Optimization and characterization of extracellular cellulase produced by Bacillus pumilus MGB05 isolated from midgut of muga silkworm (Antheraea assamensis Helfer)

Accepted Manuscript Optimization and characterization of extracellular cellulase produced by Bacillus pumilus MGB05 isolated from midgut of muga silkworm (Antheraea assamensis Helfer)

Bhuyan Pinky Moni, Sandilya Sosanka Protim, Nath Pranab Kumar, Gandotra Sakshi, Subramanian Sabtharishi, Kardong Devid, Gogoi Dip Kumar PII: DOI: Reference:

S1226-8615(18)30226-7 doi:10.1016/j.aspen.2018.08.004 ASPEN 1233

To appear in:

Journal of Asia-Pacific Entomology

Received date: Revised date: Accepted date:

4 April 2018 11 June 2018 10 August 2018

Please cite this article as: Bhuyan Pinky Moni, Sandilya Sosanka Protim, Nath Pranab Kumar, Gandotra Sakshi, Subramanian Sabtharishi, Kardong Devid, Gogoi Dip Kumar , Optimization and characterization of extracellular cellulase produced by Bacillus pumilus MGB05 isolated from midgut of muga silkworm (Antheraea assamensis Helfer). Aspen (2018), doi:10.1016/j.aspen.2018.08.004

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

ACCEPTED MANUSCRIPT Optimization and characterization of extracellular cellulase produced by Bacillus pumilus MGB05 isolated from midgut of muga silkworm (Antheraea assamensis Helfer) Bhuyan Pinky Moni1, Sandilya Sosanka Protim1, Nath Pranab Kumar2 Gandotra Sakshi3, Subramanian Sabtharishi 3, Kardong Devid4, Gogoi Dip Kumar1* 1

PT

Biotechnology Division, Central Muga Eri Research & Training Institute, Central Silk Board,

Lahdoigarh, Jorhat-785700, Assam, India. 2

RI

Department of Agricultural Biotechnology, Assam Agricultural University, Jorhat- 785013, Assam,

SC

India 3

Division of Entomology, Indian Agricultural Research Institute, New Delhi- 110012

4

MA

NU

Department of Life Sciences, Dibrugarh University, Dibrugarh-786004, Assam, India

* Corresponding Author: Dr. Dip Kumar Gogoi, Scientist CMER&TI, Central Silk Board, Lahdoigarh,

D

Jorhat-785700, Assam (India)

AC

CE

PT E

Email: [email protected]

ACCEPTED MANUSCRIPT Abstract Mature larvae of Antheraea assamensis were collected from different locations of Assam to isolate the cellulolytic gut microflora. Altogether sixty cellulase degrading bacteria were isolated on agar plates containing microcrystalline cellulose as the sole carbon source. Among them, ten isolates showed hydrolyzing zone on agar plates containing carboxy methyl cellulose (CMC) after staining

PT

with Congo-red. Isolate MGB05 exhibited the highest CMCase activity (0.262 U/mL) at 72 hours of incubation under submerged condition. FPase and β-glucosidase activity were 0.012 U/mL and 3.71

RI

U/mL respectively. It showed maximum FPase (0.022 U/mL) activity on the 3rd day of incubation in

SC

the media containing wheat bran as a carbon source. β-glucosidase production was also found to be highest with wheat bran (20.03 U/mL) at 48 hours of incubation. The optimum pH and temperature of

NU

FPase activity of MGB05 were found at 6.0 and 50oC respectively while for β-glucosidase activity, it was maximum at pH 6.0 under 50oC. In addition, metal ion Mg++ and Ca++ enhanced FPase activity

MA

up to 110.92% (0.026 U/mL) and 105.31% (0.025 U/mL) respectively. In-vitro antimicrobial bioassay of the most potent cellulolytic bacteria (MGB05) also showed high antimicrobial activity against

D

Escherichia coli (2.9 cm) and Pseudomonas aeruginosa (3.0 cm). The isolate MGB05 has been

PT E

identified based on 16S rDNA homology as Bacillus pumilus MGB05 with accession KP298708.2. Results encompass the prospective beneficial role of gut-microflora on digestion and disease

CE

resistance, which might be a potential probiotic component to enhance silk productivity.

AC

Key words: Antheraea assamensis, 16S rDNA, Bacillus pumilus, Cellulase, insect gut microbiota

ACCEPTED MANUSCRIPT Introduction

Antheraea assamensis Helfer is unique in its ability to produce the golden coloured, glossy, fine textured and the most durable silk commonly known as ‘muga silk.’ It is a multivoltine, semidomesticated lepidopteran insect endemic to the Brahmaputra valley of Assam and the adjoining hilly

PT

areas of Northeast India. It has been commercially exploited for several decades, became GI tagged in 2007 and holds tremendous export potential. A. assamensis is polyphagous and the production of

RI

quality silk cocoon is largely dependent on larval nutrition and the quality of leaves on which the

SC

insect feeds upon. Silkworms are dependent on the enzymes derived from gut microorganisms. Insect gut provides a suitable environment for microbial colonization making it a highly efficient natural

NU

bioreactor to process nutrient-poor recalcitrant diets. In addition to aiding food digestion, gut microflora provides services like pheromone production, the supply of essential nutrients, prevention

MA

of pathogen colonization and detoxification of secondary metabolites (Dillon and Dillon, 2004; Morrison et al., 2009). Microbial diversity and structure in the insect gut are moulded by available

D

food, physiological environment and propinquity to other microorganisms. A. assamensis feeds on a

PT E

variety of primary, secondary and tertiary host plants. Such remarkable adaptations to diverse nutritional resources are possible owing to the wide diversity of digestive enzymes produced by the

CE

insects themselves as well as the metabolic capabilities of symbiotic microorganisms. Symbiotic microorganisms help to overcome the host’s nutritional limitations. Microbial symbionts also provide

AC

chemical defense to the host against parasites and predators. Thus, there exists critical interplay between the host plant, gut flora and silk worm physiology. Reports on the exploration of beneficial gut-microbes of A. assamensis are meagre. Understanding the dominant gut microbial community of healthy larvae is a prospective area to develop probiotic products for disease resistance as well as silk productivity. In our previous work, we identified several nutritionally important gut bacteria having different enzymatic activities (Gandotra et al., 2016). In this study, we report a potent cellulose degrading bacterium with antimicrobial efficacy from a healthy 5th instar larva of A. assamensis.

ACCEPTED MANUSCRIPT Materials and Methods Silk worm collection and isolation of gut bacteria

Mature muga silkworms of 4th and 5th instar were collected from different areas of North-East India from farmer’s field and wild habitats (Table 1). Prior to isolation of gut microflora, the larvae

PT

were starved overnight and were surface sterilized with 70% ethanol. After aseptically isolating the alimentary canal, it was washed with cold and sterile saline solution (0.9 % NaCl, w/v) followed by

RI

homogenization in 0.1M potassium phosphate buffer. The homogenates were centrifuged to remove

SC

the cell debris. The supernatant was taken as gut microbial stock solution (Khyade and Marathe,

NU

2012).

Table 1. Muga silkworm collection sites surveyed in the study

CFU/gut homogenate on CMC plate 1.26 ± 0.12 x 106 1.81± 0.11 x 106 1.19 ± 0.2 x 106 2.5 ± 0.09 x 106 2.0 ± 0.13 x 106

AC

CE

PT E

D

MA

Geographical location of Sample collection sites Name of Area GPS state Location (Latitude Longitude) Assam Sivasagar (Farmer’s field) 26o54’51”N 94o45’37”E Assam Boko (Regional Muga Research Station, CSB) 25o59’26”N 91o14’33”E Meghalaya Nongpoh (MSSO, CSB) 25o53’34”N 91o52’34”E Nagaland Dhansiripar Village 25o44’12”N 93o37’53’’E Manipur Sericulture, West Imphal 24o47’18”N 93o56’35’’E Isolation of cellulolytic bacteria

In order to isolate the cellulolytic bacteria, 100 µL of diluted stock solution was plated onto modified Czapek’s medium (Himedia Ltd., Mumbai) containing (g/L): NaNO3 2.0; MgSO4⋅7H2O 0.5; NaCl 0.5; FeSO4⋅7H2O 0.01; KH2PO4 1.0; yeast extract 0.4; glucose 1.0; cellulose powder 3.0; agar 15.0 and pH 5.0 (Liang et al., 2014). The plates were incubated at 30°C for 3-5 days. The bacterial

ACCEPTED MANUSCRIPT colonies were counted and expressed as Colony Forming Unit (CFU) per insect gut. Distinct colonies were picked and maintained on CMC (carboxy methyl cellulose) agar slants at 4°C for further use. Qualitative cellulase assay was carried out by growing the isolates on Czapek’s medium containing CMC instead of cellulose, after 3 days of incubation at 30°C, the colonies were submerged with 1% Congo red solution (30 min) followed by treatment with 1 M NaCl (15 min) to visualize

PT

clear halo zone formed. The diameter of the clear zone around the bacterial colony is indicative of the magnitude of cellulolytic activity. The Relative Cellulolytic Activity Index (RCAI) was calculated by

RI

comparing the diameter of clearing zone around the colony with diameter of the bacterial colony.

SC

Strains with highest RCAI were re-assessed after growing in Mandels and Reese broth medium containing microcrystalline cellulose as carbon source (Mandels and Reese, 1957) followed by

NU

loading 10 µl of crude supernatant solution into wells in CMC agar plates. After incubating overnight at room temperature, the plates were flooded with Gram’s iodine (2.0 g KI and 1.0 g iodine in 300 mL

MA

distilled water) for 5 min (Kasana et al., 2008).

Qualitative assay for β-glucosidase enzyme was carried out by streaking the cellulolytic bacterial

D

isolates onto Czapek’s medium containing 1% CMC and 0.5% 4-methylumbelliferyl-β-D-glucoside

PT E

(MUG) (Sigma). The cultures were incubated at 30°C for 24 hours. The action of βglucosidase enzyme causes the release of methylumbelliferyl (MU) from MUG, which when observed under UV transilluminator emit fluorescence.

AC

CE

Morphological and Biochemical Characterization

Preliminary morphological characterization of the cellulolytic bacteria was carried out by light microscopy after staining with standard Gram’s stain (Hi-media Ltd., Mumbai). In brief, the bacterial cells were grown for 48 hours in Mandels and Reese medium (Mandels and Reese, 1957) with CMC. After washing the cell pellet with sterile PBS (Phosphate buffer solution), cell suspension amounting to 5µl was spotted onto a glass slide, heat-fixed and stained as per Holt et al., (1994). Bacterial morphology and cultural characteristics were recorded using phase contrast microscope (Olympus CKX-41). Biochemical characterization was carried out for carbon source utilization, enzymatic activity and amino acid utilization using HiIMViC and HiAssorted Biochemical Test Kit (Himedia

ACCEPTED MANUSCRIPT Ltd., Mumbai) as per manufacture’s manual, inoculating bacterial cell turbidity at 0.5 Mcfarland standards. The results were compared to Bergey’s Manual of determinative bacteriology (Holt et al., 1994). Quantitative assay of cellulase activity

PT

Cellulase positive bacteria showing good activity on Congo red media were pre-cultured overnight in nutrient broth medium (NBM) containing beef extract 2 g/L; yeast extract 2 g/L; sucrose

RI

6 g/L; and peptone 5 g/L (Liang et al., 2014). 2 mL of the culture was inoculated into Mandels and

SC

Reese broth medium at pH 5.0, containing cellulose (10 g/L) as carbon source. The culture flasks were incubated in an orbital shaker at 30°C and 180 rpm for 48 hours. The crude supernatant obtained

NU

after centrifugation (HERMLE) at 10000 rpm was used for the entire enzyme assays.

MA

Assay of Endo 1, 4- glucanases activity

Endo 1, 4- glucanases was assayed as per Gadgil et al. (1995) using carboxy methyl cellulose

D

(CMC) as substrate and 3, 5-dinitrosalisylic acid (DNS) as coupling reagent. The reaction mixture

PT E

contained 1 mL of 0.1 M citrate buffer of pH 5.0, 1 mL of 1% CMC and 0.1 mL of suitably diluted crude enzyme supernatant. After incubation at 50°C for 30 min, 3 mL of DNS reagent was added. The mixture was boiled for 15 min and cooled immediately in ice. The absorbance was measured at 540

CE

nm against reagent blank. The released glucose was determined by comparing the absorbance with

AC

standard glucose solution. One unit of enzyme activity was defined as the amount of glucose (mole) released by 1 mL of enzyme solution per min. Assay of Filter paper activity (FPase)

Enzymatic degradation of filter paper requires the concerted action of endocellulase, exocellulase and cellobiohydrolase and thus provides a clear picture of total cellulase activity (Dashtban et al., 2010). The FPase activity of the culture supernatant was determined as per Goyari et al., (2014) using Whatman No 1 filter paper as the substrate. In order to correct the reducing sugar present in the enzyme preparation, a blank without filter paper was also run (Eveleigh et al., 2009). One Filter Paper

ACCEPTED MANUSCRIPT Unit (FPU) was defined as the amount of the enzyme that released 1 μmole of glucose per minute from the original substrate at the experimental conditions. Assay of β-glucosidase activity

β-glucosidase activity was assayed using p-nitrophenyl- β -D-glucopyranoside (pNP-G) as

PT

substrate (Parry et al., 2001). The colour developed was read at 405 nm using microplate reader (HALO MPR-96, Dynamica). The colour intensity was quantified using standard curve of p-

RI

nitrophenol. One unit of enzyme activity was expressed as the amount of enzyme required to release

SC

one μmole of p-nitrophenol per minute under standard assay conditions.

NU

Evaluation of antimicrobial activity of the gut isolated bacteria

The gut isolated cellulolytic bacteria were also checked for possible in vitro antimicrobial activity

MA

against silk worm pathogens. Silk worm pathogens E. coli (gram negative), Bacillus subtilis (gram positive) and Pseudomonas aeruginosa (gram negative) were obtained from the pathology laboratory

D

of Central Muga Eri Research and Training Institute (CMER&TI). The bacterial strains were

PT E

maintained on a nutrient agar slant and stored at 5°C. The assay involved seeding of 1 mL fresh inoculum (106 CFU/mL) of MGB05 into 100 mL of nutrient broth for 48 hours in a gyratory shaker (150 rpm) at 28°C. The bacterial cells were removed by centrifugation at 10,000 rpm at 4°C for 10

CE

min and the supernatants were used to assay antimicrobial activities against the pathogens as per

AC

Perez et al., (1990). The inhibition zone developed was recorded in mm. Extraction of crude bioactive compound from gut-bacteria

The supernatants from the culture broth of MGB05 were mixed with equal volume of ethyl acetate in a separating funnel. The solvent layer was dried in vacuo while the remaining thin oily layer was weighed and dissolved in dimethyl sulfoxide (DMSO) to a final concentration of 2 mg/mL. 5 μl of the stock solution was used for evaluation of antimicrobial activity.

ACCEPTED MANUSCRIPT

Molecular characterization and analysis

Genomic DNA of the isolate MGB05 was isolated as per the standard method developed by Marmur (Marmur, 1961). Quality of the DNA was evaluated on 1.2% agarose gel. The 16S rRNA

PT

gene was amplified using universal primer 8F (5′AGAGTTTGATCCTGGCTCAG3′) and 1492R (5′ATGGGYTACCTTGTTACGACTT3′). Polymerase chain reaction (PCR) was performed in a

RI

Veriti 96 well Thermocycler (Applied Biosystems). The reaction mixture (25 µL) contained 0.5 µL of

SC

each primers (10 mM), 0.125 µL Taq Polymerase (New England Biolabs; 5000 U/mL), 2.5 µL Standard Taq reaction buffer (10X), 0.5 µL dNTP (10 mM), 2 µL isolated DNA, and nuclease-free

NU

water until final volume reaches 25 µL. The PCR condition was programmed as follows: primary denaturation for 3 min at 94°C followed by 30 cycles of denaturation at 94°C for 30s; annealing at

MA

51°C for 1 min and extension at 72°C for 2 min. A final extension for 5 min at 72°C followed by an infinite hold at 4°C finished the run. After the run, 3 µL PCR product was profiled in 1.5% agarose

D

gel and visualized using Ethidium bromide in ultraviolet transilluminator (G:BOX, Syngene). The

PT E

PCR product was purified using QIAquick PCR purification kit (Qiagen) following manufacturer’s instructions. Forward and Reverse DNA sequencing reaction of PCR amplicon was carried out on 3730xl Genetic Analyzer (Thermo Fisher Scientific) using BDT v3.1 Cycle sequencing kit. The data

CE

of 16S rRNA gene sequences were compared with the database at GenBank using BLAST-N search

AC

program in National Center Biotechnology Information (http: //www.ncbi.nlm. nih.gov). The evolutionary history was inferred using the Neighbor-Joining method (Saitou and Nei, 1987). The percentage of replicate trees in which the associated taxa clustered together in 1000 bootstraps. The evolutionary distances were computed using the Kimura 2-parameter method (Kimura, 1980) and are in the units of the number of base substitutions per site. All positions containing gaps and missing data were eliminated. Evolutionary analyses were conducted in MEGA6 (Tamura et al., 2013). The gene sequence identified was submitted to NCBI GenBank and given an accession number. Production of cellulolytic enzyme on submerged (SmF) fermentation using strain MGB05

ACCEPTED MANUSCRIPT The effect of initial pH and incubation temperature on cellulase production by MGB05 was determined by cultivating the strain in modified Mandels and Reese medium containing 20 g/L of microcrystalline cellulose at pH range 4.0 to 9.0. The culture temperature was set at 25, 30 and 35°C for 72 hours at 150 rpm. The FPase and β-glucosidase assay were carried out as mentioned earlier. Effect of carbon source on enzyme production was checked by shake-flask culture using 20 g/L of

PT

CMC, crystalline cellulose, wheat bran, Whatman No. 1 filter paper and un-delignified sugarcane bagasse. CMC and crystalline cellulose were procured from Himedia Ltd., Mumbai and the wheat

RI

bran was purchased from a local mill. Sugarcane bagasse after collection from local vendor was

SC

washed, dried and then milled to 40 mesh size to be used in enzyme production media. The culture flasks maintained in triplicates contained 100 mL of basal salt solution and bacterial inoculum of 106

NU

cells/mL. Enzyme assays were conducted up to 8th days at an interval of 24 hours to check the optimum incubation duration. Furthermore, the effect of different concentrations of the optimal

MA

carbon source (10–50 g/L) with an interval of 10 g/L was examined.

D

Effect of buffer pH and incubation temperature on Cellulase activity and stability

PT E

The optimum pH of crude enzyme preparation was measured using different buffers (50 mM acetate buffer for pH 3.0 to 5.0, 50 mM phosphate buffer for pH 6.0 to 8.0 and 50 mM Tris-HCl buffer for pH 9.0) at 50°C. Determination of the pH stability was carried out as per Dong et al.,

CE

(2010). For this, the crude enzyme extract was pre-incubated in buffer solutions of different pH (1:9,

AC

v/v) for 4 hours at 4°C. Relative activity was expressed as the percentage of enzyme activity observed after incubation with substrate as compared to the maximum activity observed at each pH. The optimum temperature for enzyme extract was determined by incubating the reaction mixture at temperature range 30 to 90°C in 50 mM phosphate buffer (pH 5.0) in hot water bath (Wise Bath, Fuzzy Control System). Thermal stability was assayed by incubating the crude enzyme at different temperatures (30 to 80°C) for 1 hour and was expressed as the measure of percent residual activity as compared to maximum observed activity at respective temperature. Effects of ions on FPase activity

ACCEPTED MANUSCRIPT The effect of various metal ions on cellulase activity was investigated by adding additives to 0.5 mL of crude enzyme preparation. The additives (NaCl, KCl, MgCl2, FeSO4, CaCl2 and ZnCl2) were used at final concentration of 5.0 mM. The reaction mixtures were incubated with the additives for 60 min at 37°C at pH 5.0. Residual cellulase activity was measured and calculated as relative (%) value to control tube without any metal ion.

PT

Statistical analysis

SC

RI

All assays were performed in triplicate. Results are expressed as Mean ± SD of three replicates.

Results and Discussion

NU

Isolation and screening of cellulolytic gut bacterial population

MA

A total of 60 cellulose hydrolyzing aerobic bacteria were distinct on Czapek’s medium. Based on their ability to form clear zones with congo red (Fig. 1), 10 isolates were considered for further

D

studies.

PT E

Congo red shows a strong interaction with polysaccharides and is potentially advantageous in characterizing cellulolytic microorganisms. However, the correlation between the diameter of

CE

hydrolyzing zone and log of enzyme concentration does not hold well in representing the enzyme producing ability of a microorganism (Teather and Wood, 1982). Congo red is reliable in detecting

AC

cellulase activity with isolated enzyme preparations (Meddeb-Mouelhi et al., 2014). Thus, in this study, although some bacterial isolates showed cellulase activity on congo red agar plate, they may not essentially represent high cellulase producers. Gram’s iodine, on the other hand is considered a superior test for a fast and easy detection of endoglucanase activity (Dashtban et al., 2010); however, may lead to the identification of false positive as reported by Meddeb-Mouelhi et al., (2014). Thus in this study, the bacterial isolates screened using congo red plate method were revaluated by Gram’s iodine.

ACCEPTED MANUSCRIPT

Morphological and Biochemical characterization:

The colony morphology of the cellulolytic bacteria on nutrient agar medium is as listed in Table 2. Six of the isolates had circular colonies, while four of the cellulolytic bacteria were irregular.

PT

Isolate MGB05 had pale yellowish pigmentation while five of the isolates had white pigmentation. Isolate MGB32 formed cream coloured colonies. Except for isolate MGB32, all the cellulolytic

RI

bacteria were gram positive. Isolate MGB07 and MGB33 were indole positive, while others showed

SC

no indole reaction. Strain MGB05 showed positive reaction to biochemical assay of methytl red, citrate utilization and gelatine liquefaction. Based on the biochemical characterization, MGB05 and

NU

MGB011 can be placed under the genus Bacillus.

Pigmentati on Gram strain Morpholog y Methyl red Indole Citrate utilization Catalase Urease Nitrate reductase Voges proskeur Gelatin liquefactio n H 2S production Amylase Lipase Cellulase

D

PT E

Margin

+

+

Ellipti c rod -

Short rod -

+

+

+

+ +

Short rod + -

-

MGB38 MGB42 Irregul ar Curled

Irregul ar Entire

Yellow

White +

+

+

+

-

Ellipti c rod + +

Short rod + -

Short rod + -

CE

Form

Bacterial isolates MGB01 MGB01 MGB03 MGB05 MGB07 MGB32 MGB33 MGB37 1 Circul Circul Irregula Circul Circul Irregul Circul Circul ar ar r ar ar ar ar ar Entire Entire Entire Entire Entire curled Entire Entire Pale Pale Yello White yellowi White Cream White White yellow w sh

Short rod + -

-

+

+

-

-

-

-

-

-

-

+ -

-

+ -

+ +

+ -

+ -

+ +

+

-

-

+

+

-

+

-

+

-

+

-

+

+

-

+

-

-

+

-

-

+

-

+

-

+

+

+

+

+

+

-

+

-

-

-

-

-

+

+

-

-

+

1.14 1.05 -

1.76 -

1.4 1.43 2.51

1.4 -

1.2 1.33 2.37

1.15

1.28 1.27

1.46 -

1.6 1.33 2.3

1 2.1

AC

Features

MA

Table 2. Colony morphology and biochemical characteristics of the gut derived Cellulolytic bacteria

Oval

Coccus

Coccus -

ACCEPTED MANUSCRIPT Pectinase 1.17 2.4 Xylanase 1.75 Arginin Ornithine Identificati Bacillus on sp. *Positive activity: ‘+’, Negative activity: ‘-’

2.4 -

1.4 + Bacill us sp.

+

1.66 +

1.8 1.33 + -

+ -

1.5 1.22 +

Betaglucosidase catalyzes the release of methylumbelliferyl (MU) from MUG, and results in

PT

fluorescence under UV light. The ten bacterial isolates screened in the previous step were grown in MUG media. After incubation, it was observed that, isolate MGB05 and MGB38 showed bright

RI

fluorescence, MGB05 being the brightest (Fig. 2). The rest of the strains did not show any

SC

fluorescence.

NU

Assay of cellulase activity

Among the 10 isolates grown on Mandels and Reese medium containing cellulose powder, strain

MA

MGB03, MGB05, MGB38 and MGB42 showed high CMCase activity. MGB05 showed maximum CMCase activity (0.262 U/mL) after 72 hours of incubation under submerged condition (Table 3).

D

FPase and β-glucosidase (BGL) activity of MGB05 was recorded to be 0.012 U/mL and 3.71 U/mL

PT E

respectively, while that of the strain MGB38 was 0.008 and 1.88 U/mL. MGB03 did not show any detectable activity in this media. Bacillus is one of the common commensal species in insect guts and

CE

can survive the high temperature and pH of lepidopteran gut environment (Bashir et al., 2013). Table 3. Cellulase activity of gut bacterial isolates

RCAI (cm)

AC

Bacterial strain MGB01 MGB03 MGB05 MGB07 MGB011 MGB32 MGB33 MGB37 MGB38 MGB42

1.021±0.23 2.11±0.15 2.6±0.45 1.31±0.25 1.342±0.13 2.175±0.11 1.87±0.10 1.33±0.30 2.56±0.08 2.131±0.17

RCAI: Relative cellulolytic activity index

CMCase Activity (U/mL) 0.130 0.237 0.262 0.035 0.078 0.205 0.175 0.062 0.225 0.209

FPase (U/mL)

BGL (U/mL)

0.012 0.010 0.008 -

3.71 1.88 -

ACCEPTED MANUSCRIPT

Antimicrobial activity of gut isolated bacteria

Gut symbionts along with secreting blends of digestive and nutritionally important enzymes also produce bioactive compounds that protect the host insect from parasitism and pathogens. In order to

PT

determine if the cellulolytic bacteria also posess antimicrobial activity, an in vitro antimicrobial bioassay of the 10 cellulolytic gut-bacteria was carried out by agar well diffusion method. Four of the

RI

isolates had an antagonistic property against at least one of the entomo-pathogens tested (Table 4).

SC

Among them MGB07 produced inhibition zone against P. aeruginosa, while, strain MGB05 and MGB32 produced inhibition zone against both E. coli (2.9 cm) and P. aeruginosa (3.0 cm) (Fig.3).

NU

Isolate MGB38 showed inhibition zone against E .coli only. The gut bacterial strains did not show antagonistic activity against one another. Gut symbionts offers multilateral resistance for the host

MA

organism against various pathogens. Bacillus species are good producers of polypeptide antibiotics and are effective against gram positive and gram negative bacteria as well as fungi (Yilmaz et al.,

D

2006). Greater diversity in gut bacterial communities offers greater degree of protection compared to

AC

Isolate No

CE

PT E

a single resident species (Dillon et al., 2005).

MGB01 MGB03 MGB05 MGB07 MGB11 MGB32 MGB33 MGB37 MGB38 MGB42

Table 4. Antimicrobial Activity assay

E. coli

Inhibition Zone Diameter (cm) B. subtilis

2.9 1.7 1.2 -

-

P. aeruginosa 3.0 2.1 1.9 -

ACCEPTED MANUSCRIPT 16S rRNA gene amplification, sequencing and Bioinformatics analysis of MGB05 MGB05 among the other isolates showed higher cellulase activity and deterred growth of silkworm pathogens Escherichia coli and Pseudomonas aeroginosa. DNA fragments containing partial 16S rRNA gene of isolate MGB05 were amplified and sequenced. The forward and reverse sequences were assembled using the online CAP3 program (Huang and Madan, 1999) to form a

PT

contiguous sequence. The sequence was submitted to the NCBI database and obtained accession number KP298708.2. To identify it, the contiguous sequence was compared to sequences in NCBI-

RI

GenBank database. MGB05 showed maximum identity (99%) to Bacillus pumilus strain BD05

SC

(Accession id KY063594.1). The biochemical properties as listed in Table 2, as well as the cultural features of MGB05 are characteristic to Bacillus species. The phylogenetic analysis result using

NU

nucleotide sequence of known microorganisms is shown in Fig. 4.

Bacillus is one of the most dominant species in healthy Antheraea assamensis Helfer gut as well

MA

as those of Bombyx mori L (Haloi et al., 2016). Bacillus pumilus prevail as endophytes of plants and in soil as well. Bacillus pumillus KC434963 has been reported as potential cellulolytic flora of termite

D

gut (Bashir et al., 2013). Cotton leaf hopper gut isolated Bacillus pumilus showed various enzyme

PT E

activities like cellulase, pectinase, amylase and protease. The strain effectively inhibited entomopathogens of leaf hopper (Sivakumar et al., 2017). Bacillus pumilus FJ584416 showed

CE

inhibition against the virulence factors of P. aeruginosa PAO1 (las, rhl) (Nithya and Pandian, 2010). In their study, they found that Bacillus pumilus produced certain anti-quoram sensing protein

AC

molecule having acylase activity, thereby inhibiting P. aeruginosa. Bacillus pumilus produces 4phenylbutanoic acid a broad spectrum anti-biofilm compound that effectively inhibits P. aeruginosa as well as E. coli (Nithya et al., 2011). The possibility of Bacillus pumillus to be used as probiotic has been put forwarded by Subramanian et al. (2009). This is the first report of Bacillus pumilus as a beneficial muga silkworm gut microflora. In reference to the enzymatic activity and antimicrobial activity, the gut isolated Bacillus pumillus is a potential candidate for probiotic formulation, which might prevent disease and enhance productivity of this outdoor reared sericigeneous species.

ACCEPTED MANUSCRIPT

Effect of media pH, incubation temperature on cellulase production The strain MGB05 with high CMCase activity was assayed for FPase and β- glucosidase activity. In order to optimize the production of cellulase, various important parameters governing the enzyme production were studied. Growth temperature and media pH are important parameters for optimal

PT

enzyme productivity. The pH of the culture media is vital for enzyme secretion as well as enzyme stability. The media pH optimum for FPase and β-glucosidase production was 7.0 and 5.0 respectively

RI

(Fig. 5). Temperature is another important physical parameter for the growth and production of

SC

metabolites by microorganisms. The optimum temperature for enzyme production was 35°C for both FPase and BGL production (Fig. 6).

NU

There have been diverse reports on the optimal media pH and temperature for cellulolytic enzyme production by Bacillus pumilus. Highest CMCase production by Bacillus pumillus ATCC7061 was

MA

achieved at temperature 30°C and pH 10.0 when grown on Ficus nitida wastes (Gomaa et al., 2013). Cellulase produced in 2L stirred tank reactor using B. pumilus EB3 at temperature 37°C and pH 7.0

D

gave maximum activities of 0.011, 0.079 and 0.038 U/mL respectively for FPase, CMCase and β-

PT E

glucosidase (Ariffin et al., 2006). In another study by Ariffin et al., (2008) endoglucanase production by B. pumilus was optimum at 37°C, initial pH 7.0 with 10 g/L of pretreated Oil Palm Empty Fruit

CE

Bunch as carbon source. Proteus mirabilis produced maximum β-glucosidase (14.58 U/mL) at pH 9.0 and temperature 37°C (Mahapatra et al., 2016).

AC

FPase activity is an important criterion to determine the efficiency of cellulase enzyme complex and requires the concerted action of endo, exo and β-glucosidase action and hence is regarded as the total cellulase activity. Betaglucosidase catalyses the final step of cellulose hydrolysis by breaking the β- (1–4) linkage of cellobiose to yield glucose. Betaglucosidase is produced by all cellulolytic organisms albeit in low or high titre. It is an important component for industrial application of cellulase.

ACCEPTED MANUSCRIPT

Effect of Carbon source and incubation duration on Enzyme production Cellulases are inducible enzymes and are under the precise control of activation and repression mechanisms depending upon the availability of substrate in the vicinity. One of the aims in our study was also to check the cellulase producing ability of the gut isolated bacteria. Various commercially

PT

available carbon sources along with agricultural by-products were tested for their ability to induce cellulase production in submerged fermentation. Wheat bran proved to be the best among all carbon

RI

sources used in the study with highest FPase activity at all incubation durations. Maximum activity

SC

(0.022 U/mL) was observed on the 3rd day of incubation at 150 rpm at temperature 35°C. Wheat bran induced 1.15 fold more FPase than observed with basal salt containing CMC-Na. (Fig. 7). Liang et

NU

al., reported basal cellulase activity of Brevibacillus sp. JXL crude culture supernatant as FPU 0.02U/mL (Liang et al., 2009). As compared to fungal cellulase, aerobic bacteria produce lower levels

MA

of FPase, and beta-glucosidase (Liang et al., 2014). Maximum FPase activity shown by Brevibacillus sp.DUSELG12 and Geobacillus sp. DUSELR7 were found to be 0.027 and 0.043U/mL respectively

D

(Rastogi et al., 2009).

PT E

In this study, we prospected another low cost, abundantly available biomass sugarcane baggase. The enzyme production using baggase was delayed and also the enzyme titre was low. Towards the

CE

4th day, FPase activity starts increasing, however the yield was low as compared to CMC, wheat bran and crystalline cellulose. This might be due to the presence of a lignin seal and a crystalline region

AC

that prevents access to the carbohydrate polymer. A similar trend has been observed in the case of Whatman filter paper fed culture flasks. Raw materials for enzyme production contribute as high as 40-60% of the total cost. Thus prospecting a cheap and easily available carbon source is very much desirable for potential industrial application. Wheat bran is cheaply available and is an excellent inducer for cellulase production. Wheat bran induced the maximum production of cellulases 2.62 IU/mL (0.20 FPase, 1.20 CMCase, 1.30 β-glucosidase) in Bacillus subtilis (Sanjeev Kumar et al., 2017). The high soluble cello-oligosaccharides content of wheat bran can induce higher levels of cellulase production during shorter fermentation time (Sun et al., 2008).

ACCEPTED MANUSCRIPT β-glucosidase production was highest with wheat bran as the carbon source and maximum activity was observed at 48 hours (20.03 U/mL) with media pH 5.0 (Fig. 8). With CMC in the media, BGL production gradually increased towards the 8th day. However, BGL production decreased from the 8th day in wheat bran containing media. Proteus mirabilis VIT117 produced maximum BGL (14.58 U/mL) at approximately 3 days incubation at temperature 37°C (Mahapatra et al., 2016). In our study,

PT

the optimal concentration of wheat bran was found to be 50 g/L for FPase as well for BGL production (Fig. 9). As per Singh et al., wheat bran concentration 400 g/L gave maximum CMCase activity using

RI

Bacillus sp. JS14 (Singh et al., 2012). Sharma et al., (2015) reported about the antimicrobial activity

SC

of biosurfactant obtained from Bacilus pumilus DSPV18 against some pathogenic bacteria.

NU

Effect of pH, temperature, metal ions on cellulase activity

The optimum pH and temperature of Bacillus pumilus MGB05 FPase activity were found to be

MA

6.0 and 50°C. FPase activity was comparatively active in the pH range 6.0-8.0 (Fig. 10). Enzyme stability is an important criterion for the economy and industrial application of enzymes. The enzyme

D

was stable between temperatures 30 to 50°C (Fig. 11). Beyond 50°C, the FPase activity started to

PT E

decline. While assaying thermal stability, pre-incubation at 60°C retained 69% of FPase activity. Beyond this temperature, the enzyme activity declined drastically and complete inactivation of

CE

enzyme was observed when heated at 80°C. Maximum BGL activity was observed at buffer pH 6.0 at 50°C (Fig. 12). BGL was stable within pH range 5.0-7.0. BGL activity of the crude extract was stable

AC

within 30-50°C (Fig. 13).

Effect of metal ions on total cellulase activity The additives, Mg2+ and Ca2+ enhanced FPase activity (Fig. 14). Addition of Mg2+ ion increased up to 110.92% (0.026 U/mL), while, Ca2+ increased up to 105.31% (0.025 U/mL) of FPase activity (Table 5). Na+, K+, Fe2+ and Zn2+ had negative effect of cellulase activity. Stimulatory effect of Mg2+ and Ca2+ on cellulase were also reported by Yoon et al. (1994) and Bakare et al. (2005). Fe2+ reduced FPase activity by 33.4%. Negative effect of Fe2+ on cellulase were also

ACCEPTED MANUSCRIPT reported by Yin et al., (2010). The production of cellulase was enhanced by the addition of NaCl and MgSO4 while EDTA reduced the production (Singh et al., 2012).

Table 5. Effect of various additives on FPase activity Residual activity (%)

Na+

63.20±1.91

K+

64.37±0.74

Mg2+

110.92±1.11

Fe2+

66.60±0.86

Ca2+

105.31±1.52

Zn2+

70.62±1.67

SC

RI

PT

Metal ions

NU

Conclusion

Insect gut harbour many novel microorganisms and there exist complex symbiotic interactions

MA

between them. Whilst the diversity of beneficial gut microflora play role in carbohydrate degradation, nutrient accessibility and uptake, they also provide opportunity for the discovery of novel bio-active

D

compounds as well as digestive enzymes of biotechnological value. With reference to cellulolytic and

PT E

anti-microbial activity, B. pumillus MGB05 might be a potential component for probiotic formulation. However, this study is prefatory to understanding the complex interaction of gut flora with the well being of the host insect. Even though the complete picture of beneficial gut microflora is vague owing

CE

to the unculturability of most symbionts, advances in genomic tools will lead the way to understand

AC

the underpinning host-symbiont ecology. Deeper insights into the tri-trophic interaction of plant, insect and bacteria will provide valuable information to devise eco-friendly pest and disease management protocols to improve silk productivity.

Acknowledgement We are grateful to the Director, CMER&TI, Central Silk Board, Lahdoigarh, Jorhat, Assam (India) for providing the necessary facilities and Department of Biotechnology, Govt. of India, New Delhi (India) for providing the fund to conduct the work.

ACCEPTED MANUSCRIPT Figure legends

Fig. 1 Morphological characterization and screening of cellulolytic bacteria. Isolate MGB05, MGB42 and MGB01 after gram staining (A, B, C); MGB05 forming clear zone with congo red media and with iodine (D & E)

PT

Fig. 2 Qualitative assay for Beta-glucosidase activity. The Gut isolated bacteria were streaked on to Czapek’s medium containing MUG. (A) Uninnoculated control, (B) MGB03 & MGB05, (C)

RI

MGB38 & MGB42

SC

Fig. 3 Antimicrobial activity of the crude bioactive compound extracted from MGB-05 against Escherichia coli (A) and Pseudomonas aeroginosa (B) with reference to control well (left

NU

well of each plate)

Fig. 4 Phylogenetic dendrogram for Bacillus pumillus MGB05 and related strains based on its 16s

MA

rDNA sequence

Fig. 5 Effect of initial media pH (4.0-9.0) on FPase and BGL activity of Bacillus pumilus MGB05

D

Fig. 6 Effect of incubation temperature (25-40ºC) on FPase and BGL production of Bacillus pumilus

PT E

MGB05

Fig. 7 Relative FPase activity of Bacillus pumilus MGB05 in five different carbon sources

CE

Fig. 8 Relative BGL activity of Bacillus pumilus MGB05 in five different carbon sources Fig. 9 Effect of wheat bran concentration (10-60 g/L) on FPase and BGL activity of Bacillus pumilus

AC

MGB05

Fig. 10 Optimization and pH stability in relative FPase activity of B. pumilus MGB05 in different buffer solution of

Fig. 11 Optimization and thermal stability in relative FPase activity of B. pumilus MGB05 at different reaction temperature Fig. 12 Optimization and pH stability in relative BGL activity of B. pumilus MGB05 in different buffer solution

ACCEPTED MANUSCRIPT Fig. 13 Optimization and thermal stability in relative BGL activity of B. pumilus MGB05 at different reaction temperature

AC

CE

PT E

D

MA

NU

SC

RI

PT

Fig. 14 Effect of different metal ions on FPase activity of Bacillus pumilus MGB05.

ACCEPTED MANUSCRIPT References Ariffin, H., Abdullah, N., Umi Kalsom, M. S., Shirai, Y., & Hassan, M. A., 2006. Production and characterization of cellulase by Bacillus pumilus EB3. Int. J. Eng. Technol. 3(1), 47-53. Ariffin, H., Hassan, M. A., Shah, U. K. M., Abdullah, N., Ghazali, F. M., & Shirai, Y., 2008. Production of bacterial endoglucanase from pretreated oil palm empty fruit bunch by Bacillus

PT

pumilus EB3. Journal of bioscience and bioengineering. 106(3), 231-236.

RI

Bakare, M. K., Adewale, I. O., Ajayi, A., & Shonukan, O. O., 2005. Purification and characterization of cellulase from the wild-type and two improved mutants of Pseudomonas fluorescens. African

SC

Journal of Biotechnology. 4(9), 898–904.

NU

Bashir, Z., Kondapalli, V. K., Adlakha, N., Sharma, A., Bhatnagar, R. K., Chandel, G., & Yazdani, S. S., 2013. Diversity and functional significance of cellulolytic microbes living in termite, pill-bug

MA

and stem-borer guts. Scientific reports. 3, 2558.

Bashir, Z., Kondapalli, V. K., Adlakha, N., Sharma, A., Bhatnagar, R. K., Chandel, G., & Yazdani, S. S., 2013. Diversity and functional significance of cellulolytic microbes living in termite, pill-bug

PT E

D

and stem-borer guts. Scientific reports. 3, 2558. Dashtban, M., Maki, M., Leung, K. T., Mao, C., & Qin, W., 2010. Cellulase activities in biomass conversion: measurement methods and comparison. Critical reviews in biotechnology. 30(4), 302-

CE

309.

Dillon, R. J., & Dillon, V. M., 2004. The gut bacteria of insects: non-pathogenic interactions. Annual

AC

Reviews in Entomology. 49(1), 71-92. Dillon, R. J., Vennard, C. T., Buckling, A., & Charnley, A. K., 2005. Diversity of locust gut bacteria protects against pathogen invasion. Ecology Letters. 8(12), 1291-1298. Dong, J., Hong, Y., Shao, Z., & Liu, Z., 2010. Molecular cloning, purification, and characterization of a novel, acidic, pH-stable endoglucanase from Martelella mediterranea. J. Microbiol. 48, 393398. Eveleigh, D. E., Mandels, M., Andreotti, R., & Roche, C., 2009. Measurement of saccharifying cellulase. Biotechnology for Biofuels. 2(1), 21.

ACCEPTED MANUSCRIPT Gadgil, N. J., Daginawala, H. F., Chakrabarti, T., & Khanna, P., 1995. Enhanced cellulase production by a mutant of Trichoderma reesei. Enzyme and Microbial Technology. 17(10), 942-946. Gandotra, S., Bhuyan, P. M., Gogoi, D. K., Kumar, A., & Subramanian, S., 2016. Screening of Nutritionally Important Gut Bacteria from the Lepidopteran Insects. Through Qualitative Enzyme Assays. Proceedings of the National Academy of Sciences, India Section B: Biological Sciences.

PT

1-9. Gomaa, E. Z., 2013. Optimization and characterization of alkaline protease and carboxymethyl-

RI

cellulase produced by Bacillus pumillus grown on Ficus nitida wastes. Brazilian Journal of

SC

Microbiology. 44(2), 529-537.

Goyari, S., Devi, S. S., Kalita, M. C., & Talukdar, N. C., 2014. Population, diversity and

NU

characteristics of cellulolytic microorganisms from the Indo-Burma Biodiversity hotspot. Springer Plus. 3, 700. https://doi.org/10.1186/2193-1801-3-700.

MA

Haloi, K., Kalita, M. K., Nath, R., & Devi, D., 2016. Characterization and pathogenicity assessment of gut-associated microbes of muga silkworm Antheraea assamensis Helfer (Lepidoptera:

D

Saturniidae). Journal of invertebrate pathology. 138, 73-85.

PT E

Holt, J. G., Krieg, N. R., Sneath, P. H. A., Staley, J. T., & Williams, S. T., 1994. Bergey’s Manual of Determinative Bacteriology (9th edn.), Baltimore, Philadelphia, Hong Kong.

868-877.

CE

Huang, X., & Madan, A., 1999. CAP3: A DNA sequence assembly program. Genome research, 9(9).

AC

Kasana, R. C., Salwan, R., Dhar, H., Dutt, S., & Gulati, A., 2008. A rapid and easy method for the detection of microbial cellulases on agar plates using Gram’s iodine. Current microbiology. 57(5), 503-507.

Khyade, V. B., & Marathe, R. M., 2012. Diversity of Bacterial flora in the mid gut of fifth instar larvae of silkworm, Bombyx mori (L)(Race: PM x CSR2). Global Journal of Bio–Science and Biotechnology, 1(2). 191-200. Kimura, M., 1980. A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution. 16, 111-120.

ACCEPTED MANUSCRIPT Kumar, S., Sharma, N., & Pathania, S., 2017. Cost effective production of cellulase using wheat bran from Bacillus subtilis BM1 and encoding endo-beta-1,4-glucanase producing gene. Res. Environ. Life Sci. 10(6), 507-512. Legay, J. M., 1958. Recent advances in silkworm nutrition. Annual Review of Entomology. 3(1), 7586.

PT

Liang, Y. L., Zhang, Z., Wu, M., Wu, Y., & Feng, J. X., 2014. Isolation, screening, and identification of cellulolytic bacteria from natural reserves in the subtropical region of China and optimization

RI

of cellulase production by Paenibacillus terrae ME27-1. BioMed research international.

SC

Liang, Y., Yesuf, J., Schmitt, S., Bender, K., & Bozzola, J., 2009. Study of cellulases from a newly isolated thermophilic and cellulolytic Brevibacillus sp. strain JXL. Journal of industrial

NU

microbiology & biotechnology. 36(7), 961-970.

Mahapatra, S., Vickram, A. S., Sridharan, T. B., Parameswari, R., & Pathy, M. R., 2016. Screening,

MA

production, optimization and characterization of β-glucosidase using microbes from shellfish waste. 3 Biotech. 6(2), 213.

D

Mandels, M., & Reese, E. T., 1957. Induction of cellulase in Trichoderma viride as influenced by

PT E

carbon sources and metals. Journal of Bacteriology. 73(2), 269. Marmur, J., 1961. A procedure for the isolation of deoxyribonucleic acid from micro-organisms. J. Mol. Biol. 3, 208-218.

CE

Meddeb-Mouelhi, F., Moisan, J. K., & Beauregard, M., 2014. A comparison of plate assay methods

16-19.

AC

for detecting extracellular cellulase and xylanase activity. Enzyme and microbial technology. 66,

Morrison, M., Pope, P. B., Denman, S. E., & McSweeney, C. S., 2009. Plant biomass degradation by gut microbiomes: more of the same or something new?. Current Opinion in Biotechnology. 20(3), 358-363. Nithya, C., & Pandian, S. K., 2010. Bacillus pumilus of Palk Bay origin inhibits quorum-sensingmediated virulence factors in Gram-negative bacteria. Research in microbiology. 161(4), 293-304.

ACCEPTED MANUSCRIPT Nithya, C., Devi, M. G., & Karutha Pandian, S., 2011. A novel compound from the marine bacterium Bacillus pumilus S6-15 inhibits biofilm formation in Gram-positive and Gram-negative species Biofouling. 27(5), 519-528. Parry, N. J., Beever, D. E., Owen, E., Vandenberghe, I., Van Beeumen, J., & Bhat, M. K., 2001. Biochemical characterization and mechanism of action of a thermostable beta-glucosidase

PT

purified from Thermoascus aurantiacus. Biochemical Journal. 353 (Pt 1), 117. Perez, C., Pauli, M., & Bazerque, P., 1990. An antibiotic assay by the agar well diffusion method.

RI

Acta Biol Med Exp. 15(1), 113-5.

SC

Rastogi, G., Muppidi, G. L., Gurram, R. N., Adhikari, A., Bischoff, K. M., Hughes, S. R., & Sani, R. K., 2009. Isolation and characterization of cellulose-degrading bacteria from the deep subsurface

NU

of the Homestake gold mine, Lead, South Dakota, USA. Journal of industrial microbiology & biotechnology. 36(4), 585.

MA

Saitou, N., & Nei, M., 1987. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution. 4, 406-425.

D

Sharma, D., Ansari, Javed M., Gupta, S., Ghamdi, Al A., Pruthi, P., & Pruthi, V., 2015. Structural

PT E

Characterization and Antimicrobial Activity of a Biosurfactant Obtained From Bacillus pumilus DSVP18 Grown on Potato Peels. Jundishapur J Microbiol. 8(9): e21257 Singh, J., & Kaur, P., 2012. Optimization of process parameters for cellulase production from

CE

Bacillus sp. JS14 in solid substrate fermentation using response surface methodology. Brazilian

AC

Archives of Biology and Technology. 55(4), 505-512. Sivakumar, G., Rangeshwaran, R., Yandigeri, M. S., Mohan, M., Venkatesan, T., Ballal, C. R., & Verghese, A., 2017. Characterization and role of gut bacterium Bacillus pumilus on nutrition and defense of leafhopper (Amrasca biguttula biguttula) of cotton. Indian Journal of Agricultural Sciences. 87(4), 534-9. Subramanian, S., Gadhave, K.R., Mohanraj, P., Thangamalar, A., 2009. Use of 16S rRNA probes for characterization of gut microflora of silkworm (Bombyx mori L.) breeds. Karnataka J Agric Sci. 22, 476–478.

ACCEPTED MANUSCRIPT Sun, X., Liu, Z., Qu, Y., & Li, X., 2008. The effects of wheat bran composition on the production of biomass-hydrolyzing enzymes

by

Penicillium decumbens.

Applied

Biochemistry and

Biotechnology. 146(1-3), 119-128. Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S., 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution. 30, 2725-2729.

PT

Teather, R. M., & Wood, P. J., 1982. Use of Congo red-polysaccharide interactions in enumeration and characterization of cellulolytic bacteria from the bovine rumen. Applied and environmental

RI

microbiology. 43(4), 777-780.

SC

Yilmaz, M., Soran, H., & Beyatli, Y., 2006. Antimicrobial activities of some Bacillus spp. strains isolated from the soil. Microbiological Research. 161(2), 127-131.

NU

Yin, L. J., Lin, H. H., & Xiao, Z. R., 2010. Purification and characterization of a cellulase from Bacillus subtilis YJ1. Journal of Marine Science and Technology. 18(3), 466-471.

MA

Yoon, S., Kim, M. K., Hong, J. S., & Kim, M. S., 1994. Production of polygalacturonase from

AC

CE

PT E

D

Ganoderma lucidum. The Korean Journal of Mycology. 22(4), 286-297.

ACCEPTED MANUSCRIPT

Highlights:  

AC

CE

PT E

D

MA

NU

SC

RI

PT



Bacillus pumilus MGB05 bacterial isolates collected from Muga silkworm gut. Posses cellulolytic activity and antimicrobial activity against silkworm pathogens Potential candidate for bio-formulation

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14