Optimization of Reverse Hybridization in Microplates Coated with rRNA Targeted Oligonucleotide Probes

System. Appl. Microbiol. 23, 573-581 (2000) © Urban & Fischer Verlag _htt~p_://w_w_w_.u_rba_n_fis_ch_er_.de--.:./j_ou_rn_als_/s_am_ _ _ _ _ _ _ _ _ _ _ _

SYSTEMATIC AND APPLIED MICROBIOLOGY

Optimization of Reverse Hybridization in Microplates Coated with rRNA Targeted Oligonucleotide Probes MATTHIAS SCHEDLI, THOMAS BEHR2, WOLFGANG LUDWIG 2, KARL HEINZ SCHLEIFER2, REINHARD NIESSNER 1 and DIETMAR KNOPP! I

Institut fur Wasserchemie, Technische Universitat Munchen, Munchen , Germany fur Mikrobiologie, Technische Universitat Munchen, Freising, Germany

2 Lehrstuhl

Received October 23, 2000

Summary Among the modern molecular techniques for the identification of microorganisms the most straightforward way is through direct hybridization with rRNA/rDNA targeted probes. In this study, the optimization of the experimental procedures for the reverse hybridization technique in 96-well microplates is described using both synthetic model oligonucleotides (18 b) and amplified DNA (app. 4500 bp). Three different types of plates were compared (Maxi Sorp, NucleoLink, CovaLink). Plates made from nonchemically modified polystyrene which are conventionally used in immunoassays (MaxiSorp) proved to be an economic alternative for plates offering chemically modified tailor-made surfaces. Phosphorylation of the oligonucleotide probe was not necessary for successful immobilization whereas with 5' -terminal hexa-deoxyadenosine tailed capture oligonucleotides an enhanced sensitivity of the assay was observed. Variation of the stringency by adjusting different concentrations of formamide during the washing step ensures high probe specificity and therefore allows reliable identification of the microorganisms. The assay can be performed in less than 4 hours using pre-coated plates which can be stored for several weeks. After dissociation of the target DNA/capture probe duplex with an alkaline denaturing solution rehybridization is possible. Key words: Reverse hybridization - Microplates - Oligonucleotides - Probes - Ribosomal RNA - Immobilization - Differential washing - Rehybridization

Introduction Among the modern molecular techniques for the detection and identification of microorganisms hybridization with rRNNrDNA targeted probes nowadays plays a central role (STAMS and ELFERINK, 1997; WALLNER et aI., 1996). The primary structures of rRNA genes comprise a mixture of evolutionary conserved to highly variable sequence stretches which provide diagnostic sites for higher and lower taxa above the species level (AMANN and LUDWIG, 1994; AMANN et aI., 1995). Comprehensive sequence data bases (MAIDAK et aI., 2000; VAN DE PEER et aI., 2000; LUDWIG and STRUNK, 1996) - now containing more than 22.000 entries - in combination with appropriate software such as the ARB package (LUDWIG and STRUNK, 1996) allow easy in silico design and evaluation of potential taxon specific probes against the background of the full data sets. However, the in silica as well as experimental specificity evaluations are limited by the

comprehensiveness of sequence databases and the availability of reference organisms, respectively. Given that potential probe target sites usually contain not more than one to a few diagnostic positions and only four character states (the nucleotides) are possible per position, there remains a certain likelihood of the occurrence of identical sites in phylogenetically diverse organisms. Consequently, there remains a certain risk of misidentification in case of any single probe. The multiple probe concept (LUDWIG et aI., 1998) which is based upon the simultaneous application of two or more probes of identical or hierarchical Abbreviations: CMCT - l-cyclohexyl-3-(2-(morpholino-ethyl)carbodiimide- metho-p-toluenesulphonate; DIG - digoxigenin; EDC - l-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride; Melm - I-methyl imidazole; MTP - microtiterplate; TMA - tetramethylammonium chloride 0723-2020/00/23/04-573 $ 15.00/0

574

M.

SCHEDL et

al.

specificities targeting independent sites or molecules helps to substantially reduce this risk. However, to follow the multiple probe concept for comprehensive identification of microorganisms in - with respect to phylogenetic or taxonomic diversity - complex samples large numbers of probes of different specificities have to be applied. Most of the commonly used hybridization techniques even the currently most attractive in situ cell hybridization method (AMANN et ai., 1995) do not allow to use or handle large numbers of probes in one experiment. The reverse hybridization methods, however, are excellent tools for the simultaneous application of comprehensive sets of probes. Furthermore, at least some variants of the technique can easily be automated. The current trends on this field clearly favor DNA chip technologies (HOHEISEL, 1997; BETTS 1999). However, thus far the expensive equipment needed for chip production, hybridization, hybrid detection and data analysis is still under development. Consequently, the DNA chip technology is not yet routinely in use for microbial identification. The experimental procedures for reverse hybridization are similar to those of immunoassays. The well established equipment for performing such assays in microplates can readily be used for reverse hybridization (GUESDON, 1992). Therefore, the reverse hybridization in microplates currently seems to be more suitable for routine identification. Some studies on design, optimization and application of identification or detection systems based upon this technique have been published using a direct (LAMOREUX et ai., 1997; PATEL et ai., 1997; FRAHM et ai., 1998; GRAF et ai., 1998; MANZANO et ai., 1998; PFYFFER et ai., 1999; SANDER and PENNO, 1999) or competitive assay format (CHEVRIER et ai., 1993; DEVERRE et ai., 1997). The results of further optimization of the microplate technique are presented here as part of a project on the development of a comprehensive identification system for enterococci based upon 16S and 23S rRNA targeted multiple probes.

Materials and Methods Design of the oligonucleotide probes The oligonucleotides used as capture probes in the present study are specified in Table 1. They are part of a comprehensive set of specific probes for the identification of enterococci published elsewhere (BEHR et aI., 2000). The ARB software package and databases (LUDWIG and STRUNK, 1996) were used as tool and basis for probe design as well as in silico evaluation. In vitro amplification and labeling of target DNA rDNA was amplified from purified genomic DNA of the target organism by applying the Qiagen Taq Core Kit (Qiagen, Hilden, Germany) according the manufacturers instructions. The following temperature profile was established in a Primus cycler (MWG, Ebersberg, Germany): 94°C 3 min for initial denaturation followed by 30 cycles of 94 °C 1 min, 52°C 1 min, 72 °C 4 min and final incubation at 72 °C for 10 min. For simultaneous labeling of the PCR product Digoxigenin labeled dUTP (Roche, Mannheim, Germany) was supplied with the dNTP mixture. The dUTP-dTTP ratio was adjusted to 1:19. The amplified rDNA fragment comprised the almost complete 16S rRNA gene, the intergenic spacer, and the major part of the 23S rRNA gene. The termini of the fragments correspond to E. coli rRNA positions 8 (16S rRNA) and 2669 (23S rRNA). The PCR primers were 616V (5'-AGAGTTTGATYMTGGCTCAG3') and 985R (5'-CCGGTCCTCTCGTACT-3'). The resulting PCR products (app. 4500 bp) were purified using the Qiagen PCR Purification Kit (Qiagen, Hilden, Germany) according to the manufacturers recommendations and finally analyzed by agarose gel electrophoresis. Immobilization of oligonucleotides. 5' phosphorylated oligonucleotides (MWG Biotech, Ebersberg, Germany) were immobilized on MaxiSorp, NucleoLink or CovaLink microtitre plates (MTP) or MTP strips (Nunc, Roskilde, Denmark) using a similar protocol as provided by the manufacturer (RASMUSSEN et aI., 1991, 1994). Various concentrations of the oligonucleotide (0.1 to 50 pmol) in 100 pi of coupling buffer composed of 10 mM 1-methylimidazole (Melm) and containing equimolar concentration of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (Sigma, Deisenhofen, Germany) or 1-cyclohexyl-3-(2-morpholinoethyl)-carbodiimide-metho-p-toluenesulphonate (CMCT) were

Table 1. Oligonucletides used as capture probes in the present study. All probes are targeted to 23S rDNA. Probe

Position"

Sequence (5'-3')

Specificity

Reference

Ega09 Ega09i Ega09p Ega09A Ega09Ap Ece09 Ece09i Ece09p Ece09A Ece09Ap Ece09AA Efa54p Eco09i Eav58i EcaflO9i

142-159 142-159 142-159 142-159 142-159 142-159 142-159 142-159 142-159 142-159 142-159 1399-1415 142-159 1494-1509 142-159

CACAACTGTGTAACATCC GGATGTTACACAGTTGTG P-CACAACTGTGTAACATCC AAAAAACACAACTGTGTAACATCC P-AAAAAACACAACTGTGTAACATCC CACTTAAAGGTAACATCC GGATGTTACCTTTAAGTG P-CACTTAAAGGTAACATCC AAAAAACACTTAAAGGTAACATCC P-AAAAAACACTTAAAGGTAACATCC AAAAAAAAAAAACACTTAAAGGTAACATCC P-CAAAAACAACTGGTACAG GGATATTACCTTTAAGTG AAATGCTTACATCTCTAA GGATGTTACGTCTGCGTG

E. gallinarum E. gallinarum E. gallinarum E. gallinarum

Behr et aI., 2000 This study This study This study This study Behr et aI., 2000 This study This study This study This study This study Behr et aI., 2000 Behr et aI., 2000 Behr et aI., 2000 Behr et aI., 2000

a: Escherichia coli position.

E. gallinarum E. cecorum E. cecorum E. cecorum E. cecorum E. cecorum E. cecorum E. faecalis E. columbae E. avium E. casseliflavus, E. flavescens

Optimization of Reverse Hybridization in Microplates added to each well of the MTP. After an incubation period of up to 15 h (overnight) at 50 °C in a Thermomix incubator! shaker (Labsystems Oy, Helsinki, Finland), the wells were manually washed three times for 5 min at 50 °C with 0.4 N NaOH containing 0.25% Tween 20 (Merck, Darmstadt, Germany). After a final rinse with a TRIS-washing solution containing 100 mM Tris-HCI, 150 mM NaCI, and 0.1 % Tween 20, pH 7.5, using a Delfia automatic plate washer (Wallac-ADL, Freiburg, Germany) the plates or strips were ready to use for the hybridization experiments.

Hybridization 100 III of DIG-labeled target-DNA (cone. 0.09 Ilg per well) was heated at 95 °C for 10 min and then quickly chilled on ice. After mixing with 9.9 ml of hybridization buffer [5xSSC with 0.5% blocking reagent (Roche Diagnostics, Mannheim, Germany) and 0.1 % Tween 20], 100 III of the solution was added to each well of the MTP with the attached capture-oligonucleotides. Hybridization was allowed to proceed at 42 °C in the Thermomix incubator. After washing with 0.5xSSC, 0.1 % Tween 20 at 42 °C for 15 min, the hybrids were visualized and quantified. Detection of hybrids Commercial Anti-Digoxigenin-Horseradish Peroxidase Fabfragments (anti-DIG-POD) (Roche Diagnostics, Mannheim) stock solution was diluted 1:1000 by adding dilution buffer (100 mM Tris-HCI, 150 mM NaC!, 0.5% blocking reagent, and 0.1 % Tween 20). 100 III of the antibody solution was added into each well. After an incubation for 1 h at room temperature the plates were washed three times with TRIS-washing solution. For colorimetric detection 100 III of substrate solution (1.5% tetramethylbenzidine in methanol, 200 mM KH 2-citrate, 0.01 % sorbic acid, 0.09% H 2 0 2 in 1 I of pure water, pH 4.5) was added to each well. Color development was stopped after 10 min with 50 III 5% H 2S0 4 containing 0.1 % SDS. The absorption was measured at 450 nm with a Victor 2 Multilabel Counter (Wallac-ADL, Freiburg, Germany). Alternatively, for luminometric detection 150 III of SuperSignal ELISA Femto (Pierce, Rockford, USA) were added to each well and luminescence signals were measured with the Multilabel Counter. Optimization of probe concentration Black MaxiSorp MTP strips were incubated with 100 III of a solution containing probe Ega09p (cone. 0, 1,2,3,5, 10 and 20 pmollwell), in 10 mM Me 1m containing 10 mM EDC at 50 °C for 5 hours. After washing with 0.4 N NaOH solution and TRIS-washing solution (as described above) the plate was used for hybridization at 42 °C for 3 hours in hybridization buffer (5xSSC) with 0-5 Illlwell DIG-labeled rDNA (cone. 0.075 ].Ig/].II) from the target species Enterococcus gallinarum. After washing with 0.5xSSC, 0.1 % Tween 20 at 42 °C, the detection and quantification of the hybrids were achieved as described above using the luminometric detection method. Optimization of immobilization time The MaxiSorp MTP strips were incubated with 100 ].II of a solution of 0.05 pmol/].ll of hexa-deoxyadenosine 5' -tailed or 5'-phosphorylated probe Ega09A or Ega09p, respectively, in 10 mM MeIm containing 10 mM EDC at 50 0c. After distinct incubation steps (1,2,3,4,5 and 15 h) a strip was removed and washed with 0.4 N NaOH containing 0.25% Tween 20 according to the procedure described above. When all strips had been processed, the reassembled plates were used for hybridization to DIG-labeled rDNA from the target species Enterococcus gallinarum (1 ].II per well, conc. 0.075 Ilg/].Il) as described above.

575

Optimization of hybridization time MaxiSorp and NucleoLink strips, pre-coated with 5 pmollwell either oligo-deoxyadenosine 5' -tailed or 5' -phosphorylated probes Ece09p, Ece09A, Ece09AA, Ece09Ap, respectively, were used for hybridization with 5 ].IlIwell DIG-labeled rDNA (0.09 ].Ig/].lL in hybridization buffer) from the target species Enterococcus cecorum. After distinct steps of incubation time (30, 50, 100, 150,200,250 and 300 min) at 42°C a strip was removed and washed two times with 2xSSC, 0.1 % Tween 20 at room temperature. Finally, the washed strips were reassembled and the whole plate was washed again two times with 0.5xSSC, 0.1 % Tween 20 at 42 °C temperature for 15 min. Detection and quantification of the hybrids were achieved as described above. Stringency of hybridization and washing MaxiSorp strips, pre-coated with 5 pmol/well 5' phosphorylated probes Ece09p or Ece09A, respectively, were used for prehybridization with 50 ].II hybridization solution (5xSSC, 1 % Blocking (Roche, Mannheim, Germany), 0.1 % n-Laurylsarkosine, 0.02% SDS) per well for 30 min at 37 0c. Subsequently, the buffer was replaced by 50 ].II hybridization solution containing approximately 120 ng/].Il of DIG-labeled rDNA from the target species Enterococcus gallinarum and the mixture was incubated for 120 min at 37 0c. After hybridization, the plates were washed three times 10 min at 37 °C with 100 ].II of TMAwashing-solution (3 M tetramethylammoniumchloride (TMA), 50 mM Tris/HCI, 2 mM EDTA, 0.1 % SDS; pH 7.5) and then rinsed with PBS (130 mM NaCI, 10 mM Na 2HP0 4 I NaH 2P0 4; pH 7.2). For differential washing a stringency gradient was applied by adding 1 %-30% (v/v) formamide to the tetramethylammonium chloride (TMA) buffer. These washings were carried out in parallel by adding TMA buffers with different formamide concentrations to adjacent microwells. Rehybridization MaxiSorp and NucleoLink strips, pre-coated with 5 pmol/well probe Ece09Ap, were used for hybridization with 0.01 pmollwell DIG-labeled inverse complementary oligonucleotide Ece09i using hybridization conditions as described above (temperature: 42 0C). After washing (as described above) and detection of the hybrids on one control strip, the other strips were washed and incubated repeatedly for 5 min with 0.2 N NaOH, 0.1 % Tween 20. After each washing step, two strips were removed and washed with TRIS-washing solution, one strip was used for the detection of the remaining DIG-labeled target-DNA (control of efficiency of denaturing step), the other strip was used for rehybridization using the exactly the same conditions of the first hybridization (control of rehybridization). All rehybridizations and subsequent detection steps were performed on one assembled plate.

Results and Discussion Type of support Hybridization using NucleoLink (non-chemically modified heat-stable polystyrene suitable for PCR, type of modification unknown) plates yielded the highest signal (Fig. 1). This can be attributed to a higher immobilization efficiency of the synthetic capture-oligonucleotide to the surface. Surprisingly, CovaLink plates (NH-modified polystyrene surface) exhibited the lowest binding capacity for both 5' phosphorylated or poly (dA)

576

M.

SCHEDL et

al.

J

o Blank (without EOC)

2

o Ega09p Fa Ega09Ap

Ega09A

1,5

ec::

5:'It"

o

o

Fig. 1. Signals after hybridization of 0.025 pmol/well DIG-labeled Ega09i using different polystyrene microplates and modified capture-probes: 5 pmol/well of ([J) 5'-phosphorylated oligonucleotide Ega09p, (fIl!) Ega09Ap oligonucleotide, (r;;) Ega09A oligonucleotide, (0) immobilization of 5'-phosphorylated oligonucleotide Ega09p without EDC.

0,5

NucleoLink

MaxiSorp Type of plate

CovaLink

probes, although the surface was originally developed as tailor-made product for DNA hybridization assays (CHEVRIER et al., 1993). In contrast, the hybridization signals obtained with MaxiSorp plates, which are routinely used for the immobilization of proteins or small hap tens (HOFSTETTER et al., 1997) in enzyme-linked immunosorbent assays (ELISA), is also quite high, although about one third lower compared to NucleoLink plates. Uniformity (expressed as standard deviation of the hybridization signals from different wells which were coated under the same conditions) of the immobilization process was quite good for both types of plates (average SD < 5% for 6 wells). In contrast to CovaLink plates which carry defined linker molecules, the surface of MaxiSorp plates is only known to have hydrophilic properties. Therefore, the binding mechanism of oligonucleotides to CovaL ink plates using EDC, a well-known crosslinking reagent, is probably based on the formation of a phosphoramidate bond (RASMUSSEN et al., 1991). However, for non-chemically modified MaxiSorp or NucleoLink

surfaces the binding mechanism is not fully understood. The findings of NIKIFOROV and ROGERS (1995) with different coupling procedures and types of MTPs, suggested a passive and noncovalent binding of unmodified oligonucleotides to polystyrene ELISA plates (Immunolon 4 plates from Dynatech were used) in the presence of EDC. According to these authors, EDC could act as a cationic detergent thus leading to complex formation between oligonucleotide and EDC which significantly alters the hydrophobic properties of the nucleic acid molecules. However, whether this is the sole binding mechanism remains unclear. Consistent with these earlier results significant oligonucleotide binding to the ELISA plate (MaxiSorp) was found only when EDC or less water-soluble CMCT was added to the immobilization solution, regardless whether the oligonucleotide was phosphorylated at the 5' -terminus or not. Furthermore, the presence of Melm buffer in the immobilization solution was not of importance, because even in pure aqueous EDC solutions coupling did occur (Fig. 2) and there-

1,200 , - - - - - - - - - - - - - - -

1,000

E c o ~

o o

i-----t~ ~t_-----+_-----~~I_- ----i~ 01---<--=r~::..I....J

0,800 - i - - - jim:

0,600 i---l:~

0.400

0,200

EOC+Melm

EDC(lIq.)

CMCT+Melm

Coupling agents used

CMCT(aq.)

Fig. 2. Hybridization ignal after different imm bilizati n pr edure using different coupling buffer and arbodiimide on Ma i orp microplate. Binding of pm Vwell of (. ) -pho phorylated o ligonucleotide Ega09p, (0 ) Ega09A, ( ~ ) '-pho phorylated oligonucleotide Ega09Ap. 0.0 pmoVwell Ega09i were u ed a target.

Optimization of Reverse Hybridization in Microplates

fore, the reaction must differ from the widely accepted binding mechanism which involves the formation of an imidazolide intermediate (CHU et al. 1983, 1986; ZAMMATTEO et aI., 1996,1997). However, given the rather harsh conditions of the washing step (0.4 N NaOH with detergent) in the immobilization protocol, oligonucleotides which are immobilized by pure physical adsorption should be removed (OROSKAR et aI., 1996). Additionally, also after hybridization or stringent washing steps no desorption of the hybrid from the surface was noticed as would have been indicated by a decrease of the hybridization signal. In our view, when colorimetric detection is used, the MaxiSorp MTPs are a cost-effective alternative support for nucleic acid hybridization assays at temperatures lower than 60°C (limited by thermostability of the plastic material), as the measured background signal is only 35 to 50% of the blank signal obtained when using the slightly yellowish colored NucleoLink plates. Hybridization time

For the 4500 bp labeled target-rDNA an optimum hybridization time of 3 hours was determined when using standard conditions (Fig. 3). Although the large size of the amplified DNA might influence kinetics unfavorably, further incubation does not increase the signal of the assay. This parameter is important to achieve a higher sample throughput as hybridization overnight is not necessary. This is also true for hybridizations carried out at 37°C, however the reaction progresses marginally slower. Overall the average time needed to perform the assay is about 4 hours when using pre-coated MTPs. The limit of detection was found to be 0.03x10-15 mol and 0.lx10- 15 mol for oligonucleotides (18-mer) and amplified rDNA (app. 4500 bp) when using oligo-deoxyadenosine tailed probes, respectively. Luminometric hybrid detection results in a two- to threefold increase in sensitivity. In addition, the linear dynamic range of the assay is two orders of magnitude higher. Although the lu-

577

minometric method provides the advantage of higher sensitivity it is remarkably more expensive with respect to needed reagents than the colorimetric detection procedure. The sensitivity and reproducibility of the colorimetric assay is sufficient for routine analyses. Differential washing

A central problem of the reverse hybridization procedure is that its major advantage i.e. the large number of probes of different specificities which can be applied in the same experiment may be abolished by the difficulty to provide experimental conditions ensuring specific binding of all individual probes. The stability of perfectly matched hybrids besides the overall G+C content and size of the base paired region is highly influenced by the primary structures of probe and target nucleic acids. Furthermore, primary and potential secondary structures of flanking regions of target nucleic acids may further affect the hybrids stability. Although careful in silico probe design, evaluation and optimization helps to estimate and roughly equalize the dissociation behavior of probe target hybrids it is usually not possible to design a comprehensive set of probes sharing identical experimental demands for specificity. This problem can be reduced substantially but not completely by using probes of equal sizes and adding tetramethylammoniumchloride (TMA) to the washing solutions. Due to its property of specifically binding to AT pairs and increasing their thermal stability the dissociation temperature of the probes at a concentration of 3M TMA should only be a function of probe length (MELCHIOR, 1973). At higher TMA concentrations the stability of GC pairs is even lower than that of AT pairs (MELCHIOR, 1973). Although TMA was routinely included and all probes were 18mers slight differences of optimal experimental conditions were observed for different probes. Consequently, misidentification resulting from non-specific hybridization signals may occur especially when comprehensive probe sets are used to analyze complex (environmental) samples. These problems

1,8 1,6

1.4 1,2

E c:

-+-Ece09

.,. g 0,8 0

It)

0,6

Fig. 3. Influence of the duration of the hybridization reaction at 42 °C on the final hybridization signal of a MaxiSorp microplates. Signal with (+) Ece09AA probe, (_) Ece09A, (e) Ece09Ap, (0 ) Ece09p.

0,4

0-----0.-----10-- __---O~--~n~----~~ 'r 't

0,2 0 0

50

100

150

200

Duration of hybridization [min)

250

300

578

M. SCHEDL et al.

1.400 , -- - - - - - - - - - - - - - - - - -_ _ _ _ _ _ _ _ _ _ _----,

E. 'aecalis E. 'a8CIUm

1,200

E. _liflllvus

E. flsvescens

1,000 t-------------.!I~---------------~

E

c:

0,800

+-- - - - - - - - - - - -

0.600

a-------------------.C\-- - - - - - - - - - - - - 4

CI

II)

~

C

o

0,400

0,200

0,000

+-- - - - - - - - -

+-----+-----+------f----+----+-----+-----l 0%

5%

10%

15%

20%

25%

Formamide in washing solution could be circumvented by monitoring controlled denaturation of the probe target hybrids. Thus perfectly matched hybrids can be differentiated from non-specific binding. As an example, the denaturation profile of a perfectly matched probe-target hybrid is shown for probe Efa54p in Fig. 4. After hybridization under relaxed conditions (5% formamide) a stringency gradient was applied during washing. Multiple hybridizations of the same target and probe DNA were performed in adjacent wells of the microplate. Hybrid denaturation was monitored by performing isothermic washing steps in parallel applying buffers differing with respect to the formamide concentration (0%-30%) to these adjacent wells. After detection and measuring the remaining hybridization signals the stabilities of hybridization products can be visualized and compared. The melting behavior of several probes out of the mentioned comprehensive probe set for enterococci (BEHR et aI., 2000) after hybridization to amplified rDNA from the respective target and closely related non-target was followed by differential washing. The probes Ecafl09i, Eav58i and Eco09i were included for evaluation and optimization of the procedure, given that their G+C contents represent the highest and lowest as well as the mean value among the probes of the set, respectively. Denaturation curves were obtained for the respective homologous probe target hybrids applying the (0%-30%) formamide gradient. Thus, performing differential washing allows to apply conditions (sequentially or in parallel) ensuring specific binding of any component of a heterogeneous set of probes. Target DNAs of probes needing the most diverged condi-

30%

35%

Fig. 4. Differential washing. Hybridization were performed with probe Efa54p specific for Enterococcus faecalis. A formamide gradient of 0%-30% was applied during washing. Hybridization signal obtained with rDNA from (+) E. faecalis, (.) E. faecium, (... ) E. casseliflavus, (e) E. flavescens.

tions for specificity can be used as internal standards to monitor the correctness of experimental conditions. Efficiency of immobilization in relation to oligonucleotide modification It has been reported earlier that modification of oligonucleotides by 5' -phosphorylation results in more efficient binding (GRAF et aI., 1998). Interestingly, when using non-phosphorylated capture-probes which had an hexa -deoxyadenosine extension at the 5' -terminus a successful hybridization with the target-DNA could be observed as well. In all cases the signal was higher or at least equal to the value obtained with phosphorylated oligonucleotides. Additional phosphorylation of the tailed capture-probe did not increase the hybridization signal (Fig. 3) and further extension to a total of 12 deoxyadenosine residues led to a slight reduction of the signal. Further experiments suggested that the immobilization of the 5' -tailed oligonucleotide on a polystyrene surface is more efficient than the coupling of phosphorylated DNA onto this support. Without the coupling agent EDC, no binding of the phosphorylated or 5' -tailed oligonucleotide was observed (Fig. 1). Obviously, the oligo-deoxyadenosine group may act as a spacer which makes the target sequence more accessible for hybridization whereas "non-extended" probes may not be completely accessible. Comparison of the melting curves obtained with 5' -tailed and phosphorylated probes indicate that at least 2-3 bases of the non-extended probe fail to pair with the target-DNA. This en-

Optimization of Reverse Hybridization in Microplates

hanced hybridization could be shown independently for both NucleoLink as well as MaxiSorp MTPs when using hexa-deoxyadenosine 5'-tailed probes. Similar results were reported by OROSKAR et al. (1996) with NucleoLink supports. The mechanism of immobilization of 5'-tailed probes to the surface of the plates is not yet fully understood, as the unmodified oligonucleotide lacks a functional group which could react with the modified polystyrene under these conditions. However, considering the strength of the binding forces between the surface and the oligonucleotide, the formation of a chemical bond between the probe and polystyrene has to be taken into account. It is evident, that the y-irradiation treatment of polystyrene does introduce some reactive sites on the surface. These sites might be capable of undergoing EDC mediated coupling reactions with the oligonucleotide regardless whether it is posphorylated or not.

Optimum capture probe concentration and incubation time for immobilization Our results confirm an optimum incubation time of the capture-probe of 5 hours at 50°C (Fig. 5) as was recommended by the manufacturer. The hybridization sig-

579

nals for both NucleoLink and MaxiSorp plates coated with capture probes in correlation with the incubation time for immobilization reached a plateau after 5 hours of incubation. In addition, similar results were obtained independently from the type of modification of the capture-probe used (oligo-deoxyadenosine 5'-tailing, phosphorylation). Although the immobilization experiments with DIGlabeled oligonucleotides showed that the well surface is not saturated completely after 5 hours, further incubation did not increase the hybridization signal significantly. As expected the signal after hybridization on MTPs is also dependent on the amount of immobilized captureprobe. Maximum hybridization signals were achieved when 5 pmol of capture-probe per well were used for immobilization (Fig. 6). Higher concentrations of captureDNA did not increase the hybridization efficiency significantly. These findings did not depend on the type of target-DNA used. Both hybridizations with synthetic oligonucleotides (18 b) and amplified DNA indicated the relationship between obtained signal and capture-probe concentration. In some cases, at very high capture-probe concentrations a decrease of the signal was observed, which may be explained by a crowding effect on the surface of the plate (SOUTHERN et al. 1999).

1,600 1,400 1,200

E 1,000 c 0

II) ~

0,800

0

0 0,600 0,400

Fig. 5. Influence of the time used for immobilization of the capture oligonucleotide (at 50°C) on the hybridization signal of a MaxiSorp MTP. Probes were: (+) Ega09A 5 pmol/well, (.) Ega09p 5 pmol/well.

0,200 0,000

3

5

7

9

11

13

15

Duration of Immobilization [h)

300000O

2500000

Fig. 6. Hybridization signal after variation of amount of immobilized capture oligonucleotide (0-25 lf 2000000 o pmol/well) and concentration of am1500000 plified labeled target rDNA (0-5 Ill; conc. 0.09 Ilg/Ill). Detection was performed by luminometric measure1000000 ment on MaxiSorp microplates. (+) 5 Ill/well, rDNA, (.) 1 Ill/well, 500000 rDNA, (A) 0.5 Ill/well rDNA, (X) 0.1 Ill/well rDNA, (0) 0.05 Ill/well o "~-=~=====-F=====T=====~-----W rDNA, (e) 0 Ill/well rDNA (blank signal). Abbreviations: CPS, counts o 5 10 15 20 25 per second. c (capture-ollgonucleotlde) pmoVwell

-+- 5 j.lVweli DNA

----1

j.lVweli --.- 0,5 IJVweli ""*- 0,1 IJVwell 0,05 IJVwell - ' - OIJ Vweli

--e-

580

M. SCHEDL et al.

Rehybridization and storage of coated plates Rehybridization of capture probe coated MaxiSorp plates with alternative target nucleic acids is possible. Obviously complete dissociation of the target-DNNcapture-probe duplex is achieved by using a denaturing solution of 0.2 N NaOH and 0.1 % Tween 20. As could be demonstrated after this procedure only the capture-probe remained on the surface of the plate. Labeled DNA was not detectable. Thus washing two times with the alkaline denaturing solution and a neutralising TRIS-washing solution proved to be a reliable and rapid method to prepare the plate for further hybridizations. Fluctuations of the signals using the same plate and target-DNA are more likely to be caused by slight differences in the assay conditions (hybridization, detection, color development) than by deterioration of the coating of the plate. The plates could be reused up to 3-5 times, without sacrificing signal strength. The pre-coated plates can be stored over a long period of time (at least 4 weeks) at 4 °C covered with an adhesive film. Hybridization signals obtained after 1, 2, 3, 4 and 8 weeks of storage showed only a minor deviation from the original signal. In summary storage and repeated use of coated MTPs could reduce the cost of a microplate hybridization assay system significantly without sacrificing performance with respect to sensitivity and reproducibility. Furthermore, by using single microwell strips, an individual plate "tailored" for a specific organism or group can be assembled. Acknowledgments

This work was supported by the German Research Council DFG Project SFB 411/B2.

References AMANN, R. and LUDWIG, W.:Typing in situ with probes. pp. 115-135. In: Bacterial Diversity and Systematics (EG. PRIEST, A. RAMOS-CORMENZANA, B. TINDALL, eds.) London, Plenum AMANN, R., LUDWIG, W., SCHLEIFER, K.-H.: Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59, 143-169 (1995) BEHR, T., KOOB, c., SCHEDL, M., MEIER, H., KNOPP, D., FRAHM, E., OBST, U., SCHLEIFER, K.H., NIEIlNER, N., LUDWIG, W.: A nested array of rRNA targeted probes for the detection and identification of Enterococci by reverse hybridization. Syst. Appl. Microbiol., submitted BETTS, K.S.: DNA chip technology could revolutionize water testing. Environ. Sci. Technol. 33, 300A-301A (1999) CHEVRIER, D., RASMUSSEN, S.R., GUESDON, J.L.: PCR product quantification by non-radioactive hybridization procedures using an oligonucleotide covalently bound to microwells. Mol. Cell. Probes 7, 187-197 (1993) CHU, B.C., WAHL, G.M., ORGEL, L.E.: Derivatization of unprotected polynucleotides. Nucleic Acids Res. 11, 6513-6529 (1983) CHU, B.C., KAMER, ER., ORGEL, L.E.: Synthesis of an amplifiable reporter RNA for bioassays. Nucleic Acids Res. 14, 5591-5602 (1986)

DEVERRE, J.R., BOUTET, V., BOQUET, D., EZAN E., GRASSI, ]., GROGNET, J.M.: A competitive enzyme hybridization assay for plasma determination of phoshodiester and phosphorthioate antisense oligonucleotides. Nucleic Acids Res. 25, 3584-3589 (1997) FRAHM, E., HElBER, I., HOFFMANN, S., KOOB, c., MEIER, H., LUDWIG, W., AMANN, A., SCHLEIFER, K.-H., OBST, U.: Application of 23S rDNA-targeted oligonucleotide probes specific for Enterococci to water hygiene control. System. Appl. Microbiol. 21, 450-453 (1998) GRAF, E., TATZEL, R., WALLNHOFER, P.R.: Reverse hybridization on a microplate: A rapid method for the identification of dairy microorganisms. Milchwissenschaft. 53, 494-498 (1998) GUESDON, J.L.: Immunoenzymatic techniques applied to the specific detection of nucleic acids. J. Immunol. Methods 150, 33-49 (1992) HOHEISEL, J.D: Oligomer-chip technology. TIBTECH 15, 465-469 (1997) HOFSTETTER, 0 ., HOFSTETTER, H., THEN, D., SCHURIG, V., GREEN, B.S.: Direct binding of low molecular weight haptens to ELISA plates. J. Immunol. Methods 210, 89-92 (1997) LAMOUREUX, M., FLISS, I., BLAIS, B.W., MESSIER, S., HOLLEY, R.A., SIMARD, R.E.: Microtitre plate hybridization system for detection of thermophilic Campylobacter rRNA. J. Appl. Microbiol. 82, 259-266 (1997) LUDWIG, W., AMANN, R., MARTINEZ-ROMERO, E., SCHONHUBER, W., BAUER, S., NEEF, A. SCHLEIFER, K.H.: rRNA based identification systems for rhizobia and other bacteria. Plant and Soil 204, 1-9 (1998) MAIDAK, B.L., COLE, J.R., LILBURN, T.G., PARKER JR., c.T., SAXMAN,P.R., STREDWICK, J.M., GARRITY, G.M., LI, B., OLSEN,G.]., PRAMANIK, S., SCHMIDT, T.M., TIEDJE, J.M.: The RDP (Ribosomal Database Project) continues. Nucleic Acids Res. 2,173-174 (2000) MANZANO, M., COCOLIN, L., CANTONI, c., COMI, G.: Detection and identification of Listeria monocytogenes in food by PCR and oligonucleotide-specific capture plate hybridization. Food Microbiol. London. 15,651-657 (1998) MELCHIOR, W.B., VON HIPPEL, P.H.: Alteration of the relative stability of dA dT and dG dC base pairs in DNA. Proc. Nat. Acad. Sci. USA. 70,298-302 (1973) NIKIFOROV, T.T, ROGERS, Y.H.: The use of 96-well polystyrene plates for DNA hybridization based assays: an evaluation of different approaches to oligonucleotide immobilization. Anal. Biochem. 227, 201-209 (1995) OROSKAR, A.A., RASMUSSEN, S.E., RASMUSSEN, H.N., RASMUSSEN, S.R., SULLIVAN, B.M., JOHANSON, A.: Detection of immobilized amplicons by ELISA-like techniques. Clin. Chern. 42, 1547-1555 (1996) PATEL, S., YATES, M., SAUNDERS, N.: PCR-enzyme-linked-immunosorbent assay and partial rRNA gene sequencing: a rational approach to identifying mycobacteria. J. Clin. MicrobioI. 35, 2375-2380 (1997) PFYFFER, G.E., FUNKE-KISSLING, P., RUNDLER, E., WEBER, R.: Performance characteristics of the BDProbeTec system for direct detection of Mycobacterium tuberculosis complex in respiratory specimens. J. Clin. Microbiol. 37,137-140 (1999) RASMUSSEN, S.R., LARSEN, M.R, RASMUSSEN, S.E.: Covalent immobilization of DNA onto polystyrene microwells: the molecules are only bound at the 5' end. Anal. Biochem. 198, 138-142 (1991) RASMUSSEN, S.R., RASMUSSEN, H.B., LARSEN, M.R., JORGENSEN, R.H., CANO, R.J.: Combined polymerase chain-reaction-hybridization microplate assay used to detect bovine leukemia virus and Salmonella. Clin. Chern. 40, 200-205 (1994)

Optimization of Reverse Hybridization in Microplates SANDER, A., PENNO, S.: Semiquantitative species-specific detection of Bartonella henselae and Bartonella quintana by PCRenzyme immunoassay. ]. Clin. Microbiol. 37, 3097-3101 (1999) SOUTHERN, E., MIR, K., SHCHEPINOV, M.: Molecular interactions on microarrays. Nature Genet. 21, 5-9 (1999). STAMS, A.J., ELFERINK, S.].: Understanding and advancing wastewater treatment. Curro Opinion Biotechnol. 8,328-334 (1997) VAN DE PEER, Y., DE RIJK P., WUYTS J., WINKELMANS T., DE WACHTER R.: The European Small Subunit Ribosomal RNA database. Nucleic Acids Res. 28,175-176 (2000) WALLNER, G., STEINMETZ, I., BITTER-SUERMANN, D., AMANN, R.: Combination of rRNA-targeted hybridization probes and immuno-probes for the identification of bacteria by flow cytometry. System. Appl. Microbiol. 19,569-576 (1996)

581

ZAMMATTEO, N., ALEXANDRE, I., ERNEST, I., LE, L., BRANCART, E, REMACLE, ].: Comparison between microwell and bead supports for the detection of human cytomegalovirus amplicons by sandwich hybridization. Anal. Biochem. 253, 180-189 (1997) ZAMMATTEO, N., GIRARDEAUX, c., DELFORGE, D., PIREAUX, ].J. AND REMACLE, ].: Amination of polystyrene microwells: application to the covalent grafting of DNA probes for hybridization assays. Anal. Biochem. 236,85-94 (1996) Corresponding Author:

Dr. DIETMAR KNOPP, Institut fur Wasserchemie, Technische Universitiit Munchen, Marchioninistrasse 17, D - 813 77 Munchen Tel.: +89/70957994, Fax: 89170957999, e-mail: [email protected]