Optimization of PCR performance

DECHNICALBIPS Optimization of PCRperformance The polymerase chain reaction (PCR) is often used under conditions where target DNA is plentiful, but problems can arise where there is a limitingly low number of target sequences, so much so that these two applications of PCR may be regarded as two essentially different techniques. We have used PCR to amplify sequences from very low copy number template DNA, using three different sets of oligonudeotide primers (see Fig. 1) and found that the results can be greatly enhanced by following some simple rules. We found that the following procedures reproducibly allow a 'high performance PCR', that is, a PCR where the critical parameter of a linear correspondence between the amounts of target sequence and of the amplification product is satisfied (over a range of log dilutions from 1 to 104 copies).

(1) Set up an annealing temperature to prevent dimerization The presence of dimerization products is often sufficient to jeopardize a result where target is scarceL This is due not ordy to competition for reaction components, but also to unproductive annealing of dimers to target sequences in competition with the primers - we call this the 'kamikaze effect'. The theoretical annealing temperatures commonly used -~.3are generally below the permissive temperature for dimerization, and primers are also able to dimerize due to the terminal transferase activity of Taq polymerase. Optimal annealing temperaNumber of target copies tures car be determined by testing different temperature points in the absence of target, using 2-3°C steps around the theoretical Tin, and choosing the lowest temperature at which no visible dimerization product is made. t,.,..* t,....~ r..,4 ~..~ ~ t.....0 t....t t...q t,....~ ~ t.-~ t......a t....~ ~ t....q ~ (2) Optimize the tbermocouple tube with glycerol Reproducibility and speed of temperature changes are important variables whose reciprocal influence can be hard to control. Fast-ramping thermal block instruments equipped with a tube-based thermal detector are designed to be highly efficient, but preventing thermal variations from tube to tube is absolutely critical. Significant temperature differences between the tube carrying the thermocouple and the reaction tubes, arising from the escape of evaporated buffer and oil via the sheath of the thermocouple wire, can occur even during the course of a single PCR experiment. Evaporation can be prevented by using 100 lxl of glycerol in the thermocouple tube instead of buffer overlaid with oil. (3) Optimize thermal exchange Highly efficient 0.5 ml thin-wall reaction tubes must be preheated empty at 94°C for 1-2 rain in the thermal block, to prevent non-elastic deformations that can interfete with contacts between the surfaces of the tubes and the wells after the first cycles of PCR. Efficient contact can be encouraged by prefilling the wells with 50 tal of glycerol, which gives better results than the commonly suggested coating of silicon grease.

(4) Add the Taq polymerase at 94°C and mix thoroughly Spurious products (dimer and others) are avoided by adding the enzyme at high temperatures, at which nonspecific priming is abolished 4. On adding the enzyme it is essential to distribute it evenly. This ca'nnot easily be achieved using application devices such as AmpliWax beads (Perkin Elmer Cetus). We add the enzyme to each tube directly, underneath the oil layer, after complete denaturation of the template, and while the reaction is still at 94°C. Addition before oil, as suggested in some protocol#, risks evaporation and uncontrolled temperature decreases. In any case, it is absolutely crucial, although not rigorously prescribed by current manuals, to mix the enzyme immediately. This is best done by thoroughly swirling with the same pipette tip with which it was added. To demonstrate the importance of this simple manoeuvre, we carried out some mock experiments which were performed for only the first 8.-10 cycles, in which a coloured indi•cator (bromophenol blue) was added to the Taq polymerase solution. The tubes were removed from the

A.

t

ii,

r

B ,,,,o. -U

1

2

3

FIGlfll Result of the modifications described on the performance of three different applications of PCR (specific amplification products are indicated by arrows; dimerization products are indicated by horizontal lines; residual primers are indicated by asterisks). PCR 1, Phage ~,target DNA and primers are from Perkin Elmer Cetus, Primers are prone to dimerization; 30 cycles were performed; the amplification product is 500 bp. PCR 2. HIV target DNA (clone HIVZ6) and primers (SK38, SK39) are from Pod:in Elmer Cetus. Target DNA is mixed with a boiled extract of 4 x 10'i human lymphocytes; 40 cycles were performed; the amplification product is 115 bp. PCR 3. 'Anchored' PCR on HIV genome (clone ~,BH10). HIV DNA was tailed with polyG at the 3' end and amplified using one HIV-LTR primer, (GGCCTGGGCGGGACTGGGGAGTG), and the 'anchor' primers described by Loh et a/. ~ Briefly, synthesis on the polyG-tailed template was primed using the 'anchor'-polyC and 'anchor' primers (ratio 1 : 10) for 9 cycles; after denaturation, the HIV primer was added and a further 40 cycles were done. The amplification product is about 140 bp. Panels A and B show the results obtained using the following protocols. (A) Annealing temperatures were calculated theoreticallyZ (PCR 1, 52°C; PCR 2, 49°C; PCR 3, 35°C for the first 9 cycles, then 63°C for the subsequent 40 cycles). Tat/polymerase was added by pipetting underneath the oil at 9~°C with no swirling. Tubes were not preheated. Thermal contact was improved using silicon grease. (B) Annealing temperatures were experimentally determined, using the lowest temperature at which dimerization products were not visible (PCR 1, 65°C; PCR 2, 55°C; PCR 3, 45°C for the first 9 cycles, then 70°C for 40 cycles). Taq polymerase was mixed in by swirling the reaction ten times with a pipette tip. Tubes were preheated. Thermal con'tact was improved using 50 !11glycerol. The results shown are representative of at least 20 experiments for each protocol. Note the dimers in all lanes of 1A and in the last two lanes of 2A. Note also the erratic results seen in 3A, as compared with those in 3B.

TIG FEBRUARY1993 VOL. 9 NO. 2

B

BECHNICALBLIPS heating block and examined by eye after each cycle. These experiments showed that, if very careful mixing is not performed, the enzyme will remain confined to the bottom of the tube for the first 2-4 cycles. By following these procedures we have achieved 'high performance PCR', which was reproducibly applied to three different types of reaction: PCR on purified, target DNA with dimerization-prone primers, PCR on unpurified DNA, and single-side 'anchored' PCR. Representative results are shown in Fig. 1. In some experiments, only one of the modifications was applied; parameters such as the annealing temperature ~m,d the careful mixing of the enzyme critically affected the results, but remarkable variations in efficiency were also seen when the tube preheating or the use of glycerol as thermal contactor were omitted. ACKNOWLEDGEMENTS

This work was supported by IV Progetto AIDS, Istituto Superiore di Sanitit. REFERENCES

1 Saiki, R.K. (1989) in PCR Technology: Principles and Applications for DNA Amplification (Erlich, H.A., ed.), pp. 7-16, Stockton Press 2 Innis, M.A. and Gelfand, D.H. (1990) in PCR Protocols: A Guide to Methods and Applications (Innis, M.A., Gelfand, D.H., Sninsky, J.J. and White, T.J., eds), pp. 3-12, Academic Press 3 Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (Vol. 2), pp. 14.2-14.35, Cold Spring Harbor Laboratory Press 4 D'Aquila, R.T. et al. O991) Nucleic Acids Res. 19, 3749 5 Loh, E.Y. et al. (1989) Science 243, 217-220

Contributed by Maurizio Carbonari, Daniela Sbarigia, Marina Cibati and Massimo Fiorilli (to whom con'espondence should be addressed), Department of Clinical Immunology, University of Rome 'la Sapienza', 00185 Rome, Italy.

Rapid determination of sequences flanking microsatellites usi:tg dephosphorylated cloning vectors Determination of the sequences flanking microsatellites is the most laborious task in the development of this type of genetic marker. Two recent papers describe procedures that simplify the taskLZ. The basic principle is restriction enzyme digestion of the DNA (from a cosmid, 2Lclone or YAC) followed by ligation of the fragments to appropriate linkers. PCR is performed on the ligation products, using a primer to the microsatellite and a primcr to the linker to amplify the intervening sequence, which is then sequenced either directly 2 or after cloningL Linkers described in both papers were based on the principle outlined by Riley et ai.3 (marketed as the 'Vectorette' system, Cambridge Research Biochemicals, UK). Such linkers contain an unpaired region, allowing an amplification primer to be designed in such a way that linker-to-linker amplification is avoided in the PCR. Dephosphorylated cloning vectors (e.g. pUC18) can be used as a simpler and cheaper alternative to this system. The dephosphorylated 615 ends ensure specificity of the subsequent amplification. For example, 49? ' we ligated 50 ng of dephosphorylated Sinai cut pUC18 (Pharmacia, Sweden) to 5-20 ng of AIM or RsaI digested DNA from a X clone 369 which contains a (CA) n microsatellite, in a reaction volume of 25 I,ti. 246 1 ~tl of the ligation mix was used in an amplification reaction with a pUC primer, CGTFGTAAAACGACGGCCAGT, and a microsatellite 123 primer, bioGAGGGGAATrCAGCTGAT(CA) m (where bio is biotin-C6, Cambridge Research Biochemicals). The conditions were as follows: 0.1 IIM each primer, 1.5 mM MgCI2, 100 I.tMeach dNTP, 50 pl reaction volume. Taq polymerase (2.5 U) was added after an initial denaturation step at 97"C for 5 min, followed by 25 cycles of 59°C for 1 min, 74"C for 1 min and 940C for 1 min. Amplification products are shown in Fig. 1, lanes a and b. As has been noted previously l, there is smearing in the tracks which does not, however, affect the clarity of the sequencing results (Fig. 1, lanes c and d). In summary, direct detera t~ c d e ruination of sequences flanking microsatellites can be achieved simply by ligation of restricted DNA to dephosphorylated vectors prior to FIGlfll PCR, even from such complex targets as YACs (Fig. 1, lane e). Lanes a and b ~.how the electrophoresis products (3% agarosc gel) from PCR amplification of REFERENCES ligations of a ~, ~'kne contaieiv~ a (CA),, 1 Pandolfo, M. (1992) Nucleic Acids Res. 20, 1154 microsatellite, resmc.~ed with Ahd (a) and RsaI 2 Edwards, A.L., Civitello, A., Hammond, H.A. and Caskey, C.T. (1991) (b). The produc~.-; were sequenced directly Am.J. Hum. Genet. 49, 621--627 (shown in lanes c a~~::id). Lane e shows the PCR 3 Riley, J. et al. (1990) Nucleic Acids Res. 18, 2887-2890 products of a similar ,:xperiment using template Contributed by M. Santibdt~ez Koref, V. Orpbanos and J.M. Boyle, DNA from a 550 kb YAC and dephosphorylated CRC Department of Cancer Genetics, Paterson Institute for primers spe~'i~c for a previously identified microsatellite. Num~:e.rs on left denote fragment Cancer Research, Christie Hospital Wilmslow Road, Manchester, size in base pairs UK M20 9BX. TIG FEBRUARYlq93 VOL. 9 NO. 2

m