not different at term. Good correlation was observed between TTR mRNA and TTR protein between individual placental samples (r ¼ 0.916; p < 0.0001). A similar trend was observed using immunohistochemical staining of placental paraffin sections. Conclusions: Our results demonstrate that TTR is expressed in the human placenta from at least 6 weeks gestation. Levels rise during the first trimester at a time when placental oxygen tensions are also rising. We hypothesise that TTR production and secretion by the placenta may facilitate transplacental delivery of TH to the fetus. Crown Copyright Ó 2011 Published by Elsevier Ltd. All rights reserved.
Keywords: Placenta Transthyretin Thyroid hormone Pregnancy Transport
1. Introduction Thyroid hormones, thyroxine (T4) and its active metabolite triiodothyronine (T3), are critical for normal embryological development, particularly that of the brain. Before the fetus begins to secrete thyroid hormone (TH) at around 16 weeks gestation it relies solely on a supply of maternal TH [1]. Clinical studies suggest that even minor reductions in maternal T4 levels in the first trimester are associated with significant cognitive impairment in the offspring, suggesting that an optimally functioning materno-fetal transport system and adequate maternal T4 levels are essential for normal fetal brain function [2,3]. While pathways for transplacental delivery of maternal TH to the fetus are not completely * Corresponding author. Conjoint Endocrine Laboratory, Royal Brisbane and Women’s Hospital, 300 Herston Rd, Herston, Brisbane, Queensland 4029, Australia. Tel.: þ61 7 3362 0495; fax: þ61 7 3636 8842. E-mail address: [email protected] (K. Richard).
understood, cell membrane TH transporters found in placental syncytiotrophoblasts and cytotrophoblasts are probably involved. We recently reported that the TH binding protein, transthyretin (TTR), is produced by placenta and secreted via the apical (maternal), and to a lesser extent, the basal (fetal) trophoblast membranes [4,5]. We postulate that carrier mediated transport of maternal T4 to the fetus by placental TTR may be an important component of the early pregnancy materno-fetal T4 transfer mechanism [5]. Transthyretin (TTR) is a 56-kDa homotetrameric protein found in serum that binds T4 and retinol (through retinol binding protein) [6]. TTR is synthesised by liver and secreted into the circulation where together with thyroxine binding globulin and albumin it forms the three major plasma thyroid hormone transport proteins. TTR has a relatively high binding affinity for T4 of 7.0 107 and a serum concentration of approximately 4.6 106 M, accounting for approximately 15% of circulating protein bound T4 [7]. TTR is also synthesised and secreted by choroid plexus and accounts for
0143-4004/$ e see front matter Crown Copyright Ó 2011 Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.placenta.2011.09.007
818
J. Patel et al. / Placenta 32 (2011) 817e822
about 25% of CSF protein [8] where it is the predominant T4 binding protein in cerebrospinal fluid (CSF) [9]. TTR may be involved in transfer of serum T4 to CSF and distribution of CSF T4 into brain. The retinal pigment epithelium also produces TTR which may be involved in TH delivery to the eye [10]. The purpose of the present study was to obtain a better understanding of the ontogeny of placental TTR expression and localisation in human pregnancy.
dilutions, as previously described [18]. Horseradish peroxidase-conjugated secondary antibodies (GE Healthcare, Buckinghamshire, UK) were used at 1:3000. Blots were developed using a Supersignal West Femto Kit (Pierce Biotechnology, Rockford, USA) following the manufacturer’s instructions and images captured by charge-coupled device camera (Fuji image LAS-3000; Fujifilm, Brookvale, Australia). Densitometric analysis was performed using Multigauge v2.3 software (Fuji, Fujifilm, Brookvale, Australia). TTR protein levels were normalised to b-actin. 2.4. Immunohistochemistry (IHC)
2. Materials and methods 2.1. Placental tissues Placental tissues from first and second trimester (6e17 wks) (Total n ¼ 44)e(6 wks (n ¼ 5); 7 wks (n ¼ 7); 8 wks (n ¼ 3); 9 wks (n ¼ 5); 10 wks (n ¼ 5); 11 wks (n ¼ 3); 12 wks (n ¼ 3); 13 wks (n ¼ 3); 14 wks (n ¼ 3); 15 wks (n ¼ 3); 16 wks (n ¼ 3) 17 wks (n ¼ 1)) terminated pregnancies were collected with informed consent soon after delivery. While individual patient information was not released the majority of terminations were for psychosocial reasons. Samples were dated by ultrasonographically measuring crown-rump length. Tissue was washed three times thoroughly in saline to remove any excess blood. Placental villi were then carefully removed. Unwanted and contaminating material such as decidual tissue was then dissected away from the placental villi and then carefully centrifuged at 130g for 5 min. Early placental tissue was centrifuged to for 5 min to recover villi that had a tendency to float in saline. Placental tissue from term (38e39 weeks gestation) normal healthy women undergoing planned caesarean sections at the Royal Brisbane and Women’s Hospital was collected with informed consent soon after delivery. Placental samples (w1 cm 1 cm cubes) were randomly selected from different areas of the placenta and combined. The placental chunks were then washed three times thoroughly in saline to remove any excess blood. Areas of placental tissue bordered by blood clots were discarded. Placental tissues were fixed in 4% paraformaldehyde (pH 7.3) for 10 min before processing to paraffin blocks. Remaining villous tissues were stored in RNA-later solution (Ambion, Austin, USA) at 20 C to be used for RNA and protein determination. Human Research Ethics Committees of The Royal Brisbane and Women’s Hospital and Queensland Institute of Medical Research approved this study. 2.2. Real time-PCR Total RNA was extracted from 30 mg of placental villi using the RNAeasy Mini Kit (Qiagen, California, USA) for each individual sample collected. 3 mg of total RNA was reverse transcribed to produce cDNA using the Superscript III Reverse Transcription Kit (Invitrogen, Mount Waverley, Australia) and P (dt) 15 primers (Roche Applied Sciences, Mannheim, Germany) in a reaction volume of 20 mL. RT-PCR was performed using 0.5 mM of forward and reverse primers with FastStart SYBR Green Master-mix per reaction (Roche Applied Sciences) in a Rotor Gene RG-3000 (Corbett Research, Mortlake, Australia). Preparing a standard curve using serially diluted cDNA validated the RT-PCR method. To quantify the mRNA expression profile in each sample, the efficiency of each standard curve was determined by its slope and comparative threshold according to the manufacturer’s instructions. For each sample, the amount of targeted mRNA (arbitrary units) was normalised to the housekeeping gene b-actin, which does not change significantly during placental development [11]. The primers used to amplify specific mRNAs are listed in Table 1. All PCR samples were run in triplicate. 2.3. Western blotting A homogenate was made from placental villi using a sucrose (250 mM)/HEPES (10 mM) pH 7.4 buffer and Protein Inhibitor Cocktail (Sigma, St Louis, USA). 30 mg of total protein was separated on 4e12% Novex NuPage Bis/Tris gels (Invitrogen, Mount Waverley, Australia) and transferred onto nitrocellulose membrane (BioRad TransBlot, Hercules, USA). Each blot included samples from a single gestational group (e. g. 6 weeks) and a lane that included 5 ng pure human TTR (Sigma, St Louis, USA) as a positive control. Rabbit anti-TTR (Dako Australia Pty. Ltd., Campbellfield, Australia), and mouse anti-b-actin (Sigma, St Louis, USA) antibody were used at 1:1000
Table 1 Primer sequences.a Gene
Primers
b-Actin
(Forward) 50 - CATGTACGTTGCTATCCAGGC -30 (Reverse) 50 - CTCCTTAATGTCSCGCACGAT -30 (Forward) 50 - ATGGCTTCTCATCGTCTGCT -30 (Reverse) 50 - TGTCATCAGCAGCCTTTCTG -30
TTR a
TTR, Transthyretin.
The presence of TTR and cytokeratin-7 (cyt-7), a trophoblast marker, was investigated by IHC in two individual samples across each gestational age group. Serial 3e4 mM sections were cut and affixed to adhesive Menzel Superfrost Plus slides (Braunschweig, Germany). Sections were dewaxed and rehydrated through xylol and a series of descending graded alcohols to Tris-buffered saline (TBS) (pH 7.4). Heat induced antigen retrieval was conducted for 20 min at 98 C using a decloaking chamber (Biocare Medical, Concord, USA) prior to immunohistochemistry. The sections were then incubated for 60 min at room temperature in either anti-human TTR (1:400 dilution) or mouse anti-human cyt-7 (1:100), both sourced from Dako, Glostrup, Denmark. Sections were then serially washed in TBS, before endogenous peroxidase activity was blocked with 1% TBS-H2O2 for 20 mins. HRP-conjugated anti-rabbit and anti-mouse secondary antibodies were applied for 30 min at room temperature. After washing in TBS, sections were then incubated with 3,30 -diaminobenzidine (DAB) (Sigma, St Louis, USA) for 5 min and then washed again gently under running tap water to removed excess chromogen. Sections were lightly counterstained in Mayers’ haematoxylin and then dehydrated through ascending graded alcohols, cleared in xylene, and mounted using DePeX medium (xylene base) (Thermo Scientific, Rockford, USA). Negative controls were incubated with the appropriate IgG fractions as isotype controls. 2.5. Microscopy IHC images were captured using the 40X objective on an Olympus BX-41 microscope with Olympus DP70 camera (Olympus, Tokyo, Japan). IHC images were examined for evidence of TTR and cyt-7. 2.6. Statistics Graph Pad Prism version v 5.04 (GraphPad Software La Jolla, CA USA) was used for statistical analysis. Single factor analysis of variance (ANOVA) was used to evaluate differences between mean values over gestational age. Differences were further evaluated using a post hoc test (Bonferroni). Pearson product moment correlation coefficients (r) were also calculated to examine relationships between gestational age and mRNA and protein expression. It is used to estimate the proportion of the variability in a data set and measure the correlation between two variables.
3. Results 3.1. TTR mRNA in placental tissue RT-PCR demonstrated detectable TTR mRNA in all samples from 6 weeks gestation on (Fig. 1A). Equality of means was excluded by ANOVA (F ¼ 15.34, p < 0.001). Increases in mRNA expression between weeks 6e10 (p < 0.01); 6e13 (p < 0.001) and 6e38 (p < 0.001) was observed. Mean TTR mRNA levels were highly correlated with gestational age between 6 and 13 weeks (r ¼ 0.974, p < 0.0001). No significant change was however observed in TTR mRNA levels between weeks 13e17. Levels at term were similar to those at 13e17 weeks (Fig. 1C). 3.2. TTR protein in placental tissue Western blotting was used to measure TTR in placental villi samples (Fig. 2A). Levels were detectable from 6 weeks on. There was a significant difference in mean mRNA levels with time (F ¼ 9.64, p < 0.01). Using Bonferroni’s test levels at weeks 6e10 (p < 0.05); 6e13 (p < 0.01) and 6e38 (p < 0.01) were different. As with TTR mRNA expression TTR protein levels between 6 and 13 weeks were strongly correlated with time (r ¼ 0.901; p < 0.001, Fig. 2B). Levels at 13e17 weeks and term (Fig. 2C) were not different. We have demonstrated excellent correlation between TTR
J. Patel et al. / Placenta 32 (2011) 817e822
819
Fig. 1. Transthyretin (TTR) mRNA was measured in placental villi samples from first trimester (6e17 wks; n ¼ 44) and term (38e39 wks; n ¼ 5) pregnancies. (A) A dot plot representing the mRNA expression of TTR through gestation. (B) Significant and linear increases (r ¼ 0.974; p < 0.0001) were observed from weeks 6e13. (C) Conversely, between weeks 13e17 and placenta from term, TTR mRNA levels remained constant. Each dot point on the figure represents an average of the means conducted in triplicate for each individual placental sample.
mRNA and TTR protein between individual samples collected (r ¼ 0.916; p < 0.0001). 3.3. IHC analysis Images from sections stained for TTR and the trophoblast marker cytokeratin-7 (cyt-7) were captured to demonstrate absence or presence of TTR protein staining within placental villi (Fig. 3). There was constant strong positive staining for cyt-7 in placental trophoblast cells at all gestational ages. At 6 weeks gestation TTR was undetectable using IHC methods but appeared to increase from 8 weeks to 14 weeks, remaining constant thereafter. 4. Discussion Thyroid hormones, especially T4, are critical for normal fetal brain development [12]. Before fetal T4 secretion begins at around the 16th week of gestation the fetus is dependent on transplacental delivery of maternal TH. A number of cell membrane TH transporters have been identified in placenta, including monocarboxylate transporters 8 and 10 (MCT8, MCT10), L-amino acid transporter 1 and 2 (LAT 1, LAT 2) and organic anion transporting polypeptide 1A2 and 4A1 (OATP1A2, OATP4A1). These are almost certainly involved in materno-fetal TH transport (for a review see [13]). We have recently reported that the term placenta actively produces and secretes TTR, a TH binding protein (THBP) [4]. Placental TTR is secreted predominantly via the apical cell membrane. TTR can also be taken up by trophoblasts [5], raising the
possibility that placental TTR acts as a shuttle system to move maternal T4 and perhaps retinol into the placenta. This could be by delivery of T4 to the membrane transporters, transmembrane carriage of T4 or both. TTR entry into cells has also been described in kidney and choroid plexus. In 1986, Soprano and colleagues described the synthesis of TTR by rat visceral yolk sac and postulated that it may play a role in retinol transfer to the fetus [14]. Likewise, TTR synthesised by choroid plexus has been shown to play a role in transfer of T4 into rat brain [15]. TTR can also be taken up by human kidney [16] and uptake is increased in the presence of T4. Our aim therefore was to investigate the ontogeny of TTR, particularly during the critical early stages of pregnancy, to further our understanding of the role that TTR may play in transplacental T4 delivery. We have demonstrated highly significant time dependent linear increases in TTR mRNA and protein levels in early pregnancy (weeks 6e13). However, from week 13e17 of gestation TTR mRNA and protein levels remained constant and were not different from levels at term. This same trend was observed in TTR immunohistochemical studies, which also demonstrated strong localisation of TTR to cytotrophoblasts and syncytiotrophoblasts. During the first trimester of pregnancy the placenta is relatively hypoxic with low oxygen levels that rise to reach an average of about 2.5% at 8 weeks gestation. With establishment of the spiral arterioles oxygen levels rise, further to an average of about 8.5% at 12 weeks gestation, at which levels persist until delivery [17,18]. We recently reported that oxygen regulates expression and production of TTR in cultured JEG-3 human choriocarcinoma cells [19]. JEG-3
820
J. Patel et al. / Placenta 32 (2011) 817e822
Fig. 2. Transthyretin (TTR) protein was measured in placental villi samples from first trimester (6e17 wks; n ¼ 44) and term (38e39 wks; n ¼ 5) pregnancies. (A) A dot plot representing the protein expression of TTR through gestation measured by Western blot. (B) Significant and linear increases (r ¼ 0.901; p < 0.001) were observed between weeks 6e13. (C) Conversely, between weeks 13e17 and placenta from term, TTR protein level remained constant. Each dot point on the figure represents an average of the means conducted in triplicate for each individual placental sample. Strong correlation between TTR mRNA vs TTR protein was also observed between individual placental samples (r ¼ 0.916; p < 0.0001).
cells cultured at 1% oxygen produce higher levels of TTR mRNA and protein than cells cultured at 8% oxygen. We hypothesised that expression of TTR within the human placenta would be relatively high early in the first trimester of pregnancy when placental oxygen levels are low (up to 2.5%) and then progressively fall until 12 weeks gestation as placental bed oxygen concentrations rise to about 8.5%. and persist at that level throughout pregnancy. We found the contrary and this perhaps somewhat surprising result probably reflects the complexity of cell types and interactions in the functioning human placenta, with a potentially large number of TTR gene regulating factors, in contrast to the rigid controlled conditions applied to cell lines during laboratory culture. Mapping of the mouse TTR promoter region from the liver has demonstrated a number of regulatory protein binding sites that differentially affect TTR transcription. Therefore, analysis into the TTR promoter region within the human placenta warrants attention to determine other regulatory factors (apart from hypoxia demonstrated in vitro) that may well be affecting TTR expression throughout gestation. There is little information about TTR levels in fetal serum. Fryer and colleagues studied levels of several proteins in the plasma of normal human fetuses from 13 to 41 weeks gestation [20]. While levels of most serum proteins such as albumin, ceruloplasmin and transferrin rose with increasing gestation mean plasma TTR levels were highest at 13e16 weeks and then fell as pregnancy progressed [20]. The fetus appears to produce TTR as early as 8 weeks gestation in pancreas and gastrointestinal tract but TTR was not detected immunohistochemically in early or late fetal liver [21]. A later study
demonstrated only weakly immunoreactive TTR in the liver of an 8 week fetus and weak liver immunoreactivity in 3 of 5 mid-term fetuses [22]. In situ hybridisation was also used to localise TTR mRNA in that study. Strong choroid plexus labelling was demonstrated at 8 weeks but again only weak labelling in liver at 8 and again at 20 weeks. A study by Greenberg and colleagues in 1970 [23] demonstrated that, during early pregnancy, T4 in fetal serum is predominantly bound to TTR. As the fetus matures TTR binding decreases as TBG binding of T4 increases. By the 20th week of gestation, fetal TBG bound around 78% of 125I-T4, a level that is similar to binding in adult serum. Whether the decrease in TTR binding of T4 reflects a change in fetal serum TTR concentration or a change in binding affinity is undetermined. Maternal plasma TTR levels do not appear to change throughout pregnancy although urinary TTR is reported to be a thousand times higher in the urine of pregnant compared with non pregnant individuals (45 65 mg/g creatinine versus 46 24 ng/g creatinine) [24,25]. These results suggest that the high plasma TTR levels of 13e16 week fetuses and perhaps the high urine TTR of pregnant women may be of placental origin. Previous reports from our laboratory have shown that trophoblastic TTR is secreted via apical (maternal) and basal (fetal) surfaces and that TTR is actively taken up by trophoblasts [5]. TTR binds T4, which facilitates formation of tetrameric TTR and enhances trophoblast TTR uptake. TTR cross-linked with T4 is also actively taken up by trophoblasts [5]. Thus TTR may facilitate transfer of T4 across the placenta. Whether this is by carriage of T4
J. Patel et al. / Placenta 32 (2011) 817e822
821
by TTR, delivery of T4 by TTR to membrane thyroid hormone transporters or a combination of the two is as yet unclear. 5. Conclusion It is now clear that TTR is expressed in the human placenta as early as 6 weeks and throughout gestation. The role of placental TTR remains speculative although it is quite likely that TTR either presents T4 to membrane TH transporters carries maternal T4 into the fetal circulation or both. Acknowledgements This study was supported by the Division of Chemical Pathology, Pathology Queensland, Department of Endocrinology, Royal Brisbane and Women’s Hospital and the Royal Brisbane and Women’s Hospital Research Foundation. We thank staff who recruited women who kindly donated their placentas for our study. References
Fig. 3. Immunohistochemical (IHC) images demonstrating staining for transthyretin (TTR) and cytokeratin-7 (cyt-7). IHC staining was conducted on individual samples to confirm the absence or presence of protein. TTR staining demonstrates localisation of TTR protein within the trophoblast lining of the placental villi, with increasing intensity of staining from weeks 6 gestation. IHC staining matched TTR mRNA and protein expression with increasing TTR intensity till week 14 in gestation. Thereafter the level of TTR staining intensity remained similar. Images were taken at 40X magnification. Scale bar 20 mm.
[1] Thorpe-Beeston JG, Nicolaides KH, Felton CV, Butler J, McGregor AM. Maturation of the secretion of thyroid hormone and thyroid-stimulating hormone in the fetus. N Engl J Med 1991;324(8):532e6. [2] Morreale de Escobar G. Maternal hypothyroxinemia versus hypothyroidism and potential neurodevelopmental. Alterations of her offspring. Ann Endocrinol (Paris) 2003;64(1):51e2. [3] Patel J, Landers K, Li H, Mortimer RH, Richard K. Thyroid hormones and fetal neurological development. J Endocrinol 2011;209(1):1e8. [4] McKinnon B, Li H, Richard K, Mortimer R. Synthesis of thyroid hormone binding proteins transthyretin and albumin by human trophoblast. J Clin Endocrinol Metab 2005;90(12):6714e20. [5] Landers KA, McKinnon BD, Li H, Subramaniam VN, Mortimer RH, Richard K. Carrier-mediated thyroid hormone transport into placenta by placental transthyretin. J Clin Endocrinol Metab 2009;94(7):2610e6. [6] van Jaarsveld PP, Edelhoch H, Goodman DS, Robbins J. The interaction of human plasma retinol-binding protein and prealbumin. J Biol Chem 1973; 248(13):4698e705. [7] Hagen GA, Elliott WJ. Transport of thyroid hormones in serum and cerebrospinal fluid. J Clin Endocrinol Metab 1973;37(3):415e22. [8] Aldred AR, Brack CM, Schreiber G. The cerebral expression of plasma protein genes in different species. Comp Biochem Physiol B Biochem Mol Biol 1995; 111(1):1e15. [9] Dickson PW, Aldred AR, Marley PD, Tu GF, Howlett GJ, Schreiber G. High prealbumin and transferrin mRNA levels in the choroid plexus of rat brain. Biochem Biophys Res Commun 1985;127(3):890e5. [10] Cavallaro T, Martone RL, Dwork AJ, Schon EA, Herbert J. The retinal pigment epithelium is the unique site of transthyretin synthesis in the rat eye. Invest Ophthalmol Vis Sci 1990;31(3):497e501. [11] Lacey HA, Nolan T, Greenwood SL, Glazier JD, Sibley CP. Gestational profile of Naþ/Hþ exchanger and Cl-/HCO3- anion exchanger mRNA expression in placenta using real-time QPCR. Placenta 2005;26(1):93e8. [12] Glinoer D, Delange F. The potential repercussions of maternal, fetal, and neonatal hypothyroxinemia on the progeny. Thyroid 2000;10(10):871e87. [13] Patel J, Landers K, Li H, Mortimer RH and Richard K. Delivery of maternal thyroid hormones to the fetus. Trends Endocrinol Metab 22(5):164e170. [14] Soprano DR, Goodman DS. Retinol-binding protein and transthyretin mRNA levels in visceral yolk sac and liver during fetal development in the rat. Proc Natl Acad Sci (USA) 1986;83(19):7330e4. [15] Schreiber G, Aldred AR, Jaworowski A, Nilsson C, Achen MG, Segal MB. Thyroxine transport from blood to brain via transthyretin synthesis in choroid plexus. Am J Physiol 1990;258(2 Pt 2):R338e45. [16] Sousa MM, Norden AG, Jacobsen C, Willnow TE, Christensen EI, Thakker RV, et al. Evidence for the role of megalin in renal uptake of transthyretin. J Biol Chem 2000;275(49):38176e81. [17] Huppertz B, Peeters LL. Vascular biology in implantation and placentation. Angiogenesis 2005;8(2):157e67. [18] Schneider H. Oxygenation of the placental-fetal unit in humans. Respir Physiol Neurobiol 2011;178(1):51e8. [19] Patel J, Landers K, Li H, Mortimer RH, Richard K. Oxygen concentration regulates expression and uptake of transthyretin, a thyroxine binding protein, in JEG-3 choriocarcinoma cells. Placenta 2011;32(2):128e33. [20] Fryer AA, Jones P, Strange R, Hume R, Bell JE. Plasma protein levels in normal human fetuses: 13 to 41 weeks’ gestation. Br J Obstet Gynaecol 1993;100(9): 850e5. [21] Gray HD, Gray ES, Horne CH. Sites of prealbumin production in the human fetus using the indirect immunoperoxidase technique. Virchows Arch A Pathol Anat Histopathol 1985;406(4):463e73.
822
J. Patel et al. / Placenta 32 (2011) 817e822
[22] Jacobsson B. Localization of transthyretin-mRNA and of immunoreactive transthyretin in the human fetus. Virchows Arch A Pathol Anat Histopathol 1989;415(3):259e63. [23] Greenberg AH, Czernichow P, Reba RC, Tyson J, Blizzard RM. Observations on the maturation of thyroid function in early fetal life. J Clin Invest 1970;49(10):1790e803.
[24] Schweigert FJ, Wirth K, Raila J. Characterization of the microheterogeneity of transthyretin in plasma and urine using SELDI-TOF-MS immunoassay. Proteome Sci 2004;2(1):5. [25] Giacoia GP. Concentration of serum prealbumin and retinol-binding proteins during pregnancy. South Med J 1984;77(10):1261e3.
Contents lists available at SciVerse ScienceDirect
Placenta journal homepage: www.elsevier.com/locate/placenta
Ontogenic changes in placental transthyretin J. Patela, b, K.A. Landersb, H. Lib, R.H. Mortimera, b, c, K. Richarda, b, * a
School of Medicine, The University of Queensland, Herston 4006, Brisbane, Australia Conjoint Endocrine Laboratory, Royal Brisbane and Women’s Hospital, 300 Herston Rd, Herston, Brisbane, Queensland 4029, Australia c Disciplines of Medicine, Obstetrics and Gynaecology, The University of Queensland, Herston 4006, Brisbane, Australia b
a r t i c l e i n f o
a b s t r a c t
Article history: Accepted 6 September 2011
Objectives: Before secretion of fetal thyroid hormone at around 16 weeks gestation normal fetal development depends on a constant supply of maternal thyroid hormone (TH), particularly thyroxine (T4). The detailed mechanisms of transplacental delivery of TH are still uncertain. The TH binding protein, transthyretin (TTR), is produced and secreted by placenta and may play a role in this process. The ontogeny of placental TTR is unknown. Our aim was to study changes in placental TTR in early and late pregnancy. Study design: We collected placentas from surgically terminated pregnancies between 6 and 17 weeks gestation (n ¼ 44) and from normal term (38e39 weeks) pregnancies following caesarean section (n ¼ 5). Real time-PCR, western blotting and immunohistochemistry were used to determine TTR mRNA and protein levels. Results: There were highly significant correlations between gestational age and TTR mRNA (r ¼ 0.974; p < 0.0001) and between gestational age and TTR protein (r ¼ 0.901; p < 0.001) levels between weeks 6 and 13 of gestation. TTR expression did not increase between 13 and 17 weeks and was not different at term. Good correlation was observed between TTR mRNA and TTR protein between individual placental samples (r ¼ 0.916; p < 0.0001). A similar trend was observed using immunohistochemical staining of placental paraffin sections. Conclusions: Our results demonstrate that TTR is expressed in the human placenta from at least 6 weeks gestation. Levels rise during the first trimester at a time when placental oxygen tensions are also rising. We hypothesise that TTR production and secretion by the placenta may facilitate transplacental delivery of TH to the fetus. Crown Copyright Ó 2011 Published by Elsevier Ltd. All rights reserved.
Keywords: Placenta Transthyretin Thyroid hormone Pregnancy Transport
1. Introduction Thyroid hormones, thyroxine (T4) and its active metabolite triiodothyronine (T3), are critical for normal embryological development, particularly that of the brain. Before the fetus begins to secrete thyroid hormone (TH) at around 16 weeks gestation it relies solely on a supply of maternal TH [1]. Clinical studies suggest that even minor reductions in maternal T4 levels in the first trimester are associated with significant cognitive impairment in the offspring, suggesting that an optimally functioning materno-fetal transport system and adequate maternal T4 levels are essential for normal fetal brain function [2,3]. While pathways for transplacental delivery of maternal TH to the fetus are not completely * Corresponding author. Conjoint Endocrine Laboratory, Royal Brisbane and Women’s Hospital, 300 Herston Rd, Herston, Brisbane, Queensland 4029, Australia. Tel.: þ61 7 3362 0495; fax: þ61 7 3636 8842. E-mail address: [email protected] (K. Richard).
understood, cell membrane TH transporters found in placental syncytiotrophoblasts and cytotrophoblasts are probably involved. We recently reported that the TH binding protein, transthyretin (TTR), is produced by placenta and secreted via the apical (maternal), and to a lesser extent, the basal (fetal) trophoblast membranes [4,5]. We postulate that carrier mediated transport of maternal T4 to the fetus by placental TTR may be an important component of the early pregnancy materno-fetal T4 transfer mechanism [5]. Transthyretin (TTR) is a 56-kDa homotetrameric protein found in serum that binds T4 and retinol (through retinol binding protein) [6]. TTR is synthesised by liver and secreted into the circulation where together with thyroxine binding globulin and albumin it forms the three major plasma thyroid hormone transport proteins. TTR has a relatively high binding affinity for T4 of 7.0 107 and a serum concentration of approximately 4.6 106 M, accounting for approximately 15% of circulating protein bound T4 [7]. TTR is also synthesised and secreted by choroid plexus and accounts for
0143-4004/$ e see front matter Crown Copyright Ó 2011 Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.placenta.2011.09.007
818
J. Patel et al. / Placenta 32 (2011) 817e822
about 25% of CSF protein [8] where it is the predominant T4 binding protein in cerebrospinal fluid (CSF) [9]. TTR may be involved in transfer of serum T4 to CSF and distribution of CSF T4 into brain. The retinal pigment epithelium also produces TTR which may be involved in TH delivery to the eye [10]. The purpose of the present study was to obtain a better understanding of the ontogeny of placental TTR expression and localisation in human pregnancy.
dilutions, as previously described [18]. Horseradish peroxidase-conjugated secondary antibodies (GE Healthcare, Buckinghamshire, UK) were used at 1:3000. Blots were developed using a Supersignal West Femto Kit (Pierce Biotechnology, Rockford, USA) following the manufacturer’s instructions and images captured by charge-coupled device camera (Fuji image LAS-3000; Fujifilm, Brookvale, Australia). Densitometric analysis was performed using Multigauge v2.3 software (Fuji, Fujifilm, Brookvale, Australia). TTR protein levels were normalised to b-actin. 2.4. Immunohistochemistry (IHC)
2. Materials and methods 2.1. Placental tissues Placental tissues from first and second trimester (6e17 wks) (Total n ¼ 44)e(6 wks (n ¼ 5); 7 wks (n ¼ 7); 8 wks (n ¼ 3); 9 wks (n ¼ 5); 10 wks (n ¼ 5); 11 wks (n ¼ 3); 12 wks (n ¼ 3); 13 wks (n ¼ 3); 14 wks (n ¼ 3); 15 wks (n ¼ 3); 16 wks (n ¼ 3) 17 wks (n ¼ 1)) terminated pregnancies were collected with informed consent soon after delivery. While individual patient information was not released the majority of terminations were for psychosocial reasons. Samples were dated by ultrasonographically measuring crown-rump length. Tissue was washed three times thoroughly in saline to remove any excess blood. Placental villi were then carefully removed. Unwanted and contaminating material such as decidual tissue was then dissected away from the placental villi and then carefully centrifuged at 130g for 5 min. Early placental tissue was centrifuged to for 5 min to recover villi that had a tendency to float in saline. Placental tissue from term (38e39 weeks gestation) normal healthy women undergoing planned caesarean sections at the Royal Brisbane and Women’s Hospital was collected with informed consent soon after delivery. Placental samples (w1 cm 1 cm cubes) were randomly selected from different areas of the placenta and combined. The placental chunks were then washed three times thoroughly in saline to remove any excess blood. Areas of placental tissue bordered by blood clots were discarded. Placental tissues were fixed in 4% paraformaldehyde (pH 7.3) for 10 min before processing to paraffin blocks. Remaining villous tissues were stored in RNA-later solution (Ambion, Austin, USA) at 20 C to be used for RNA and protein determination. Human Research Ethics Committees of The Royal Brisbane and Women’s Hospital and Queensland Institute of Medical Research approved this study. 2.2. Real time-PCR Total RNA was extracted from 30 mg of placental villi using the RNAeasy Mini Kit (Qiagen, California, USA) for each individual sample collected. 3 mg of total RNA was reverse transcribed to produce cDNA using the Superscript III Reverse Transcription Kit (Invitrogen, Mount Waverley, Australia) and P (dt) 15 primers (Roche Applied Sciences, Mannheim, Germany) in a reaction volume of 20 mL. RT-PCR was performed using 0.5 mM of forward and reverse primers with FastStart SYBR Green Master-mix per reaction (Roche Applied Sciences) in a Rotor Gene RG-3000 (Corbett Research, Mortlake, Australia). Preparing a standard curve using serially diluted cDNA validated the RT-PCR method. To quantify the mRNA expression profile in each sample, the efficiency of each standard curve was determined by its slope and comparative threshold according to the manufacturer’s instructions. For each sample, the amount of targeted mRNA (arbitrary units) was normalised to the housekeeping gene b-actin, which does not change significantly during placental development [11]. The primers used to amplify specific mRNAs are listed in Table 1. All PCR samples were run in triplicate. 2.3. Western blotting A homogenate was made from placental villi using a sucrose (250 mM)/HEPES (10 mM) pH 7.4 buffer and Protein Inhibitor Cocktail (Sigma, St Louis, USA). 30 mg of total protein was separated on 4e12% Novex NuPage Bis/Tris gels (Invitrogen, Mount Waverley, Australia) and transferred onto nitrocellulose membrane (BioRad TransBlot, Hercules, USA). Each blot included samples from a single gestational group (e. g. 6 weeks) and a lane that included 5 ng pure human TTR (Sigma, St Louis, USA) as a positive control. Rabbit anti-TTR (Dako Australia Pty. Ltd., Campbellfield, Australia), and mouse anti-b-actin (Sigma, St Louis, USA) antibody were used at 1:1000
Table 1 Primer sequences.a Gene
Primers
b-Actin
(Forward) 50 - CATGTACGTTGCTATCCAGGC -30 (Reverse) 50 - CTCCTTAATGTCSCGCACGAT -30 (Forward) 50 - ATGGCTTCTCATCGTCTGCT -30 (Reverse) 50 - TGTCATCAGCAGCCTTTCTG -30
TTR a
TTR, Transthyretin.
The presence of TTR and cytokeratin-7 (cyt-7), a trophoblast marker, was investigated by IHC in two individual samples across each gestational age group. Serial 3e4 mM sections were cut and affixed to adhesive Menzel Superfrost Plus slides (Braunschweig, Germany). Sections were dewaxed and rehydrated through xylol and a series of descending graded alcohols to Tris-buffered saline (TBS) (pH 7.4). Heat induced antigen retrieval was conducted for 20 min at 98 C using a decloaking chamber (Biocare Medical, Concord, USA) prior to immunohistochemistry. The sections were then incubated for 60 min at room temperature in either anti-human TTR (1:400 dilution) or mouse anti-human cyt-7 (1:100), both sourced from Dako, Glostrup, Denmark. Sections were then serially washed in TBS, before endogenous peroxidase activity was blocked with 1% TBS-H2O2 for 20 mins. HRP-conjugated anti-rabbit and anti-mouse secondary antibodies were applied for 30 min at room temperature. After washing in TBS, sections were then incubated with 3,30 -diaminobenzidine (DAB) (Sigma, St Louis, USA) for 5 min and then washed again gently under running tap water to removed excess chromogen. Sections were lightly counterstained in Mayers’ haematoxylin and then dehydrated through ascending graded alcohols, cleared in xylene, and mounted using DePeX medium (xylene base) (Thermo Scientific, Rockford, USA). Negative controls were incubated with the appropriate IgG fractions as isotype controls. 2.5. Microscopy IHC images were captured using the 40X objective on an Olympus BX-41 microscope with Olympus DP70 camera (Olympus, Tokyo, Japan). IHC images were examined for evidence of TTR and cyt-7. 2.6. Statistics Graph Pad Prism version v 5.04 (GraphPad Software La Jolla, CA USA) was used for statistical analysis. Single factor analysis of variance (ANOVA) was used to evaluate differences between mean values over gestational age. Differences were further evaluated using a post hoc test (Bonferroni). Pearson product moment correlation coefficients (r) were also calculated to examine relationships between gestational age and mRNA and protein expression. It is used to estimate the proportion of the variability in a data set and measure the correlation between two variables.
3. Results 3.1. TTR mRNA in placental tissue RT-PCR demonstrated detectable TTR mRNA in all samples from 6 weeks gestation on (Fig. 1A). Equality of means was excluded by ANOVA (F ¼ 15.34, p < 0.001). Increases in mRNA expression between weeks 6e10 (p < 0.01); 6e13 (p < 0.001) and 6e38 (p < 0.001) was observed. Mean TTR mRNA levels were highly correlated with gestational age between 6 and 13 weeks (r ¼ 0.974, p < 0.0001). No significant change was however observed in TTR mRNA levels between weeks 13e17. Levels at term were similar to those at 13e17 weeks (Fig. 1C). 3.2. TTR protein in placental tissue Western blotting was used to measure TTR in placental villi samples (Fig. 2A). Levels were detectable from 6 weeks on. There was a significant difference in mean mRNA levels with time (F ¼ 9.64, p < 0.01). Using Bonferroni’s test levels at weeks 6e10 (p < 0.05); 6e13 (p < 0.01) and 6e38 (p < 0.01) were different. As with TTR mRNA expression TTR protein levels between 6 and 13 weeks were strongly correlated with time (r ¼ 0.901; p < 0.001, Fig. 2B). Levels at 13e17 weeks and term (Fig. 2C) were not different. We have demonstrated excellent correlation between TTR
J. Patel et al. / Placenta 32 (2011) 817e822
819
Fig. 1. Transthyretin (TTR) mRNA was measured in placental villi samples from first trimester (6e17 wks; n ¼ 44) and term (38e39 wks; n ¼ 5) pregnancies. (A) A dot plot representing the mRNA expression of TTR through gestation. (B) Significant and linear increases (r ¼ 0.974; p < 0.0001) were observed from weeks 6e13. (C) Conversely, between weeks 13e17 and placenta from term, TTR mRNA levels remained constant. Each dot point on the figure represents an average of the means conducted in triplicate for each individual placental sample.
mRNA and TTR protein between individual samples collected (r ¼ 0.916; p < 0.0001). 3.3. IHC analysis Images from sections stained for TTR and the trophoblast marker cytokeratin-7 (cyt-7) were captured to demonstrate absence or presence of TTR protein staining within placental villi (Fig. 3). There was constant strong positive staining for cyt-7 in placental trophoblast cells at all gestational ages. At 6 weeks gestation TTR was undetectable using IHC methods but appeared to increase from 8 weeks to 14 weeks, remaining constant thereafter. 4. Discussion Thyroid hormones, especially T4, are critical for normal fetal brain development [12]. Before fetal T4 secretion begins at around the 16th week of gestation the fetus is dependent on transplacental delivery of maternal TH. A number of cell membrane TH transporters have been identified in placenta, including monocarboxylate transporters 8 and 10 (MCT8, MCT10), L-amino acid transporter 1 and 2 (LAT 1, LAT 2) and organic anion transporting polypeptide 1A2 and 4A1 (OATP1A2, OATP4A1). These are almost certainly involved in materno-fetal TH transport (for a review see [13]). We have recently reported that the term placenta actively produces and secretes TTR, a TH binding protein (THBP) [4]. Placental TTR is secreted predominantly via the apical cell membrane. TTR can also be taken up by trophoblasts [5], raising the
possibility that placental TTR acts as a shuttle system to move maternal T4 and perhaps retinol into the placenta. This could be by delivery of T4 to the membrane transporters, transmembrane carriage of T4 or both. TTR entry into cells has also been described in kidney and choroid plexus. In 1986, Soprano and colleagues described the synthesis of TTR by rat visceral yolk sac and postulated that it may play a role in retinol transfer to the fetus [14]. Likewise, TTR synthesised by choroid plexus has been shown to play a role in transfer of T4 into rat brain [15]. TTR can also be taken up by human kidney [16] and uptake is increased in the presence of T4. Our aim therefore was to investigate the ontogeny of TTR, particularly during the critical early stages of pregnancy, to further our understanding of the role that TTR may play in transplacental T4 delivery. We have demonstrated highly significant time dependent linear increases in TTR mRNA and protein levels in early pregnancy (weeks 6e13). However, from week 13e17 of gestation TTR mRNA and protein levels remained constant and were not different from levels at term. This same trend was observed in TTR immunohistochemical studies, which also demonstrated strong localisation of TTR to cytotrophoblasts and syncytiotrophoblasts. During the first trimester of pregnancy the placenta is relatively hypoxic with low oxygen levels that rise to reach an average of about 2.5% at 8 weeks gestation. With establishment of the spiral arterioles oxygen levels rise, further to an average of about 8.5% at 12 weeks gestation, at which levels persist until delivery [17,18]. We recently reported that oxygen regulates expression and production of TTR in cultured JEG-3 human choriocarcinoma cells [19]. JEG-3
820
J. Patel et al. / Placenta 32 (2011) 817e822
Fig. 2. Transthyretin (TTR) protein was measured in placental villi samples from first trimester (6e17 wks; n ¼ 44) and term (38e39 wks; n ¼ 5) pregnancies. (A) A dot plot representing the protein expression of TTR through gestation measured by Western blot. (B) Significant and linear increases (r ¼ 0.901; p < 0.001) were observed between weeks 6e13. (C) Conversely, between weeks 13e17 and placenta from term, TTR protein level remained constant. Each dot point on the figure represents an average of the means conducted in triplicate for each individual placental sample. Strong correlation between TTR mRNA vs TTR protein was also observed between individual placental samples (r ¼ 0.916; p < 0.0001).
cells cultured at 1% oxygen produce higher levels of TTR mRNA and protein than cells cultured at 8% oxygen. We hypothesised that expression of TTR within the human placenta would be relatively high early in the first trimester of pregnancy when placental oxygen levels are low (up to 2.5%) and then progressively fall until 12 weeks gestation as placental bed oxygen concentrations rise to about 8.5%. and persist at that level throughout pregnancy. We found the contrary and this perhaps somewhat surprising result probably reflects the complexity of cell types and interactions in the functioning human placenta, with a potentially large number of TTR gene regulating factors, in contrast to the rigid controlled conditions applied to cell lines during laboratory culture. Mapping of the mouse TTR promoter region from the liver has demonstrated a number of regulatory protein binding sites that differentially affect TTR transcription. Therefore, analysis into the TTR promoter region within the human placenta warrants attention to determine other regulatory factors (apart from hypoxia demonstrated in vitro) that may well be affecting TTR expression throughout gestation. There is little information about TTR levels in fetal serum. Fryer and colleagues studied levels of several proteins in the plasma of normal human fetuses from 13 to 41 weeks gestation [20]. While levels of most serum proteins such as albumin, ceruloplasmin and transferrin rose with increasing gestation mean plasma TTR levels were highest at 13e16 weeks and then fell as pregnancy progressed [20]. The fetus appears to produce TTR as early as 8 weeks gestation in pancreas and gastrointestinal tract but TTR was not detected immunohistochemically in early or late fetal liver [21]. A later study
demonstrated only weakly immunoreactive TTR in the liver of an 8 week fetus and weak liver immunoreactivity in 3 of 5 mid-term fetuses [22]. In situ hybridisation was also used to localise TTR mRNA in that study. Strong choroid plexus labelling was demonstrated at 8 weeks but again only weak labelling in liver at 8 and again at 20 weeks. A study by Greenberg and colleagues in 1970 [23] demonstrated that, during early pregnancy, T4 in fetal serum is predominantly bound to TTR. As the fetus matures TTR binding decreases as TBG binding of T4 increases. By the 20th week of gestation, fetal TBG bound around 78% of 125I-T4, a level that is similar to binding in adult serum. Whether the decrease in TTR binding of T4 reflects a change in fetal serum TTR concentration or a change in binding affinity is undetermined. Maternal plasma TTR levels do not appear to change throughout pregnancy although urinary TTR is reported to be a thousand times higher in the urine of pregnant compared with non pregnant individuals (45 65 mg/g creatinine versus 46 24 ng/g creatinine) [24,25]. These results suggest that the high plasma TTR levels of 13e16 week fetuses and perhaps the high urine TTR of pregnant women may be of placental origin. Previous reports from our laboratory have shown that trophoblastic TTR is secreted via apical (maternal) and basal (fetal) surfaces and that TTR is actively taken up by trophoblasts [5]. TTR binds T4, which facilitates formation of tetrameric TTR and enhances trophoblast TTR uptake. TTR cross-linked with T4 is also actively taken up by trophoblasts [5]. Thus TTR may facilitate transfer of T4 across the placenta. Whether this is by carriage of T4
J. Patel et al. / Placenta 32 (2011) 817e822
821
by TTR, delivery of T4 by TTR to membrane thyroid hormone transporters or a combination of the two is as yet unclear. 5. Conclusion It is now clear that TTR is expressed in the human placenta as early as 6 weeks and throughout gestation. The role of placental TTR remains speculative although it is quite likely that TTR either presents T4 to membrane TH transporters carries maternal T4 into the fetal circulation or both. Acknowledgements This study was supported by the Division of Chemical Pathology, Pathology Queensland, Department of Endocrinology, Royal Brisbane and Women’s Hospital and the Royal Brisbane and Women’s Hospital Research Foundation. We thank staff who recruited women who kindly donated their placentas for our study. References
Fig. 3. Immunohistochemical (IHC) images demonstrating staining for transthyretin (TTR) and cytokeratin-7 (cyt-7). IHC staining was conducted on individual samples to confirm the absence or presence of protein. TTR staining demonstrates localisation of TTR protein within the trophoblast lining of the placental villi, with increasing intensity of staining from weeks 6 gestation. IHC staining matched TTR mRNA and protein expression with increasing TTR intensity till week 14 in gestation. Thereafter the level of TTR staining intensity remained similar. Images were taken at 40X magnification. Scale bar 20 mm.
[1] Thorpe-Beeston JG, Nicolaides KH, Felton CV, Butler J, McGregor AM. Maturation of the secretion of thyroid hormone and thyroid-stimulating hormone in the fetus. N Engl J Med 1991;324(8):532e6. [2] Morreale de Escobar G. Maternal hypothyroxinemia versus hypothyroidism and potential neurodevelopmental. Alterations of her offspring. Ann Endocrinol (Paris) 2003;64(1):51e2. [3] Patel J, Landers K, Li H, Mortimer RH, Richard K. Thyroid hormones and fetal neurological development. J Endocrinol 2011;209(1):1e8. [4] McKinnon B, Li H, Richard K, Mortimer R. Synthesis of thyroid hormone binding proteins transthyretin and albumin by human trophoblast. J Clin Endocrinol Metab 2005;90(12):6714e20. [5] Landers KA, McKinnon BD, Li H, Subramaniam VN, Mortimer RH, Richard K. Carrier-mediated thyroid hormone transport into placenta by placental transthyretin. J Clin Endocrinol Metab 2009;94(7):2610e6. [6] van Jaarsveld PP, Edelhoch H, Goodman DS, Robbins J. The interaction of human plasma retinol-binding protein and prealbumin. J Biol Chem 1973; 248(13):4698e705. [7] Hagen GA, Elliott WJ. Transport of thyroid hormones in serum and cerebrospinal fluid. J Clin Endocrinol Metab 1973;37(3):415e22. [8] Aldred AR, Brack CM, Schreiber G. The cerebral expression of plasma protein genes in different species. Comp Biochem Physiol B Biochem Mol Biol 1995; 111(1):1e15. [9] Dickson PW, Aldred AR, Marley PD, Tu GF, Howlett GJ, Schreiber G. High prealbumin and transferrin mRNA levels in the choroid plexus of rat brain. Biochem Biophys Res Commun 1985;127(3):890e5. [10] Cavallaro T, Martone RL, Dwork AJ, Schon EA, Herbert J. The retinal pigment epithelium is the unique site of transthyretin synthesis in the rat eye. Invest Ophthalmol Vis Sci 1990;31(3):497e501. [11] Lacey HA, Nolan T, Greenwood SL, Glazier JD, Sibley CP. Gestational profile of Naþ/Hþ exchanger and Cl-/HCO3- anion exchanger mRNA expression in placenta using real-time QPCR. Placenta 2005;26(1):93e8. [12] Glinoer D, Delange F. The potential repercussions of maternal, fetal, and neonatal hypothyroxinemia on the progeny. Thyroid 2000;10(10):871e87. [13] Patel J, Landers K, Li H, Mortimer RH and Richard K. Delivery of maternal thyroid hormones to the fetus. Trends Endocrinol Metab 22(5):164e170. [14] Soprano DR, Goodman DS. Retinol-binding protein and transthyretin mRNA levels in visceral yolk sac and liver during fetal development in the rat. Proc Natl Acad Sci (USA) 1986;83(19):7330e4. [15] Schreiber G, Aldred AR, Jaworowski A, Nilsson C, Achen MG, Segal MB. Thyroxine transport from blood to brain via transthyretin synthesis in choroid plexus. Am J Physiol 1990;258(2 Pt 2):R338e45. [16] Sousa MM, Norden AG, Jacobsen C, Willnow TE, Christensen EI, Thakker RV, et al. Evidence for the role of megalin in renal uptake of transthyretin. J Biol Chem 2000;275(49):38176e81. [17] Huppertz B, Peeters LL. Vascular biology in implantation and placentation. Angiogenesis 2005;8(2):157e67. [18] Schneider H. Oxygenation of the placental-fetal unit in humans. Respir Physiol Neurobiol 2011;178(1):51e8. [19] Patel J, Landers K, Li H, Mortimer RH, Richard K. Oxygen concentration regulates expression and uptake of transthyretin, a thyroxine binding protein, in JEG-3 choriocarcinoma cells. Placenta 2011;32(2):128e33. [20] Fryer AA, Jones P, Strange R, Hume R, Bell JE. Plasma protein levels in normal human fetuses: 13 to 41 weeks’ gestation. Br J Obstet Gynaecol 1993;100(9): 850e5. [21] Gray HD, Gray ES, Horne CH. Sites of prealbumin production in the human fetus using the indirect immunoperoxidase technique. Virchows Arch A Pathol Anat Histopathol 1985;406(4):463e73.
822
J. Patel et al. / Placenta 32 (2011) 817e822
[22] Jacobsson B. Localization of transthyretin-mRNA and of immunoreactive transthyretin in the human fetus. Virchows Arch A Pathol Anat Histopathol 1989;415(3):259e63. [23] Greenberg AH, Czernichow P, Reba RC, Tyson J, Blizzard RM. Observations on the maturation of thyroid function in early fetal life. J Clin Invest 1970;49(10):1790e803.
[24] Schweigert FJ, Wirth K, Raila J. Characterization of the microheterogeneity of transthyretin in plasma and urine using SELDI-TOF-MS immunoassay. Proteome Sci 2004;2(1):5. [25] Giacoia GP. Concentration of serum prealbumin and retinol-binding proteins during pregnancy. South Med J 1984;77(10):1261e3.