Operation performance and granule characterization of upflow anaerobic sludge blanket (UASB) reactor treating wastewater with starch as the sole carbon source

Accepted Manuscript Operation performance and granule characterization of upflow anaerobic sludge blanket (UASB) reactor treating wastewater with starch as the sole carbon source Xueqin Lu, Guangyin Zhen, Adriana Ledezma Estrada, Mo Chen, Jialing Nic, Toshimasa Hojo, Kengo Kubota, Yu-You Li PII: DOI: Reference:

S0960-8524(15)00021-8 http://dx.doi.org/10.1016/j.biortech.2015.01.010 BITE 14442

To appear in:

Bioresource Technology

Received Date: Revised Date: Accepted Date:

24 November 2014 31 December 2014 3 January 2015

Please cite this article as: Lu, X., Zhen, G., Estrada, A.L., Chen, M., Nic, J., Hojo, T., Kubota, K., Li, Y-Y., Operation performance and granule characterization of upflow anaerobic sludge blanket (UASB) reactor treating wastewater with starch as the sole carbon source, Bioresource Technology (2015), doi: http://dx.doi.org/10.1016/j.biortech. 2015.01.010

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Operation performance and granule characterization of upflow anaerobic sludge blanket (UASB) reactor treating wastewater with starch as the sole carbon source Xueqin Lua, Guangyin Zhenb, Adriana Ledezma Estradaa, Mo Chenc, Jialing Ni ,Toshimasa Hojoa, Kengo Kubotaa, Yu-You Lia*

a. Department of Civil and Environmental Engineering, Graduate School of Engineering, Tohoku University, Sendai, Miyagi 980-8579, Japan b. National Institute for Environmental Studies, Onogawa 16-2, Tsukuba, Ibaraki 305-0053, Japan c. Graduate School of Environmental Studies, Tohoku University, Sendai, Miyagi 980-8579, Japan

*Corresponding author: Yu-You Li Department of Civil and Environmental Engineering, Graduate School of Engineering, Tohoku University, Japan E-mail addresses: [email protected]; [email protected]; [email protected].

10

Abstract Long-term performance of a lab-scale UASB reactor treating starch wastewater was investigated under different hydraulic retention times (HRT). Successful start-up could be achieved after 15 days’ operation. The optimal HRT was 6 h with organic loading rate (OLR) 4 g COD/L•d at COD concentration 1000 mg/L, attaining 81.1– 98.7% total COD removal with methane production rate of 0.33 L CH4/g CODremoved. Specific methane activity tests demonstrated that methane formation via H2-CO2 and acetate were the principal degradation pathways. Vertical characterizations revealed that main reactions including starch hydrolysis, acidification and methanogenesis occurred at the lower part of reactor (“main reaction zone”); comparatively, at the up converting acetate into methane predominated (“substrate-shortage zone”). Further reducing HRT to 3 h caused volatile fatty acids accumulation, sludge floating and performance deterioration. Sludge floating was ascribed to the excess polysaccharides in extracellular polymeric substances (EPS). More efforts are required to overcome sludge floating-related issues.

Keywords: Upflow anaerobic sludge blanket (UASB); Starch; Granular sludge; Methane; Extracellular polymeric substances (EPS)

11

1. Introduction Starch, composed of repeating D-glucopyranosyl units, are largely used in human and animal nutrition, or as virgin materials for a wide range of industrial products (Avancini et al., 2007). The increased adopts of starch inevitably lead to the production of massive starch wastewater. One such type of wastewater, with COD 25 g/L and low pH 3.8–5.2, for instance, was collected from about 250 existing small-scale plants by the starch extraction process which was discharged to water bodies without any treatment (Annachhatre and Amatya, 2000; Colin et al., 2007). A typical sour starch plant in Colombia generated 12 × 103 L/d starch wastewater having approximately 100 g/L of COD (Colin et al., 2007). Likewise, in Thailand, the pond system received roughly 4500 m3/d starch wastewater with COD 13941 ± 359 mg/L and pH 4.2 ± 0.4 (Rajbhandari and Annachhatre, 2004). Discharge of starch wastewater with strong acidity as well as high organic content and suspended solids into the river may affect aquatic organisms, compromise fish breeding areas (Parthiban et al., 2007; Rajbhandari and Annachhatre, 2004) and even threaten some species with extinction. To deal with the wastewater related environmental issues, during the last few years many techniques, e.g. physical & chemical methods, aerobic & anaerobic digestion, etc. have been developed (Jing et al., 2013; Rizvi et al., 2013; Sekiguchi et al., 2001). Among the multifarious alternatives, the UASB reactor is by far one of the most widely adopted anaerobic options for treatment of various wastewaters (Harada et al., 1993), such as cheese whey (Carrillo-Reyes et al., 2014), potato-juice (Fang et al., 2011) acrylic fiber, palm oil mill effluent (Ahmad et al., 2011), etc. due to its high efficiency, flexibility, energy generation in the form of biogas and low sludge production (Hinken et al., 2014). It is reported that there 12

are over 1000 UASB reactors installed worldwide to treat different kinds of wastewaters (Chong et al., 2012). Recently, interest in utilizing UASB reactor for the treatment of starch wastewater has grown (Annachhatre and Amatya, 2000; Hinken et al., 2014). As an example, in Shandong Province, China, a wheat starch processing factory operates a UASB reactor in combination with two-stage aerobic processing (anoxia–biological contact oxidation process) to treat wastewater with COD concentration between 9.6 and 12.5 kg/m3·d, which produces 1500–1900 m3 CH4/d (Tan et al., 2014). Another study by Kobayashi et al. (2011) undertook the co-treatment of starch and methanolic wastewater in a UASB reactor. In spite of the unremitting efforts dedicated previously, however, the reports once again, are mostly limited to the integration of UASB with other techniques, or the co-fermentation of starch with other organics to reinforce the biodegradation of starch. Very rare work on the feasibility of using UASB alone in wastewater treatment with starch as the sole substrate has been carried out (Hinken et al., 2014). Starch wastewater, which is characterized by low pH and high sugar content, in case of overloading, may cause an acidification of the digester, and even the termination of methane production (Kryvoruchko et al., 2009). The limited knowledge achieved until now yet cannot definitely answer whether UASB proceeds smoothly during the long-term operation provided starch is added solely. Further investigation in assessing the continuous stability of starch-fed UASB is still urgently required in lab-scale experiments to push forward its industrial application. Moreover, most previous research relation to UASB has mainly focused on the optimization of operational parameters, particularly HRT. There are very few studies available in literature considering the vertical variations of key process

13

parameters in UASB reactor during wastewater treatment, consequently limiting our understanding into the underlying principles. Therefore, in this study, a lab-scale UASB reactor has been constructed and operated for more than 200 days to comprehensively evaluate the long-term performance of UASB in treating starch wastewater. The effects of OLR on the overall stability were examined by varying HRT (from 24 to 3 h) to optimize the operating condition. In order to elucidate the responsible pathway for starch biodegradation, the specific methanogenic activity (SMA) of granules by feeding seven substrates (i.e. starch, glucose, acetate, propionate, butyrate, formate and H2-CO2) were also determined. Besides, the possible changes of water qualities (i.e. pH, ORP, COD, acetate, etc.) and granule characteristics (i.e. morphological and microbial structure, EPS distribution, settling velocity, etc.) along the height were detected, hoping to map the core degradation dynamics occurred in the interior of UASB. This study would help to enhance our insights into the principle mechanisms of this technique in starch wastewater treatment and provide preliminary basis and theoretical guidance for its practical application.

2. Materials and Methods 2.1 Source of seed sludge Digested sludge was sourced from a methophilic anaerobic digester (35 ± 1 ◦C) of a municipal wastewater treatment plant (WWTP) in Sendai, Japan. Anaerobic granular sludge was withdrawn from sludge treatment plant effluent mixture of ethanol and sugar factory waste water in Tokyo, Japan. The initial granular sludge, consisting of well-settled black granules with about 80% showing the size from 0.4 to 4.0 mm in diameter and 0.02 to 0.03 14

m/s of the sedimentation velocity, had a mixed liquor volatile suspended solid (MLVSS) concentration of 28.5 g/L and mixed liquor suspended solids (MLSS) concentration of 35.0 g/L. 2.2 Experimental set-up and its operation The schematic diagram of the UASB reactor is depicted in (Fig. 1S in Supplementary Information). The set-up designed herein consists of a starch wastewater feed tank, a temperature control unit, UASB main body, a wet gas flow meter and a desulfidation unit. The main body included two parts: a rectangular column and a gas–liquid-solid separator. It had an effective working volume of 6 L with an internal diameter of 10 cm and a reacting zone height of 80 cm and the sludge added as inoculum occupied 2/3 of the working volume of reactor. The gas-liquid-solids separator (GLS) was installed at the top of the reactor. The temperature in the reactor was controlled with water recirculation using a heated water bath. The operational temperature was kept constant at 35 ± 1 ◦C. The gas collection tube was connected at the 80 cm height of the column and the evolved gas passed through a glass bottle with 2 L volume containing desulfurizer to capture H2S. Then, a wet gas meter (SHINAGAWA W-NK-0.5) following the desulfurizer bottle was employed to monitor the daily biogas volume. The biogas produced was then calculated as the value at the standard state (T= 273.15 K, P = 101.3 kPa) according to equation of ideal. This reactor was inoculated on Feb. 22, 2014, with 1 L digested sludge and 3 L granular sludge. The upflow velocity of UASB was about 0.02 m/h. The OLR was set at 1.0 g COD/L·d with a HRT of 24 h under start-up condition, until more than 90% of total COD (TCOD) and 80% of soluble COD (SCOD) were removed after 15 days operation. 15

2.3 Wastewater composition According to the actual compositions of the starch wastewater, the synthetic wastewater used as influent in the continuous experiments was composed of 1000 mg/L COD from starch with the fixed COD/sulfate ratio of 20, and sulfate was added into wastewater in the form of Na2SO4. The dosage of NaHCO3 was controlled at 2000 to 2700 mg/L except at the start-up HRT of 24 h with dosage of 1500 mg/L. Compositions of the buffer and trace elements used were as follows (in mg/L): 850 NH4Cl, 750 KCl, 250 K2HPO4, 100 KH2PO4, 125 MgCl2·6H2O, 4.2 NiCl2·6H2O, 4.2 CoCl2·6H2O, 15 CaCl2·2H2O and 42 FeCl·4H2O. 2.4 Methane producing activity The specific methanogenic activities (SMAs) of granular sludge sampled from UASB reactor were determined via the serum bottle tests using starch, glucose, acetate, propionate, butyrate, formate, and H2-CO2 as substrates, respectively. After inoculated with 2 g wet sludge, the serum bottle with H2-CO2 as substrate was filled with 40 mL nutrient solution while 80 mL for the left. Nutrient solution used herein had the same buffer as the synthetic wastewater but different substrates. The buffer, prior to use, was boiled for 2 h to remove any dissolved oxygen present. The initial COD concentration for the vials added with starch, acetate, propionate, butyrate, glucose, formate and methanol was all 1000 mg/L. After sealed with rubber stoppers secured by aluminum crimp, the serum bottles were flushed with nitrogen gas to remove oxygen in headspace. But for H2-CO2, the headspace of the bottle was replaced with pressurized gas of H2-CO2 (80: 20, v/v) to get a final pressure of 1.4 atm. Afterwards, 1 mL Na2S·9H2O (250 mg/L as a final concentration in the vial), used as the reducing agent, was injected into each bottle to obtain an absolutely anaerobic condition. 16

Then, all bottles were placed and incubated in a water bath (100 ± 1 rpm) at 35 ± 1◦C. Biogas production and compositons were measured at 2-h intervals, and expressed as the value at the standard state. Besides, to further understand the variation of sludge SMAs along with UASB height, the granular samples collected from different heights (i.e. 95, 44 and 4 cm, hereinafter referred as to “up”, “middle” and “bottom”, respectively) were studied with starch and acetate as substrates, respectively. The experimental precedure was the same as described above. 2.5 EEM fluorescence spectroscopy Excitation-emission matrix (EEM) fluorescence spectra analysis was carried out by using a spectrofluorophotometer (RF-5300PC, Shimadze Corporation, Japan). The EEM spectra were recorded with the emission (Em) wavelength scanning from 220 to 550 nm at 1 nm increments by fixing the excitation (Ex) wavelength at 230, 280 and 320 nm, respectively. 2.6 Other analysis methods The pH and oxidation-reduction potential (ORP) of influent and effluent were measured with a pH meter (TOA, HM-30R) and an ORP meter (TOA, RM-30P), respectively. TCOD and SCOD (0.45 µm) were analyzed by the semi-automated colorimetric method at 600 nm with a SR 5000 UV-vis spectrophotometer (HACH Co, USA) (APHA, 1998). Volatile fatty acids (VFAs) were determined with an Agilent 6890 gas chromatography equipped with a flame ionization detector (FID) using helium as carrier gas. The composition of biogas (CH4 and CO2) was analyzed by a gas chromatograph (SHIMADZU GC-8A) equipped with a thermal conductivity detector (SHINAGAWA W-NK-0.5) and an 2 m stainless steel column packed with Porapak Q. Sulfate was analyzed by ion chromatography (DIONEX, DX-120). 17

Hydrogen sulfide (H2S) was determined by hydrogen sulfide detecting tubes (Gastec, No. 4H). Theoretical biogas production based on OLR was calculated by Eq. (1).

rtheoretical =

୕×େ୓ୈ౨౛ౣ౥౬౛ౚ ×଴.ଷହ େୌర (%)×୚

(1)

where r = theoretical biogas production rate, L/L/d; Q = flow rate, L/d; CODremoved = CODInfluent-CODEffluent, g/L; CH4 (%) = methane content, %; V = effective working volume, L; 0.35 = conversion factor between COD and CH4 (L CH4/g COD). Extracellular polymeric substances (EPS) extraction protocol in this article was mainly based on the research of Zhen et al. (2013). Proteins (PN) were determined by the Lowry procedure; protein polysaccharides (PS) were stained with the phenol-sulfuric acid method using glucose as the standard. Morphology and microstructure of granules were characterized by using scanning electron microscopy (SEM) (JSM-6500F, Japan Electron Optics Laboratory Co., Japan). To identify the domain microbial populations involved in starch biodegradation, fluorescence in situ hybridization (FISH) was conducted. The detailed analytical procedures of FISH are presented in Supplementary Information.

3. Results and discussion 3.1 Long-term performance of UASB reactor under different HRTs The continuous experiments were operated for a period of around 210 days and experienced a setback and recovery phase. The hydraulic retention times (HRT) were curtailed stepwise from 24 to 3 h with COD loading rate increased from 1.0 up to 8.0 g COD /L·d. Fig. 1 show the process performance of UASB reactor in terms of pH, ORP, COD removal, VFAs, biogas production rate and biogas composition over the experimental time.

18

The pH and ORP are critical parameters influencing the survival and growth of obligate anaerobes, especially methanogens. According to the literature, the optimum pH for methane producing archara (MPA) is between 6.5 and 8.0; the ideal ORP for methanogenesis is lower than –330 mV. Despite the slight fluctuation of influent pH and ORP from Fig. 1a-b, the overall performance of UASB reactor was not affected. The pH of effluent maintained 6.5– 7.5 during the stable operation time (Fig. 1a), falling in the optimum range for methanogenesis by the alkalinity (2000 mg CaCO3/L) present in the influent; the effluent ORP were also kept on a platform –300 mV (Fig. 1b). The ideal pH and ORP levels herein created a more advantageous circumstance for microorganisms, thus motivating the anaerobic process. As a result of this, the stable performance was achieved after only 15 days of operation. TCOD and SCOD removal increased gradually from 54.3% to 98.7%, 44.3% to 97.0%, respectively at first 15 days (Fig. 1c). The content of CH4 also increased stepwise from 14.4% to 70.3%, then maintained in the range of 70.3–84.3%. Moreover, no sign of VFAs in the effluent was detected at any moment during the first 120 days of operation (Fig. 1d), meaning that the granular-sludge activity was sufficient to metabolize VFAs , clearly confirming the promising performance in starch wastewater treatment. When HRT was further shortened with OLR improving, COD removal efficiency and CH4 content decreased slightly. Especially when HRT decreased to 3 h with OLR of 8 g COD /L·d, UASB started to show symptoms of failure, i.e. sharp pH drop (< 6.7) (Fig. 1a) and clear accumulation of VFAs (> 300 mg/L) (Fig. 1d), which subsequently caused the UASB performance to worsen. In this regard, effluent TCOD and SCOD increased from 88.8 to 616.6 mg/L and 62.2 to 603.1 mg/L, respectively, with the corresponding removal efficiency dropping from 91.5% to 19

35.8% and 73.4% to 28.7%. CH4 content was also as low as 37.2% in a nose dive. Similar phenomenon has been documented previously by Wang et al. (2009), who observed the VFAs accumulation when shortening HRT, resulting in a dramatic drop in biogas production. So in order to solve the above problems, the feeding of UASB was halted from day 116 to day 118 until VFAs decreased into < 60 mg/L, pH rose to around 7.0, CH4 content restored to 64% and CH4 production rate rose into 0.52 L/L·d level to prevent process breakdown. After that the feeding was resumed whilst HRT was progressively increased into 6 h for 1 day, and then HRT 24 h for 30 days to restore the UASB performance. From the experimental data obtained here, it is clear that HRT 3 h, i.e. OLR of 8 g COD/L·d, was too high for this kind of starch wastewater. In literature, the normal operation range of UASB with 1.2 L working volume has been reported to be 2.5–3.2 g COD/L·d (Fang et al., 2011), while a range of approximately 1.4–16.0 g COD/L·d has been also regarded as the normal operation range for UASB reactor to secure a stable process (Annachhatre and Amatya, 2000; Jing et al., 2013). Previous investigations are different with this result, possibly due to the difference in the types of substrates applied. For this study, keeping OLR of 1.0–6.0 g COD/L·d (i.e. HRT 24–4 h) were necessarily required for the successful operation of UASB. The main factor that affected the reactor performance in our study might be attributed to the complex structure of starch fed as substrate. Starch is a polysaccharide composed of units that are related to α-D-glucose. It when mixing with (warm) water gives wheat-paste, which is gelatinous and sticky, and of ease to bind to the surface of granules. Hence, as expected, feeding starch in excessively high OLR made sludge particles stick together, which lowered the mass transfer rate and adversely impaired the specific 20

methanogenesis activity of granules, finally deteriorating the performance of UASB in terms of COD removal and biogas production. Based on this reason, the applicable OLR for treating low strength starch wastewater in this case should be limited to less than 8.0 g COD/L·d (i.e. HRT over 3 h). 3.2 Biogas production and composition The effect of HRTs on biogas production rate was displayed in Fig. 1e and f. The composition of biogas, i.e. CH4, H2S and CO2 were measured as well (Fig. 1f). Under the all operating conditions, methane was always the main component in biogas, keeping mostly in the range of 65–75% except during upset periods; whereas H2S was not a significant variant (< 0.3%) due to the high ratio of COD/SO42– (about 20 in this case). The ratio COD/SO42– is one of the most critical factors influencing the competition between methane producing archara (MPA) and sulfate reducing bacteria (SRB) (Guerrero-Barajas et al., 2014). At high COD/SO42–, the growth of the SRB was the sulfate limited, and thus this enabled the MPA to outcompete the SRB. For biogas production, on average production rate after the start-up period at HRT 24 h (i.e. OLR 1.0 g COD/L·d) was found to be merely 0.21 ± 0.05 L/L·d. When HRT was shorten in a stepped manner to 4 h (OLR 6.0 g COD/L·d) over a period of 110 days, biogas production rate increased gradually reaching a maximum of 3.95 L/L·d. At later period HRT of 3 h, attributable to the acidification, the methanogenesis in UASB was suppressed greatly, resulting in a decline in biogas production rate from 3.95 L/L·d sharply to 0.51 L/L·d, indicating the severe overload of OLR. From day 120 onwards, with the HRT was resumed to 24, 12 and 6 h to prevent the performance worsening (i.e. recovery phase), the biogas production rate now began to recover and finally stabilized in the range of 0.29– 21

0.35, 0.31–0.58 and 0.43–0.69 L/L·d, respectively. Unfortunately, the biogas production rate obtained at this time was still much lower than that of the normal stage, suggesting that longer period of time would be needed for its complete restoration. In order to further assess the overall stability, the theoretical biogas production based on OLR was calculated by Eq. (1) and then compared with the measured values. As shown in Fig. 1e, the real biogas production rate fluctuation trends were mostly coincided with the theoretical values. Of course, the increased space between the theoretical and actual values was also noticed especially during the period of upsets and recovering, attributed to the production of a large amount of foam which blocked up GLS separator, resulted in the escape of biogas from the outlet, and subsequently attenuated the collection efficiency of biogas (see Fig. 2S in Supplementary Information). Despite the several problems arising at HRT below 3 h, based on the experimental data from the steady-state condition we still can conclude that the UASB can be capable of treating low-strength starch wastewater. In addition, according to the above obtained biogas production and composition, the amount of methane produced per gram COD removed at different HRTs were also obtained (see Fig. 3S in Supplementary Information). There was a considerable change in CH4 yield, the highest value of 0.33 L CH4/g CODremoved was noticed at HRT of 6 h during the normal phase, highly comparable with the theoretical value of 0.35 L CH4/g CODremoved; the lowest value was found at HRT of 3 h, around 0.26 L CH4/g CODremoved, meaning that HRT of 6 h is the optimal. The methane yield in this work is obviously higher than 0.15 L CH4/g CODremoved reported by Sun et al. (2012), during the treatment of cassava starch wastewater in an up-flow multistage anaerobic reactor (UMAR). In addition, a recent study by Jing et al. (2013) similarly concluded the 22

same HRT of 6 h was the best for UASB to treat the synthetic wastewater UASB, but COD recovery in the form of CH4 in their work was relatively low, around 0.23 L CH4/g CODremoved. Fig. 1. 3.3 COD mass balance Table 1 displays the mass balance of COD for every HRT phase. The amount of COD that outflows the reactor consists of six parts: (1) recovered CH4-COD in gas phase (CODCH4 gas);

(2) dissolved CH4-COD in the effluent (CODCH4 aq), (3) recovered H2S-COD in gas phase

(CODH2S gas), which was calculated by multiplying the moles of sulfide produced by 64 (g COD/mol); (4) COD used for sulfate reduction (COD△SO4); (5) COD of suspended solids (SS) in the effluent (CODeff-SS) and (6) soluble COD in the effluent (CODeff-sol.) (Harada et al., 1993). The fourth item, i.e. COD△SO4, was estimated by multiplying the amount of SO42--S reduced by a conversional factor of 2 (g COD/g SO42--S); and the item (7) represents COD recovery. As summarized in Table 1, the distribution of COD was substantially different among the different HRTs over the steady-state period. The maximum recovered COD of 81.7% into methane, that is CODCH4 gas plus CODCH4 aq, was achieved at HRT 24 h, followed by about 80.6% at HRT 6 h; only 13.2–16.8% was left in the effluent. In contrast, the amount of COD used for methane production at other HRTs showed a marked decline, ranging from 61.2 to 75.9%. In spite of the weaken performance, utilization efficiency of COD in this situation was still typically higher than that of Harada et al. (1993) in treating low strength wastes (starch and sucrose) with different levels of sulfate, and also those reported by Jing et al. 23

(2013) in treating ethanol-acetate wastewater. In the consideration of energy consumption and energy recovery, the optimal HRT could be 6 h. On the other hand, HRT variation did not exert the obvious effect on COD used for sulfate reduction which accounted for as low as 0.5–2.1% of influent COD, primarily because of low sulfate in influent as discussed before. Because of the shock impact of overloading rate as mentioned earlier, the satisfactory performance of UASB was not completely back even at the end of recovering. The proportion of COD transferred into methane represented just 22.5–68.2% of COD added, with up to 22.3–61.7% retained in the effluent. Nevertheless, based on above mentioned observations, UASB will be stable as well as efficient treating starch wastewater with efficient COD removal and methane production, provided that OLR is confined within the rational range (i.e. ~4 g COD/L·d). Table 1

3.4 Roles of OLR on biogas production and COD removal In order to more clearly unveil the effects of OLR, the relationships between OLR and biogas production rate, biogas composition, effluent TCOD and SCOD concentrations and COD removal efficiency were established. The results showed that the performance of UASB system strongly depended on OLR applied (Fig. 2). As presented in Fig. 2a, biogas production rate showed a closely positive correlation with OLR, and increased linearly with OLR (R = 0.9846, p < 0.01), agreeing well with the investigations of Parthiban et al. (2007) on anaerobic tapered fluidized bed reactor fed with starch wastewater, and Sun et al. (2012) who applied an UMAR for treating cassava starch wastewater. Similar behavior of the 24

increasing of methane yield with increasing OLR was also observed in the earlier work of Badshah et al. (2012) on the treatment of methanol condensate employing mesophilic UASB reactors, where methane output increased gradually from 0.21 to 0.29 L/g CODremoved while the OLR was elevated from 1.42 to 5.05 g COD/L·d. On the other hand, methane content in biogas reached a maximum, up to 78% at 4 g COD/L·d (i.e. HRT 6 h) and then dropped down with the further increasing of OLR. Meanwhile, with the OLR increasing from 1 to 8 g COD/L·d, TCOD and SCOD removal also declined to some extents, possibly owing to higher upflow velocity (Vup) which reduced the contact time between granules and targets present in wastewater in addition to smashing and resultantly higher washout of sludge granules (Rizvi et al., 2013). According to Rizvi et al. (2013), Vup is directly related with HRT (or OLR) and plays an important role to entrap suspended solids. A decrease in HRT (i.e. increase in OLR) would lead to an increase in Vup, which, as a consequence, weakened the overall performance of UAS system. Hence, taking into account efficient bioenergy recovery and continuous stability of the system, the optimum OLR in the present study should be 4 g COD/L·d, i.e. HRT 6 h. Furthermore, the relationship between OLR and UASB performance in stable and recovery stages were compared (i.e. at HRT of 24, 12 and 6 h), and the results are graphically reported in Fig. 2b. Biogas production and COD removal were less stable and efficient in recovery stage in comparison with the stable stage at the same OLR conditions. In this situation, biogas production gave a very poor correlation with OLR (R2 = 0.5679), in sharp contrast with the perfect linear increment under stable operations (R2 = 0.9300). Fig. 2. 3.5 Fluorescence spectroscopy analysis 25

Excitation-emission matrix (EEM) fluorescence spectroscopy was applied to investigate the variation of fluorescent organic matters in the effluent from UASB reactor during the steady-state operational periods. As illustrated in Fig. 3, three main peaks could be identified from fluorescence spectra at the excitation/emission wavelengths (Ex/Em) of 280/345 nm (peak A), 230/335 nm (peak B) and 320/420–440 nm (peak C). The first peak was attributed to the tryptophan protein-like substances while the second peak was assigned to the aromatic protein-like substances. Compared to the fluorescence peak location of proteins (Ex/Em of 225/345–355 nm) in extracellular biopolymers extracted from sludge as described by Zhen et al. (2012), the locations of peak B for the effluent showed a blue shift in terms of emission wavelengths. The third peak was regarded as the humic-like substances derived from the biodegradation of soluble organic matters (Mobed et al., 1996). Similar fluorescence signals have also been reported for extracellular substances of aerobic granules in a Plexiglas sequencing batch bioreactor (SBR) (Zhu et al., 2012). Although all effluent samples with different HRT had similar fluorescent features with typical fluorohpores of protein-like and humic-like substances, the position and intensity of fluorescence peaks showed significant differences at different HRT conditions (insert of Fig. 3). The peak locations of the effluent displayed a slight variation with HRT. For instance, the peaks A and B were red shifted by 1–3 and 1–2 nm with the decreasing of HRT, respectively; whereas the peak C indicated by humic-like substances exhibited an obvious blue shift by around 2–5 nm along with the emission axis. Such a shift reflects the changes in the conformations of the fluorescence components in the effluent with changing HRT. According to the literature (Zhen et al., 2012), a red shift might be attributed to the increase of carbonyl, 26

hydroxyl, alkoxyl, and amnio groups in fluorohpores while a blue shift was related to the elimination of particular functional groups (carbonyl, hydroxyl, amine and aromatic rings) or a reduction in the degree of π-electron systems. Fig. 3. In addition, the fluorescence intensities of tryptophan protein-like and aromatic proteinlike substances described respectively by peaks A and B decreased significantly with the prolonged HRT; oppositely, the humic-like substances increased greatly. These results implied that protein-like substances have been efficiently decomposed while being converted into the more stabilized humic substances. Moreover, the fluorescence intensities of peaks A and B in the effluent from HRT 6 h were much weaker than those at other HRT conditions, hinting once again that HRT of 6 h (i.e. OLR at 4 g COD/L•d) depicted higher efficiency in the biodegradation of high molecular fluorescing substances and biogas recovery. Apparently, UASB has obvious advantages for treating starch wastewater at HRT of 6 h. 3.6 Possible biodegradation mechanisms of starch in UASB The conversion of starch to methane originated from the complex metabolic interactions between microorganisms in UASB system. In order to know the principle decomposition mechanisms of starch in UASB reactor, the specific methanogenic activity (SMA) experiment was conducted to characterize the methanogenic activity of granular sludge in serum bottles, and the corresponding results are summarized Table 2. It can be found that the tests fed with starch yielded a relatively low SMA of 0.188 g CODCH4/g VSS·d. However, when glucose was used as substrate, the SMA greatly increased to 0.256 g COD CH4/g VSS·d, increasing by at least 36%, indicating that the hydrolysis from starch to glucose was the rate27

limiting step of starch biodegradation. The step fermentative process of starch starts with the sugar production from starch due to amylolytic microcoganisms as reported by Avancini et al. (2007). In order to further reveal the core degradation pathway involved in acidification and methanogenisis, the granular sludge was fed with H2-CO2 as well as four volatile fatty acids (i.e. formate, acetate, propionate and butyrate). The highest SMA was obtained in the tests with H2-CO2 as substrate, up to 0.382 g CODCH4/g VSS·d, followed by acetate (around 0.288 g CODCH4/g VSS·d). Comparatively, the granular sludge exhibited the quite low decomposition capability to formate, propionate and butyrate; the SMA value was as low as 0.175, 0.145 and 0.103 g CODCH4/g VSS·d, respectively. Based on the above findings, it is apparent that H2-CO2 and acetate could be the most ideal methanogenic precursors compared with other acids during starch biodegradation, even though, other volatile acids can be ultimately converted to CH4 and CO2 by syntrophic acetogens and methanogenic bacteria, which indicated that the production of H2-CO2 and acetate seems to be the key pathways involved in starch bio-decomposition. One possible cause for this, as has been hypothesized in the earlier works, might be that starch wastewater has indigenous microbiota which can drive the formation of H2 and acetate. One evidence, for example, from Sen and Suttar (2012) showed that the H2 yield and production rate reached 349.7 mL/g starchadded and 77.1 mL/L· h, respectively at neutral pH condition; another study by Ahn et al. (2004) in anaerobically treating starch-processing wastewater, noted that acetate production at the optimal conditions was 672 ± 20 mg total organic carbonequivalent/L, accounting for 75% of influent total organic carbon, demonstrating that the anaerobic degradation of starch mainly produces H2 and acetate as the intermediates. 28

No doubt the presence of H2 and acetate will favor the growth of hydrogenotrophic and acetoclastic methanogens, such as methanobacterials (Yang et al., 2013), genus methanosaeta (Kobayashi et al., 2011), etc. In this regard, the hydrogen- and acetate-utilizing methenogenesis during the subsequent starch-fed UASB process can be definitely expected. Table 2

3.7 Characterization of granular sludge in different positions of UASB 3.7.1 Identification of key populations The granular sludges, after 104 days of operating, were collected from different positions of UASB (i.e. up, middle and bottom), and subjected to SEM and FISH analysis. As can be seen from Figs. 4S and 5S in Supplementary Information, the granules with the average size of around 2–5 mm were elliptical as a whole, full of many cavities and cracks on the surface which supplied the vents for produced biogas to escape. It is also worth mentioning that, significantly different from the conventional sludge granules as described previously (Nizami and Murphy, 2011), the granules cultivated in this work resembled brushy balloon with some flagella-like filaments outgrowing from the surface (Fig. 2S in Supplementary Information). This observation is particularly the same to the previously reported by Sekiguchi et al. (2001) in a thermophilic UASB reactor receiving the actual wastewater from a fried soy bean curdmanufacturing factory. They attributed this to the growth of filamentous microorganisms, resulting in the formation of projection-like structure. Nevertheless, because of the limited knowledge regarding the responsible formation mechanisms of the unique granules available in literature, further study are still required.

29

Besides, a further close-up of granules elucidates microorganism congeries distributing in three types of sludges (Figs. 4Sb-d). The shape and structure of microorganisms demonstrated a slight but perceptible shift from the up to the bottom in reactor. The granules from the up and middle mainly comprised of rod-shaped archaebacterial (Figs. 4Sb-c and 5Sa-b); the cells closely associated with or entrapped within sludge matrix, forming a compact and intact micro-structure. For the granules from the bottom, not only rod-shaped archaebacterial also cocci-shaped archaea prevailed on the surface or interior of granules (Figs. 4Sd and 5Sc); the granules were less rigid with a lot of micro-pores observed between microorganisms, possibly caused by the emission of biogas. According to Nizami and Murphy (2011), the rod-shaped archaebacterial and cocci-shaped archaea belong to Methanothrix and Methanosaricina, respectively. The appreciable shift in dominant microbes along the height of UASB might be related to the variations of the surroundings, such as pH, ORP, temperature, substrate or metabolite concentrations, etc. To in-depth understand the responsible reasons for this phenomenon, several parameters including pH, ORP, SCOD, and acetic acid at different heights were measured Fig. 4a. The results indicated pH and ORP kept in a more favorable range for methenogenesis in the lower part, followed by an upward trend in the upper. On the other hand, as expected, starch indicated by SCOD at the bottom was the highest; and it was gradually metabolized, attenuated along the upflow direction (i.e. from the bottom to up) and nearly diminished at the up. Likewise, acetic acid derived from starch exhibited a similar variation, peaking at the bottom and there was extremely low residual acetic acid detected at the up. From the experimental data, it can be speculated that the reactions taking place between the bottom and middle in UASB were the hydrolysis of starch, 30

accompanied by the formation of acetate (i.e. acidification) and concurrent utilization (i.e. methanogenesis); therefore, the zone could be called the “main reaction zone”. Comparatively, thanks to the efficient degradation of starch previously, converting acetate into methane (i.e. methanogenesis) at the up predominated (i.e. “substrate-shortage zone”) (Fig. 5). In this sense, the co-growth of starch- as well as acetate-utilizing anaerobic microbes at the bottom were predominant while the unique microorganisms feeding mainly on acetate grew in abundance at the up, agreeing well with FISH results. This can also be demonstrated by the distinct SMA of granules taken from different positions, as illustrated in Fig. 4b. Bottom-granules could efficiently utilize both starch and acetic acid for methane recovery, with SMA value of 0.247, and 0.211 g CODCH4/g VSS·d, respectively; the granular sludges from the middle and up, in contrast, were capable of decomposing acetate (0.277–0.288 g CODCH4/g VSS·d), but exhibited the poor decomposition capability to starch (0.188–0.199 g CODCH4/g VSS·d). The dynamic and diverse distribution of key populations in the reactor did not only increase the resistance of microorganisms against the external stress, but also improved the overall operating stability of UASB reactor, which in turn led to the effective treatment of starch wastewater. These results would help enhance our insights into the principle mechanisms of UASB in starch wastewater treatment and provide detailed information and theoretical guidance for practical application. Fig. 4. Fig. 5 3.7.2 Different EPS fractions

31

Extracellular polymeric substances (EPS), secreted by the multispecies community of microorganisms, mainly consist of protein (PN) and polysaccharides (PS) with less lipids, humic acids and other polymers, etc. It has been commonly accepted that EPS, present on or outside of sludge flocs, play a key role in anaerobic granulation formation, matrix structural integrity and long-term stability of UASB system (Li et al., 2012). EPS, including slime EPS (S-EPS), loosely bound EPS (LB-EPS) and tightly bound EPS (TB-EPS) extracted from the different locations in the reactor were thus quantified and are given in Fig. 6. Results clearly show that after 104 days of operation, the matured granules coming from the reactor presented a striking increase in EPS, particularly TB-EPS, compared to the seed sludge; moreover, they rose successively from the up to the bottom. The changes of EPS along height of UASB were highly identical to the potential discrepancy of microbial populations present, as has been observed before (see Figs. 4S and 5S in Supplementary Information). High metabolic activity and abundance of microbial species present at the bottom promoted the degradation of starch as well as the self-growth while expediting the biosynthesis and secretion of EPS. The EPS molecules could form gel networks on the surface of granules and contribute more to microbial adhesion and attachment by means of chemical bonding or physical entanglement (Wang et al., 2006), thereby facilitating the accumulation of biomass and strengthening the granulation of sludge. The sludge granulation subsequently improved the settling characteristics and reduced washout of the granules while maintaining the operational stability of the reactor (Fig. 6S in Supplementary Information). Besides the beneficial role played by EPS in granulation process, they can also serve as carbon and energy source to ensure the survival and normal growth of microorganisms during the 32

starvation period (Lu et al., 2014). Based on the abovementioned results, it can be noted that the granules with high amount of EPS would thus have a more stable three dimensional structure to maintain the structural integrity as well as the superior shock and impact resistance against stressfully external disturbance, such as the variation of OLR investigated in this study. As a result, the excellent process stability of UASB reactor can be harvested. In addition, when considering the special influence on the sludge surface properties (e.g. surface charge, viscosity, hydrophobicity, etc.), the PN/PS ratio in different EPS fractions were also calculated. As presented in Fig. 6, the PN/PS ratio extracted from the starch-grown granules decreased compared with those of the seed sludge, caused mainly by the considerable increase in PS content. This observation corroborates with other studies (Wang et al., 2013), which documented a similar PN/PS tendency in an anoxic–aerobic sequencing batch reactor (SBR) when increasing salinity. Extremely high fraction of PS is not always advantageous to the long-term stability of reactor because PS content in EPS induces adherence properties (Ying et al., 2010), likely resulting in the production of foam and agglomeration of granules. Bulky microbial aggregates with a high specific surface thus would be much easier to be adhered to by biogas-bubbles and foam, which reduced the specific gravity of granules and led to floating of sludge. During a healthy UASB process (e.g. OLR below 4.0 g COD/L·d in this study), a dynamic balance existed between sludge floating and settling; the floating granules could recover its settleability when transferred into the top of reactor by releasing biogas-bubbles and consuming the excess EPS. But, this balance might be disequilibrated if OLR was too high because biogas-bubbles was not released promptly and excess EPS not be consumed effectively, which subsequently would cause 33

intensive floating of sludge and even washout. This might be the core reason for the critical problems observed when OLR was maintained at a high level (i.e. 8 g COD/L·d) (Fig. 2S in Supplementary Information). Based on the results posed above, notably, despite the positive role of UASB in starch wastewater treatment as noted before, to be fair, there are still a lot of quite hard challenges such as the foaming, floating and washout of sludge, clogging of outlet, etc. facing us. The serious problems, if not overcome timely, will seriously impede the engineering application of the UASB technique in real starch wastewater treatment. Thus, further investigation is still urgent. Fig. 6.

4. Conclusions UASB showed good performance for treating starch wastewater. The optimal HRT was 6 h with OLR 4 g COD/L·d, which gained 81.1–98.7% COD removal and 0.33 L CH4/g CODremoved methane yield. Methane production via H2-CO2 and acetate were the principal starch fermentation pathways. Main reactions with respect to starch biodegradation occurred at the lower part of reactor (“main reaction zone”) while at the up converting acetate into methane predominated (“substrate-shortage zone”). Further shortening HRT to 3 h caused VFAs accumulation, sludge floating and performance inhibition. Sludge floating was primarily ascribed to the excess secretion of PN in EPS.

Acknowledgements 34

The authors wish to thank the China scholarship Council (CSC, File No.201306890003) and Japan Society for the Promotion of Science (JSPS, ID No. PU 14016) for partial support of this study.

35

Reference Ahmad, A., Ghufran, R., Wahid, Z.A. 2011. Role of calcium oxide in sludge granulation and methanogenesis for the treatment of palm oil mill effluent using UASB reactor. J. Hazard. Mater. 198, 40- 48. Ahn, J.H., Lee, S., Hwang, S. 2004. Modeling and Biokinetics in Anaerobic Acidogenesis of Starch-Processing Wastewater to Acetic Acid. Biotechnol. Progr. 20, 636-638. Annachhatre, B.A.P., Amatya, P.L. 2000. UASB treatment of tapioca starch wastewater. J. Environ. Eng. 126, 1149-1152. APHA. 1998. Standard Methods for the Examination of Water and Wastewater, 20th ed, (Ed.) A.P.H. Association. Washington, DC, USA. Avancini, S.R.P., Faccin, G.L., Vieira, M.A., Rovaris, A.A., Podesta, R., Tramonte, R., Souza, N.M.A.d., Amante, E.R. 2007. Cassava starch fermentation wastewater: Characterization and preliminary toxicological studies. Food Chem. Toxicol. 45, 2273-2278. Badshah, M., Parawira, W., Mattiasson, B. 2012. Anaerobic treatment of methanol condensate from pulp mill compared with anaerobic treatment of methanol using mesophilic UASB reactors. Bioresour. Technol. 125, 318-327. Carrillo-Reyes, J., Celis, L.B., Alatriste-Mondragon, F., Razo-Flores, E. 2014. Decreasing methane production in hydrogenogenic UASB reactors fed with cheese whey. Biomass Bioenerg. 63, 101-108. Chong, S., Sen, T.K., Kayaalp, A., Ang, H.M. 2012. The performance enhancements of upflow anaerobic sludge blanket (UASB) reactors for domestic sludge treatment-A State-of-the-art review. Water Res. 46, 34343470. Colin, X., Farinet, J.L., Rojas, O., Alazard, D. 2007. Anaerobic treatment of cassava starch extraction wastewater using a horizontal flow filter with bamboo as support. Bioresour. Technol. 98, 1602-1607. Fang, C., Boe, K., Angelidaki, I. 2011. Biogas production from potato-juice, a by-product from potato-starch processing, in upflow anaerobic sludge blanket (UASB) and expanded granular sludge bed (EGSB) reactors. Bioresour. Technol. 102, 5734-5741. Guerrero-Barajas, C., Ordaz, A., Garibay-Orijel, C., García-Solares, S.M., Bastida-Gonzalez, F., Zarate-Segura, P.B. 2014. Enhanced sulfate reduction and trichloroethylene (TCE) biodegradation in a UASB reactor operated with a sludge developed from hydrothermal vents sediments: Process and microbial ecology. Int. Biodeter. Biodegr. 94, 182-191. Harada, H., Uemura, S., Momonoi, K. 1993. Interaction between sulfate-reducing bacteria and methaneproducing bacteria in UASB reactors fed with low strength wastes containing different levels of sulfate. Water Res. 28(2), 355-367. Hinken, L., Huber, M., Weichgrebe, D., Weichgrebe, D. 2014. Modified ADM1 for modelling an UASB reactor laboratory plant treating starch wastewater and synthetic substrate load tests. Water Res. 64, 82-93. Jing, Z.Q., Hu, Y., Niu, Q.G., Liu, Y.Y., Li, Y.Y., Wang, X.C. 2013. UASB performance and electron competition between methane-producing archaea and sulfate-reducing bacteria in treating sulfate-rich wastewater containing ethanol and acetate. Bioresour. Technol. 137, 349-357. Kobayashi, T., Yan, F., Takahashi, S., Li, Y.-Y. 2011. Effect of starch addition on the biological conversion and microbial community in a methanol-fed UASB reactor during long-term contimuous operation. Bioresour. Technol. 102, 7713-7719. Kryvoruchko, V., Machmuller, A., Bodiroza, V., Amon, B., Amon, T. 2009. Anaerobic digestion of by-products of sugar beet and starch potato processing. Bimass Bioenerg. 33, 620-627.

36

Li, J., Wang, J., Luan, Z., Ji, Z., Yu, L. 2012. Biological sulfate removal from acrylic fiber manufacturing wastewater using a two-stage UASB reactor. J. Environ. Sci. 24(2), 343-350. Lu, X., Zhen, G., Liu, Y., Hojo, T., Estrada, A.L., Li, Y.Y. 2014. Long-term effect of the antibiotic cefalexin on methane production during waste activated sludge anaerobic digestion. Bioresour. Technol. 169, 644– 651. Mobed, J.J., Hemmingsen, S.L., Autry, J.L., Mcgown, L.B. 1996. Fluorescence Characterization of IHSS Humic Substances: Total Luminescence Spectra with Absorbance Correction. Environ. Sci. Technol. 30, 3061-3065. Nizami, A.S., Murphy, J.D. 2011. Optimizing the Operation of a Two-Phase Anaerobic Digestion System Digesting Grass Silage. Environ. Sci. Technol. 45, 7561-7569. Parthiban, R., Iyer, P., Sekaran, G. 2007. Anaerobic tapered fluidized bed reactor for starch wastewater treatment and modeling using multilayer perceptron neural network. J. Environ. Sci. 19, 1416-1423. Rajbhandari, B.K., Annachhatre, A.P. 2004. Anaerobic ponds treatment of starch wastewater:case study in Thailand. Bioresour. Technol. 95, 135-143. Rizvi, H., Ahmad, N., Abbas, F., Bukhari, I.H., Yasar, A., Ali, S., Yasmeen, T., Riaz, M. 2013. Start-up of UASB reactors treating municipal wastewater and effect of temperature/sludge age and hydraulic retention time (HRT) on its performance. Arabian J. Chem. In Press. doi:10.1016/j.arabjc.2013.12.016. Sekiguchi, Y., Takahashi, H., Kamagata, Y., Ohashi, A., Harada, H. 2001. In Situ Detection, Isolation, and Physiological Properties of a Thin Filamentous Microorganism Abundant in Methanogenic Granular Sludges: a Novel Isolate Affiliated with a Clone Cluster, the Green Non-Sulfur Bacteria, Subdivision I. Appl. Environ. Microbiol. 67(12), 5740-5749. Sen, B., Suttar, R.R. 2012. Mesophilic fermentative hydrogen production from sago starch-processing wastewater using inriched mixed cultures. Int. J. Hydrogen Energ. 37, 15588-15597. Sun, L., Wan, S., Yu, Z., Wang, Y., Wang, S. 2012. Anaerobic biological treatment of high strength cassava starch wastewater in a new type up-flow multistage anaerobic reactor. Bioresour. Technol. 104, 280288. Tan, X., Chu, H., Zhang, Y., Yang, L., Zhao, F., Zhou, X. 2014. Chlorella pyrenoidosa cultivation using anaerobic digested starch processing wastewater in an airlift circulation photobioreactor. Bioresour. Technol. 170, 538–548. Wang, R.M., Wang, Y., Ma, G.P., He, Y.F., Zhao, Y.Q. 2009. Efficiency of porous burnt-coke carrier on treatment of potato starch wastewater with an anaerobic–aerobic bioreactor. Chem. Eng. J. 148, 35-40. Wang, Z., Gao, M., Wang, Z., She, Z., Chang, Q., Sun, C., Zhang, J., Ren, Y., Yang, N. 2013. Effect of salinity on extracellular polymeric substances of activated sludge from an anoxic-aerobic sequencing batch reactor. Chemosphere 93, 2789–2795. Wang, Z., Liu, L., Yao, J., Cai, W. 2006. Effects of extracellular polymeric substances on aerobic granulation in sequencing batch reactors. Chemosphere, 63, 1728-1735. Yang, Y., Guo, J., Hu, Z. 2013. Impact of nano zero valent iron (NZVI) on methanogenic activity and population dynamics in anaerobic digestion. Water Res. 47, 6790-6800. Ying, W., Yang, F., Bick, A., Oron, G., Herzberg, M. 2010. Extracellular Polymeric Substances (EPS) in a Hybrid Growth Membrane Bioreactor (HG-MBR): Viscoelastic and Adherence Characteristics. Environ. Sci. Technol. 44, 8636-8643. Zhen, G.Y., Lu, X.Q., Li, Y.Y., Zhao, Y.C. 2013. Innovative combination of electrolysis and Fe(II)-activated persulfate oxidation for improving the dewaterability of waste activated sludge. Bioresour. Technol. 136, 654-663.

37

Zhen, G.Y., Lu, X.Q., Wang, B.Y., Zhao, Y.C., Chai, X.L., Niu, D.J., Zhao, A.H., Li, Y.Y., Song, Y., Cao, X.Y. 2012. Synergetic pretreatment of waste activated sludge by Fe(II)–activated persulfate oxidation under mild temperature for enhanced dewaterability. Bioresour. Technol. 124, 29-36. Zhu, L., Qi, H.Y., Lv, M.L., Kong, Y., Yu, Y.W., Xu, X.Y. 2012. Component analysis of extracellular polymeric substances (EPS) during aerobic sludge granulation using FTIR and 3D-EEM technologies. Bioresour. Technol. 124, 455-459.

38

Figure Legends Fig. 1. Operational performance of UASB under different HRTs. Fig. 2. Effect of OLR on UASB performance under normal and recovery phase. Fig. 3. Effect of HRT on fluorescence properties of dissolved organic matters (DOM) in effluent. Fig. 4. (a) Variations of pH, ORP, SCOD, and acetic acid along the height of UASB; (b) SMA of granular sludges sampled from the up, middle and bottom. Herein, the SMA tests were carried out using starch and acetic acid as the substrate, respectively. Fig. 5. Starch fermentation dynamics and principal mechanisms of sludge floating in the interior of UASB. Fig. 6. EPS content in the inoculum and granules coming from the different height of UASB.

39

HRT = 24 h 12 h 8h

6h

10.00 9.00 8.00 7.00 6.00 5.00 300 150 0 -150 -300

4h

3h 24 h 12 h 6h Recovery stage

pH

(a) Influent Effluent

Influent Effluent

100 80 60 40 20 0 360 300 240 180 120 60 0 5 4 3 2 1 0 100 80 60 40 20 0

(c) TCOD-removal SCOD-removal

(d)

Measured production rate Theoretical production rate

(e)

CH4 CO2 H2S

(f)

0.3 0.2 0.1

0

20

40

0.0 60 80 100 120 140 160 180 200 220 Operation time (days) Fig. 1.

40

H2S (%)

CH4 and CO2 (%) Biogas production VFA (mg/L) rate (L/L/d)

COD removal (%)

ORP (mV)

(b)

Biogas production rate(L/L/d)

Biogas production rate (L/L/d)

2.0

4 RR = 0.9846, = 0.9586, p =p3.55 = 0.0025 x 10-4 <<0.01 0.01

3

(a)

2

1.0

1

0.5

0

CH4 content (%)

Biogas composition (%)

(b) R2 = 0.9300 2

R = 0.5679

0.0 100

100 80 60

CH4 CO2 H2S

40 20

SCOD removal (%) TCOD removal (%)

0 1000

COD removal (%) CODeffluent (mg/L)

Recovery stage Stable Regr

1.5

TCOD SCOD

800 600 400 200 0 100 80 60 40

TCOD SCOD

20 0 0

1

2

3 4 5 6 OLR (g COD/L/d)

7

8

80 60 40 20

80 60 40 Recovery stage Stable

20 0 100

9

Fig. 2.

41

Recovery stage Stable

0 100

80 60 40 Recovery stage Stable

20 0 0.5

1.0

1.5

2.0 2.5 3.0 OLR (g COD/L/d)

3.5

4.0

4.5

Peak area (x104)

700 Ex = 230 nm

Intensity

600

HRT 3 HRT 4 HRT 6 HRT 8 HRT 12 HRT 24

500 400

4 3 2 1 0 4 8 12 16 20 24 HRT (h)

300 200

peak A

100 0 260 280 300 320 340 360 380 400 420 300

Peak area (x104)

Em wavelength (nm) Ex = 280 nm

Intensity

250 200

1.6 1.2 0.8 0.4 0 4 8 12 16 20 24 HRT (h)

HRT 3 HRT 4 HRT 6 HRT 8 HRT 12 HRT 24

150 100 50

peak B

0 300

350

400 Peak area (x104)

100

Ex = 320 nm 80

Intensity

450

500

Em wavelength (nm)

60

HRT 3 HRT 4 HRT 6 HRT 8 HRT 12 HRT 24

0.5 0.4 0.3 0.2 0.1 0 4 8 12 16 20 24 HRT (h)

40 20 0 350

peak C 400

450

500

Em wavelength (nm)

Fig. 3. 42

550

(a)

120

UASB height (cm)

100 80 60 40 20 0

SMA (g CODCH4/g VSS d)

(b)

0.30 0.25 0.20 0.15 0.10 0.05 0.00

SMA (g CODCH4/g VSS d)

6.8 7.2 7.6 8.0 -350 -280 -2100 200 400 6000 20 40 60 80 pH ORP (mV) SCOD (mg/L) Acetic acid (mg/L) Starch

Up

Middle Bottom

Fig. 4.

43

0.4

Acetate

0.3 0.2 0.1 0.0 Up

Middle Bottom

Fig. 5.

44

2.5 PN PS PN/PS

700 600

#:S-EPS

500

&:LB-EPS

400

@:TB-EPS

1.5 1.0

300

& @

200 100

2.0

0.5 #

0

0.0

Raw

Up

Middle Bottom

Fig. 6.

45

PN/PS ratio

EPS (mg/g Wet sludge)

800

Supplementary Information 1. Fluorescence in situ hybridization (FISH) Fluorescence in situ hybridization (FISH) was conducted mainly according to the methods described before (Kobayashi et al., 2012; Zhen et al., 2014 submitted to Bioresource technology). Granules were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS; 10 mM Na2HPO4, 10 mM NaH2PO4 and 150 mM NaCl at pH 7.2) at 4 ◦ C for 3 h. The fixed samples were washed three times in PBS and once in ultra-pure water. After that, the samples were sonicated for 5 min in a PBS–ethanol solution (1:1) to disperse the cells. The samples were immobilized on slides by 1% agarose in PBS (1% agarose and 0.01% sodium dodecyl sulfate), dried at 45 ◦C, dewatered by an ethanol series (50%, 80%, and 95%) (2 min per step), and then dried again at 45 ◦C. Hybridizations were performed at 46 ◦ C for 3 h with the hybridization buffer (900 mM NaCl, 20 mM Tris-HCl [pH 7.2], 35% formamide, 0.01% sodium dodecyl sulfate and 1% blocking reagent (w/v, RocheDiagnostics, Mannheim, Germany)) containing 0.5 µM probes and then washed at 48 ◦C for 15 min with the washing buffer (900 mM NaCl, 20 mM Tris-HCl [pH 7.2], 35% formamide and 0.01% sodium dodecyl sulfate). Afterwards, the slides were immersed in ultra-pure water for 2 min, and finally air dried. Fluorescence labels of the oligonucleotide probes used here included ARC915 (Archaea, GTGCTCCCCCGCCAATTCCT). After hybridization, the cells on slides were stained with 4,6-diamidino-2-phenylindole (DAPI). FISH were carried out under a Nikon E1000 research-level microscope. The images were optimized by adjusting the pixel level and brightness/contrast to achieve 46

a high contrast of a target microbe. The relative abundance of each microbial group was estimated on at least 5 different TIF images using ImageJ 1.48 software package available in the public domain at http://rsb.info.nih.gov/ij/download.html.

2. Figure Legends Fig. 1S Schematic diagram of the UASB reactor system. Fig. 2S Critical problems observed during the starch-fed UASB process. Fig. 3S Methane yield per gram COD removed under different HRTs. Fig. 4S SEM images of granules: (a) overall view; (b) up; (c) middle; and (d) bottom section of the UASB reactor. Fig. 5S Fluorescence in situ hybridization (FISH) of granules collected from (b) up; (c) middle; and (d) bottom section of the UASB reactor. Total cells were identified with DAPI stain (blue) and Archaea were hybridized with Cy3-labeled ARC915 probe (red). Fig. 6S Change of settling velocities of granules collected from the different heights of UASB.

47

Fig. 1S

48

Fig. 2S

49

Methane yield (L/g CODremoved)

0.35 I: Steady stage

II: Recovery satge

0.30 0.25 0.20 0.15 0.10 0.05 0.00 24 12

8

6 4 3 HRT (h) Fig. 3S

50

24 12

6

Fig. 4S

51

Fig. 5S

52

Settling velocity (m/s)

0.05 0.04

Raw Up Middle Bottom

0.03 0.02 0.01 0.00

0~30

30~100 Route (cm)

100~130

Fig. 6S

Reference： ： Kobayashi, T., Li, Y.Y., Kubota, K., Harada, H., Maeda, T., Yu, H.Q. 2012. Characterization of sulfide-oxidizing microbial mats developed inside a full-scale anaerobic digester employing biological desulfurization. Appl. Environ. Biotechnol. 93(2), 847-857. Zhen, G., Kobayashi, T., Lu, X., Xu, K. 2014. Understanding methane bioelectrosynthesis from carbon dioxide in a two-chamber microbial electrolysis cells (MECs) containing a carbon biocathode. Bioresource Technology, submitted (with editor).

53

Lists of Tables Table 1 Distributions of COD with HRTs under steady-state and recovery (filled with orange) conditions. Table 2 Specific methanogenic activity (SMA) of the granular sludges fed with different substrates.

54

Table 1 CODInff.

CODCH4 gas CODCH4 aq CODH2S gas COD△SO4

CODeff-SS

CODeff-sol.

Recovery

HRT (h) (mg/L)

(%)-(1)

(%)-(2)

(%)-(3)

(%)-(4)

(%)-(5)

(%)-(6)

(%)-(7)

24

847.0 ± 153.7 80.4 ± 4.8

1.3 ± 0.5

0.2 ± 0.0

2.1 ± 0.2

7.6 ± 1.4

5.6 ± 0.0

91.5 ± 6. 9

12

911.5 ± 87.1

58.7 ± 3.7

2.5 ± 0.1

0.1 ± 0.0

1.3 ± 0.4

9.1 ± 4.5

5.0 ± 2.1

80.9 ± 3.0

8

947.6 ± 103.9 67.9 ± 9.6

1.7 ± 0.1

0.1 ± 0.0

0.5 ± 0.3

19.4 ± 11.1 6.2 ± 1.8

95.7 ± 0.1

6

1063.2 ± 86.8 78.6 ± 4.2

2.0 ± 0.7

0.1 ± 0.1

0.9 ± 0.3

10.1 ± 2. 5

6.7 ± 1.6

98.3 ± 3.6

4

955.3 ± 58.8

64.8 ± 23.7 1.9 ± 0.4

0.1 ± 0.1

0.9 ± 0.2

15.5 ± 9.6

9.6 ± 4.0

92.7 ± 18.0

3

1071.5 ± 96.2 73.0 ± 8.8

2.9 ± 1.1

0.1 ± 0.1

1.1 ± 0.7

7.5 ± 8.7

9.2 ± 3.0

93.8 ± 5.8

24

831.5 ± 96.0

67.7 ± 12.5 0.5 ± 0.6

0.1 ± 0.8

1.1 ± 0.3

10.2 ± 9.4

12.1 ± 4.5 91.7 ± 11.2

12

871.9 ± 131.8 43.3 ± 19.8 1.3 ± 0.9

0.0 ± 0.0

1.0 ± 0.4

14.5 ± 7.1

27.5 ± 9.9 87.6 ± 11.7

6

897.4 ± 164.7 20.6 ± 3.4

0.1 ± 0.0

2.1 ± 2.1

20.1 ± 12.9 41.6 ± 6.6 86.3 ± 13.8

1.9 ± 0.6

40

(1) recovered CH4-COD in gas phase (CODCH4 gas); (2) dissolved CH4-COD in the effluent (CODCH4 aq), (3) recovered H2S-COD in gas phase (CODH2S gas); (4) COD used for sulfate reduction (COD△SO4); (5) the COD of the suspended solids in the effluent (CODeff-SS); (6) soluble COD in the effluent (CODeff-sol.); (7) recovery (%), which represents the COD recovery, accounting for the conversion of the COD removed from all forms other than that retained in the reactor.

41

Table 2

Substrate SMA (g CODCH4/g VSS·d)

Starch Glucose Butyrate Propionate Acetate Formate

0.188

0.256

0.103

42

0.145

0.288

0.175

H2 CO2 0.382

Graphical Abstract

43

Research Highlights: Long-term performance of UASB reactor treating starch wastewater was investigated. COD removal reached 81.1–98.7% at HRT 6 h with methane yield of 0.33 L/g CODremoved. Principle degradation dynamics in different UASB positions were elucidated. Sludge floating was a critical factor attenuating the overall performance of UASB. Extracellular polymeric substances were a major contributor to sludge floating.

44