- Email: [email protected]
Oral administration of Debaryomyces hansenii CBS8339-β-glucan induces trained immunity in newborn goats
Developmental and Comparative Immunology 105 (2020) 103597
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm
Oral administration of Debaryomyces hansenii CBS8339-β-glucan induces trained immunity in newborn goats
T
Miriam Anguloa, Martha Reyes-Becerrila, Ramón Cepeda-Palaciosb, Carlos Anguloa,∗ a
Immunology & Vaccinology Group, Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Av. Instituto Politécnico Nacional 195, Playa Palo de Santa Rita Sur, La Paz, B.C.S., 23096, Mexico b Laboratorio de Sanidad Animal, Universidad Autónoma de Baja California Sur, Carretera al Sur km. 5.5, Col. Mezquitito, La Paz, B.C.S., 23080, Mexico
A R T I C LE I N FO
A B S T R A C T
Keywords: Ruminant Innate immune memory Marine yeast Polysaccharides Pathogen
Beta-glucans from yeast can induce trained immunity in in vitro and in vivo models. Intraperitoneal doses of βglucans in mammals have shown to induce trained immunity, but the training effects of orally administering βglucans are unknown. Newborn goats are susceptible to infections in the neonatal stage, so the induction of trained immunity could improve animal survival. This study aimed to describe the in vitro effects of immunological training by β-glucan from Debaryomyces hansenii (β-Dh) on caprine monocytes, as well as its in vivo effects using oral doses on newborn goats upon challenge with lipopolysaccharide (LPS). Hence in vitro, goat monocytes trained with β-Dh up-regulated the gene expression of macrophage surface markers (CD11b and F4/ 80) whereas enhanced cell survival and high phagocytic ability was found upon LPS challenge. In the in vivo experiment, newborn goats stimulated with two doses (day −7 and - 4) of β-Dh (50 mg/kg) and challenged (day 0) with LPS showed an increase in respiratory burst activity, IL-1β, IL-6, and TNFα production in plasma, and transcription of the macrophage surface markers. This study has demonstrated for the first time that trained immunity was induced with oral doses of β-glucan upon LPS challenge in mammals using newborn goats.
1. Introduction Trained immunity has been described as the ability of the innate immune system to enhance the response against a re-infection/stimulation with the same or different pathogen or pathogen-associated molecular patterns (PAMPs) (Netea et al., 2015). This concept has been widely described in plants and invertebrate animals. Recently, scientific evidence of cellular and molecular mechanisms has been found in mammals, such as mice and humans (Ifrim et al., 2014, Kleinnijenhuis et al., 2014). Stimuli that induce trained immunity are Bacille CalmetteGuérin (BCG) vaccine, Vaccinia Ankara, chimeric compounds (i.e. CL429), Plasmodium falciparum and yeast cell wall components, such as chitins and β-glucans (Arts et al., 2015; Blok et al., 2019; Schrum et al., 2018; Santecchia et al., 2019; Rizzetto et al., 2016; García-Valtanen et al., 2017), among others. Beta-glucans are polysaccharides that have well-known immunomodulatory effects. In this context, only those from Saccharomyces cerevisiae and Candida albicans have been tested and induced trained immunity in monocytes and macrophages of murine and human models (García-Valtanen et al., 2017; Bekkering et al., 2016; Alexander et al.,
2016). Trained monocytes and macrophages increased pro- and antiinflammatory cytokines by β-glucan in both in vitro and in vivo evaluations; and the trained mechanisms were associated with epigenetic and metabolic reprogramming of cells, which were mainly stable changes in histone trimethylation at H3K4 and increases in glycolysisdependent activation of mammalian target of rapamycin (mTOR) regulator, respectively (Quintin et al., 2012; Cheng et al., 2014). Remarkably, the functional monocyte reprogramming has also been associated with cell shape and cell surface marker modifications (Ifrim et al., 2014). The effects of yeast-derived β-glucans on trained immunity upon secondary stimulation in mice have been assessed by intraperitoneal administrations (Walachowski et al., 2017; García-Valtanen et al., 2017) while the effects of oral administration of β-glucans are unknown. On the other hand, in all animal species, the neonatal stage is a critical period sensitive to infections because of immune system immaturity, including caprine species (Tourais-Esteves et al., 2008). In this stage, newborn goats are in contact with different pathogens that cause infections and death (Singh et al., 2018). Recently, our research
∗ Corresponding author. Centro de Investigaciones Biológicas del Noroeste, S.C., Instituto Politécnico Nacional #195, Col. Playa Palo de Santa Rita, La Paz C.P., 23090, BCS, Mexico. E-mail address: [email protected] (C. Angulo).
https://doi.org/10.1016/j.dci.2019.103597 Received 1 October 2019; Received in revised form 26 November 2019; Accepted 21 December 2019 Available online 25 December 2019 0145-305X/ © 2019 Elsevier Ltd. All rights reserved.
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
group found that β-glucans from the marine yeast Debaryomyces hansenii CBS 8339 increased innate immune parameters in goat leukocytes before and upon challenge with Escherichia coli (Angulo et al., 2018). Thus, the induction of trained immunity in newborn goats could improve survival against infections; curiously, oral administration of D. hansenii CBS 8339 also enhanced their innate immune parameters (Angulo et al., 2019). Accordingly, this study aimed to examine whether oral stimuli with β-glucans from D. hansenii CBS8339 could induce trained immunity in caprine monocytes (in vitro) and newborn goats (in vivo) upon challenge with lipopolysaccharide (LPS) from E. coli.
USA). The transcriptional level of each target gene was corrected by the Eukaryotic initiation factor 2 (EIF2). The relative mRNA of each target gene in the treated groups versus the control group was calculated by Pfaffl equation (Pfaffl, 2001). Data for real-time PCR are expressed as the fold increase (mean ± standard error, SE). The values higher than 1 in the level of a gene express an increase, while values lower than 1 in the level of a gene express a decrease. 2.2.3. Cell viability Evaluation of cell viability of goat monocytes trained with β-glucan upon LPS challenge was performed using propidium iodide (PI) staining assay by flow cytometry. Briefly, 500 μl of goat cells trained were centrifuged (1500 rpm, 10 min), and the supernatant was discarded. Later, 400 μl of binding buffer and 5 μl of PI were added, mixed, and the cells were incubated in darkness for 15 min. After that, 400 μl of binding buffer were added, and the mix was filtrated by 40-μm sieves to fluorescence-activated cell sorting tubes (FACS, Becton and Dickinson, Mountain View, CA, USA). All samples were analyzed using a flow cytometer (S3e Cell Sorter, Biorad, Hercules, CA, USA), and PI was detected using red fluorescence (FL-3) detector. The results were expressed as live cell percentages.
2. Materials and methods 2.1. Glucan extraction Debaryomyces hansenii strain CBS 8339 was inoculated in 35 L of Yeast Peptone Dextrose broth (Sigma, St. Louis MO, USA) and incubated under agitation (150 rpm) at 30 °C for 48 h. The cell biomass was recovered by centrifugation (5000 rpm, 4 °C, 15 min) and lyophilized (FreeZone 18, LABCONCO, Kansas City, MO, USA) for 24 h. The glucan was extracted according to the methodology previously described by Angulo et al. (2018).
2.2.4. Phagocytic ability The phagocytic ability to engulf S. cerevisiae (strain S288C) was determined in goat trained monocytes with β-glucan from D. hansenii CBS 8339 after LPS challenge by flow cytometry (Rodríguez et al., 2003). S. cerevisiae cells were labeled with 5-([4,6-Dichlorotriazin-2-yl] amino) fluorescein hydrochloride (DTAF; Sigma, St. Louis, MO, USA) following the methodology performed by Angulo et al. (2018). Then, 60 μl of labeled-yeast cells were added to 100 μl (1 × 106 cells/ml) of trained monocytes, mixed by pipetting, and incubated at 22 °C for 30 min. After incubation, phagocytosis was stopped placing samples on ice, and 400 μl ice-cold phosphate buffered saline (PBS, pH 7.2) were added to each sample. The fluorescence of the non-phagocyted yeast cells was quenched by the addition of 40 μl of ice-cold trypan blue (0.4% in PBS). All samples were analyzed in a flow cytometer (S3e Cell Sorter, Biorad, Hercules, CA, USA) set to determine the phagocytic cells showing the highest forward scatter (FSC) and moderate side scatter (SSC). Phagocytic ability was expressed as the percentage of phagocytic cells.
2.2. In vitro evaluation 2.2.1. Isolation and stimulation of goat monocytes Goat peripheral blood monocytes were isolated by using Human Whole Blood Monocytes Isolation Kit (Bio Vision, Milpitas, CA, USA) and performed according to the instructions provided by the manufacturer. Thereafter, monocytes were resuspended in RPMI 1640 medium (Sigma, St. Louis, MO, USA) supplemented with fetal bovine serum (10%, Gibco, Grand Island, NY, USA), penicillin-streptomycin (100 IU/ml-100 mg/ml), and glutamine (1%). One ml of monocytes (1 × 106 cells/ml) were placed in both 24-well plates and 4-well culture slides (Corning, NY, USA) allowing adhesion at 37 °C for 1 h. After incubation, the media were removed and replaced as follows: 1 ml of the same medium (control); 1 ml of medium containing 5 μg of β-glucan from D. hansenii CBS 8339 (β-Dh); 1 ml of medium containing 20 ng of phorbol-12-myristate-13-acetate (PMA). After 24 h, the cells were washed with prewarmed (37 °C) RPMI medium; then, 1 ml of supplemented RPMI was placed in each well. Subsequently, the monocytes were incubated for five days to allow cell differentiation, in which cells were refreshed with a new medium at day 3 post-incubation. At the end of the cell differentiation period, culture media were removed, and monocytes were challenged with 1 ml RPMI medium containing 10 ng of LPS (Sigma, St. Louis, MO, USA). Supernatants from 24-well plates were collected at 24 h after challenge for gene expression, viability, and phagocytosis analyses. The cells placed in 4-well slide culture were stained with Giemsa (Sigma, St. Louis, MO, USA) and analyzed for morphological differentiation under Olympus Bx41 optic microscope (Olympus, America Inc., Melville, NY, USA).
2.3. In vivo evaluation 2.3.1. Animal feeding and sampling This experiment was carried out in the Sheep and Goat Research Unit of the Universidad Autonoma de Baja California Sur (UABCS), Mexico, and conducted in accordance with UABCS bioethical committee. Twelve Saanen × Nubian crossbred newborn males (3.56 ± 0.58 kg body weight) were divided into three experimental groups in separate pens of the Research Unit. At birth, each newborn goat was weighed, identified with a tag on the neck, and the umbilical cord was disinfected. Newborns were kept in stable conditions with free access to breast milk during the experimental trial (8 days). The experimental groups consisted of (1) Control (n = 4), (2) βglucan of D. hansenii (β-Dh, n = 4) and (3) β-glucan of S. cerevisiae (βSc, n = 4). Following the schedule described in Fig. 4A newborn goats of groups β-Dh and β-Sc were orally treated with two doses of 50 mg/kg of live body weight of β-glucan from D. hansenii and β-glucan from S. cerevisiae, respectively. The β-Dh and β-Sc doses were administered in 1 ml of goat's breast milk on days −7 and −4 using a syringe (3 ml). Each newborn in the control group received only 1 ml of goat's breast milk. Peripheral blood was obtained from each newborn on day −1 (pre-bleed) to evaluate the pre-existing immunological parameters. On day 0, all the goat kids were intraperitoneally injected with 1 ml of a solution containing 12.5 μg/kg live body weight of LPS in saline solution (0.85% NaCl). Blood was obtained from each goat kid at 2.5 h after
2.2.2. Gene expression The relative expression levels of cell surface markers (CD11b, CD11c and F4/80) and cytokine proinflammatory (IL-1β) genes were evaluated in goat trained monocytes with β-glucan from D. hansenii and challenged with LPS using real-time polymerase chain reaction (PCR) and the 2−ΔΔCT method (Livak and Schmittgen, 2001). The primers used in this study are listed in Table 1. Total RNA was extracted with TRIzol reagent (Life Technologies, Carlsbad, CA, USA) and treated with amplification grade DNase I (1 U/mg RNA, Life Technologies, Carlsbad, CA, USA). The first-strand cDNA was synthesized with ImProm-II™ Reverse Transcription System (Promega, Madison, WI, USA) following the manufacturer's instructions. Real-Time PCR was performed with a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) using Ssofast™ EVAGreen® Super Mix (Bio-Rad, Hercules, CA, 2
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
Table 1 Sequences of the primers used in this study of trained immunity by oral doses of D. hansenii-derived β-glucan in newborn goats. Gene
Abbreviation
Length of product (pb)
Accession No.
Primer sequence (5′– 3′)
Integrin subunit alpha M
CD11b
193
XM_05697735.3
F4/80
F4/80
198
NM_018050945.1
Integrin subunit alpha X
CD11c
194
XM_018040559.1
18S RNA
18s
100
DQ149973.1
Eukaryotic translation initiation factor 2B subunit beta
EIF2B2
180
XM_013967316.2
GAGAAAAACGCTGAAATCAAGG CATCACACTTCCACTTAGCTCTC GTGGAAATGCAGTATCTCGC CATTGCACTGAGATCTGTTGTC CAAAGCATTGTGACATTTGAC AAGTTGAGACGCAAGATGATG TCGGGGATTGCAATTATTC ACGGGCGGTGTGTACAAA ACAACGGAGAACATCGCAG ATTGACTGCCATCTCATGACC
PCR and the 2−ΔΔCT method (Table 1). The transcriptional level of each target gene was corrected by the 18s gene. The relative mRNA of each target gene in the treated groups versus the control group was calculated by Pfaffl equation (Pfaffl, 2001). Data for real-time PCR were expressed as fold increase (mean ± standard error, SE). Values higher than 1 in the level of a gene express an increase, while values lower than 1 in the level of a gene express a decrease.
LPS injection in BD Vacutainer® tubes with sodium heparin (Franklin Lakes, NJ, USA). Three ml of blood was used for respiratory burst activity and RNA extraction; while 2 ml of blood were allocated for plasma separation by centrifugation (500 g, 10 min) for nitric oxide production, lysozyme activity analysis, and cytokine production. 2.3.2. Respiratory burst The respiratory burst activity of goat monocytes was measured as the production of reactive oxygen intermediates using the nitro blue tetrazolium (NBT) reduction according to Kemenade et al. (1994). Fifty μl of blood were placed in 96-well plates and incubated at 37 °C for 1 h to allow cell adhesion. After incubation, NBT solution (1 mg/ml; Sigma, St. Louis, MO, USA) was added to each well and incubated in darkness for 2 h. Later, cells were washed with PBS and incubated with methanol (70% v/v) for 10 min. Subsequently, cells were washed and resuspended in 2M KOH-DMSO. The optical density (OD) was read at 655 nm in a microplate reader (BioRad, Model 3550 UV, Hercules, CA, USA).
2.4. Statistical analysis All data were performed by triplicate, and the mean ± standard error (SE) for each treatment was calculated. A one-way ANOVA was used to analyze the training of immune cells of goat kids with β-glucan from D. hansenii before and/or upon challenge with LPS using SPSS v.19.0 software (SPSS, Richmond, VA, USA). Means were separated by Duncan multiple range test. Differences were considered significant at P < 0.05. 3. Results
2.3.3. Nitric oxide production The nitric oxide production was determined according to Neumann et al. (1995). Briefly, 100 μl of plasma were incubated with 100 μl of Griess reagent in a 96-well plate, mixed, and incubated at room temperature in dark for 15 min. The OD was read at 562 nm in a microplate reader (3550UV, BioRad, Hercules, CA, USA). The data were expressed in nitrite concentration (μM).
3.1. In vitro evaluation of trained immunity 3.1.1. Goat trained monocytes with β-glucan from Debaryomyces hansenii morphologically differentiated to macrophages-like cells Goat monocytes were stimulated with β-glucan from D. hansenii CBS 8339 for 24 h. After this period, the cells were subjected to a period of differentiation for five days. On day 0, monocytes with the typical round morphology were observed while on day four and six, differentiation of larger cells and often-elongated morphology were observed in all treatments, showing a classical macrophage morphology (Fig. 1).
2.3.4. Lysozyme activity The lysozyme activity was evaluated in plasma following the methodology of Litwack (1995) with slight modifications. Briefly, 25 μl of standards and plasma samples were dispensed into 96-well plates per triplicate and 175 μl of Micrococcus lysodeikticus (75 mg/ml; M3770, Sigma, St. Louis, MO, USA) were added. Immediately, the plate was read at 450 nm in a microplate reader (BioRad, Model 3550 UV, Hercules, CA, USA). Serial dilutions of Hen egg white lysozyme (FIEWL) (Sigma, St. Louis, MO, USA) in phosphate/citrate buffer (0.1 M) were used at 0, 2.5, 5, 10, and 20 μg/ml for the standard curve. The lysozyme activity was calculated in each plasma sample from the standard curve.
3.1.2. Relative expression of macrophage cell surface marker genes upregulated in β–glucan and phorbol myristate acetate trained cells The transcriptional level of three cell surface marker genes was analyzed: CD11b gene mainly expressed in monocytes, CD11c gene predominantly expressed in dendritic cells, and F4/80 gene principally expressed in macrophages. After re-stimulation with LPS, the expression level of CD11b gene significantly increased only in the β-Dh group compared to the control and phorbol myristate acetate (PMA) groups (Fig. 2A). Moreover, the mRNA levels of F4/80 gene up-regulated (P < 0.05) in trained cells with β-glucan and PMA compared with the control group (Fig. 2B). In contrast, the relative expression of CD11c gene down-regulated (P < 0.05) in trained cells with β-glucan with respect to the control and PMA groups (Fig. 2C) whereas the expression of the proinflammatory cytokine IL-1β gene was similar among groups (Fig. 2D).
2.3.5. Goat cytokine detections by enzyme-linked ImmunoSorbent assay ELISA goat cytokine kits (MyBiosource, San Diego, CA, USA) were used to detected IL-1β (MBS1601368), IL-6 (MBS7606893), and TNF-α (MBS263127). Each cytokine concentration was determined using a standard curve following recombinant cytokine standards provided by the kit. 2.3.6. Gene expression analysis Same as in the in vitro gene expression analysis, the relative expression level of cell surface markers CD11b, CD11c, and F4/80 genes was evaluated in blood cells from trained newborn goats with β-glucan from D. hansenii before and after challenge with LPS using Real-Time
3.1.3. The training of goat monocytes with β-glucan increased cell viability upon lipopolysaccharide challenge Goat trained monocytes with β-glucan from D. hansenii showed a higher (P < 0.05) proportion of live cells (77.7%) compared to PMA 3
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
Fig. 1. In vitro differentiation of goat monocytes. Images taken at: (A) day 0 (untreated), (B) and (C) control, day 4 and 6, respectively; (D) and (E) β-glucan from Debaryomyces hansenii, day 4 and 6, respectively; (F) and (G) phorbol myristate acetate (PMA), day 4 and 6, respectively. All pictures were taken using the × 40 magnification objective. (H) Timeline diagram of treatment and culture of goat monocytes.
3.2. In vivo evaluation of trained immunity in newborn goats
and control groups (58.9% and 49.3%, respectively) after LPS challenge (Fig. 3A).
3.2.1. Respiratory burst activity increased in blood cells of newborn goats treated with β-glucan from Debaryomyces hansenii after LPS challenge On pre-bleed day (−1), the activity of respiratory burst in blood cells of newborn goats stimulated with β-glucan from D. hansenii (β-Dh) was similar to the control group while this activity decreased (P < 0.05) in blood cells of goat kids stimulated with β-glucan from S. cerevisiae (β-Sc) compared to the other groups. After LPS challenge, the respiratory burst activity significantly increased in blood cells from
3.1.4. Phagocytic ability increased in β-glucan-trained and LPS-challenged goat monocytes The training of goat immune innate cells with β-glucan from D. hansenii showed a significant (P < 0.05) increase in the phagocytic ability (32.9%) compared to cells stimulated with PMA (23.1%) and the control cells (21%) after LPS challenge (Fig. 3B). 4
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
Fig. 2. Relative mRNA expression of (A) CD11b, (B) CD11c, (C) F4/80, and (D) IL-1β gene in goat monocytes stimulated with RPMI, β-glucan from D. hansenii, or phorbol-12-myristate-13-acetate (PMA) upon Lipopolysaccharide (LPS) challenge. Bars represent the mean ± SE. Different letters indicate significant (p < 0.05) difference among groups.
newborn goats of the β-Dh group with respect to the β-Sc and control groups (Fig. 4B).
and control groups. In addition, the concentration of IL-6 significantly decreased in newborn goats of β-Sc group challenged with LPS in comparison to the other groups.
3.2.2. Effect of training with β-glucans on nitric oxide production in plasma of newborn goats Fig. 4C shows that the nitric oxide production in plasma of goat kids of all treatments was unaffected in the two samplings (pre-bleed and after LPS challenge). However, nitric oxide levels had a tendency to increase in β-Dh and β-Sc groups (P < 0.065) upon LPS challenge.
3.2.5. Gene expression of cell surface markers increased in newborn goats orally trained with β-glucan from Debaryomyces hansenii after LPS challenge The expression of CD11b, CD11c, and F4/80 cell surface marker genes were evaluated. The transcription levels of CD11b and F4/80 genes were significantly up-regulated only in blood cells from newborn goats trained with β-glucan from D. hansenii and challenged with LPS with respect to the other groups (Fig. 6A and B). In contrast, the expression level of CD11c gene remained unaffected in blood cells from newborn goats (Fig. 6C).
3.2.3. Lysozyme activity in plasma of newborn goats β-glucan-trained and LPS challenged The results of the lysozyme activity in plasma indicated similar levels among groups and sampling times (pre-bleed and after LPS challenge) as shown in Fig. 4D.
4. Discussion 3.2.4. The training of newborn goats with oral doses of β-glucan from Debaryomyces hansenii enhanced cytokine concentrations in plasma Concentrations of IL-1β, IL-6 and TNF-α pro-inflammatory cytokines were analyzed. The concentration patterns of IL-1β and TNF-α had a similar behavior in the three treatments and the two samplings (pre-bleed and after LPS challenge; Fig. 5A and C). Higher IL-1β and TNF-α concentrations (P < 0.05) were found in the plasma of newborn goats orally dosed with β-Dh compared with other groups. The concentration of IL-6 in pre-bleed significantly decreased in the newborn goats trained with β-Dh compared with β-Sc and control groups (Fig. 5B). Nevertheless, upon LPS challenge, the IL-6 concentration was higher (P < 0.05) in newborns of the β-Dh group with respect to β-Sc
Currently, trained innate immunity has been widely described in mammals, such as mice and humans. Intraperitoneal doses of β-glucans have shown to induce trained immunity after re-stimulation with pathogens or PAMPs; however, the training effects of β-glucan oral doses are unknown. Besides, as previously mentioned newborn goats are susceptible to infections in the neonatal stage, which substantially contributes to losses for breeders (Singh et al., 2018); thus, the induction trained immunity may improve animal survival. In a recent study, β-glucan stimulation protected goat leukocytes against challenge with E. coli (Angulo et al., 2018). Therefore, this study describes the in vitro effects of immunological training by β-glucan from D. hansenii on 5
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
macrophages (i.e. CD11b) after challenge with LPS. In contrast, GarciaValtanen et al. (2017) observed that the levels of cell surface markers F4/80 and CD11b decreased with respect to the control group in murine monocytes trained with C. albicans-derived β-glucan. In addition, the relative expression of CD11c gene down-regulated in cells from the βDh group compared with other groups, which indicated that monocytes could not differentiate dendritic cells in agreement with results in murine monocytes trained with β-glucans from C. albicans (GarcíaValtanen et al., 2017). Considering that cell/animal survival after an infection is critical, this study analyzed cell viability of goat monocytes trained with βglucan from D. hansenii upon LPS challenge. Living cell percentage was higher in the β-Dh group that in the PMA and control groups, which suggested cellular induced protection against a challenge with LPS. In comparison, the number of dead cells was lower in murine macrophages trained with β-glucan from S. cerevisiae after LPS challenge than that in the control group (Walachowski et al., 2017). Moreover, GarciaValtanen (2017) detected that stimulation with C. albicans-derived βglucan aided in survival of monocytes from both human and mouse upon LPS challenge. In in vivo experiments, trained immunity in mice with non-lethal doses of C. albicans increased survival after challenge with lethal doses of the same pathogen (Saeed, 2014). Consistently, our results revealed that β-glucan from D. hansenii could aid on the survival of goat monocytes during the differentiation period and after the challenge with LPS. To assess the influence of trained immunity on effector mechanisms of innate immunity, phagocytic ability was evaluated. The results showed that training with D. hansenii-derived β-glucan on goat monocytes upon LPS challenge increased phagocytic ability in comparison with the PMA and control groups. Interestingly, Rizzetto et al. (2016) demonstrated that human cells trained with chitin from S. cerevisiae increased the percentage E. coli- and C. albicans-containing (phagolysosomes) monocytes with respect to the control (not trained) monocytes. Our findings evidenced a greater capacity of goat trained monocytes with β-glucan from D. hansenii to phagocytize, which could lead to protection against pathogens. Additionally, to find whether D. hansenii-derived β-glucan induced trained immunity in newborn goats, an in vivo experiment was performed. Neonates have a significant dependence on innate immune system (Wynn and Levy, 2010) and clinical evidence demonstrates trained immunity in newborns (Levy and Wynn, 2014). Newborn goats also critically depend on innate immunity in early life for their defense against microbial infections. Remarkably, trained immunity is the phenomenon of memory of innate immune function after a stimulus that is not specific to the original stimulus, and which do not depend of the specific adaptive immune system (Smith et al., 2017). Interestingly, fish and mammals (including human beings) having adaptive immunity have been used as test models. Therefore, trained immunity in neonatal goat model in this study could be associated with oral administration of β-glucan from D. hansenii. Respiratory burst activity (reactive oxygen species (ROS) production) and nitric oxide production are antimicrobial responses to pathogens, and these responses were triggered by the invasion of microorganisms. ROS formation leads to the activation of transcription factors (i.e. HIF1a) involved in metabolic cell reprogramming during trained immunity (Cheng et al., 2014). In this study respiratory burst activity increased in blood cells from newborn goats of the β-Dh group in comparison with other groups. In contrast, an in vitro study showed that ROS production was unaffected in human primary monocytes trained with C. albicans-derived β-glucan upon a challenge with LPS; interestingly, BCG or oxLDL (Oxidized low-density lipoprotein) increased ROS production in trained monocytes (Bekkering et al., 2016). Similarly, Sohrabi et al. (2018) demonstrated that human monocytes trained with oxLDL increased ROS formation upon a re-stimulation with Pam3cys. Differences in origin and chemical structure of yeast glucans are related with the biological outcomes of trained immunity in
Figure 3. β-Glucan from D. hansenii increased cell survival and phagocytic ability upon Lipopolysaccharide (LPS) challenge in goat monocytes. (A) Cell viability and (B) phagocytic ability in goat monocytes stimulated with RPMI, βglucan from Debaryomyces hansenii or phorbol myristate acetate (PMA) upon LPS challenge. Bars represent the mean ± SE. Different letters indicate significant (p < 0.05) difference among groups.
caprine monocytes as well as its in vivo effects using oral doses on newborn goats upon challenge with LPS. Immunological status (trained immunity or tolerance) can determine the functional fate of monocytes and macrophages after infection or vaccination (Saeed, 2014). In vitro, monocytes can differentiate morphologically macrophages/dendritic-like cells in five days. The typical small round shape of monocytes on day 0 changed during the subsequent days of differentiation to more elongated cells, such as typical morphologies of macrophages and dendritic cells. This differentiation was observed in all treatments (β-Dh, PMA and control). Furthermore, trained cells with β-glucan lead to epigenetic reprogramming of monocytes, which have beeb associated with cell shape and cell surface marker modifications (Ifrim et al., 2014). To complement cell differentiation analysis, transcription levels of cell surface marker genes were analyzed. The changes in the expression of these markers may contribute to an increase or decrease in innate immune responses during cell training (Ifrim et al., 2014). Upon LPS challenge, the expression levels of CD11b gene up-regulated in cells trained with β-glucan compared with control and PMA groups. This result suggested a greater number of undifferentiated monocytes in β-Dh group or that these monocytes expressed an abundant number of CD11b transcripts; nevertheless, some monocytes could become differentiated because CD11b marker is, albeit to a lesser extent, expressed in macrophages (Hickstein et al., 1992). Likewise, the relative level of F4/80 gene was up-regulated in both β-Dh and PMA groups with respect to the control group. The relative up-regulation of F4/80 gene expression proved that β-glucan from D. hansenii and positive differentiation control (PMA) could stimulate monocytes differentiation to macrophages. Similarly, Ifrim et al. (2014) demonstrated that most human monocytes trained with β-glucan from Candida albicans expressed cell surface markers of 6
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
Fig. 4. Innate immune parameters increased in blood cells of newborn goats treated with β-glucans from Debaryomyces hansenii upon Lipopolysaccharide (LPS) challenge. (A) Timeline of the β-glucan dosage schedule in the newborn goats in vivo experiment. (B) Respiratory burst activity, (C) Nitric oxide production, and (D) Lysozyme activity in blood cells from newborn goat kids stimulated with milk (control), β-glucan from D. hansenii, or β-glucan from S. cerevisiae at pre-bleed and upon Lipopolysaccharide (LPS) challenge. Bars represent the mean ± SE (n = 4). Different letters indicate significant (p < 0.05) difference among groups.
monocyte and macrophage trained functions, such as the inflammatory response (Forrester et al., 2018). One of the key features of trained innate cells is the ability to release proinflammatory cytokines in response to subsequent challenge with pathogens or PAMPs (Netea et al., 2015). In this study, the production of three proinflammatory cytokines: IL1-β, IL-6 and TNF-α was evaluated. IL1-β, IL-6 and TNF-α concentration increased in the plasma of newborn goats trained with oral doses of D. hansenii-derived β-glucan upon LPS challenge. Curiously, proinflammatory cytokine concentrations in plasma were unaffected in newborn goats stimulated with βglucan from S. cerevisiae. In contrast, Walachowski et al. (2017) observed in an in vitro assay that mouse macrophages trained with βglucan from S. cerevisae increased IL1-β, IL-6 and TNF-α production
human/mouse monocytes (Walachoswski et., 2017; Saed et al., 2014). In this study the tendency of nitric oxide production to increase in plasma from newborn goats was stimulated with β-glucan from D. hansenii and β-glucan from S. cerevisiae (commercial control) upon LPS challenge compared to the control group. Remarkably, Santecchia et al. (2019) observed in an in vivo study that peritoneal cells of mice trained with intraperitoneal doses of CL429 increased nitric oxide production after ex vivo challenge with leptospires or LPS. Thus, nitric oxide is a potent antimicrobial compound that has been linked to trained immunity. Overall, the respiratory burst activity and nitric oxide production seem play a crucial role on trained immunity, which in newborn goats stimulated with β-glucan from D. hansenii could be related to trigger antimicrobial responses against pathogens and regulate
7
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
Fig. 5. Cytokine levels of (A) IL-1β, (B) IL-6, and (C) TNF-α in plasma from newborn goats stimulated with milk (control), β-glucan from Debaryomyces hansenii, or β-glucan from S. cerevisiae at pre-bleed and upon Lipopolysaccharide (LPS) challenge. Bars represent the mean ± SE (n = 4). Different letters indicate significant (p < 0.05) difference among groups.
Fig. 6. Relative mRNA expression of (A) CD11b, (B) CD11c, and (C) F4/80 gene in blood cells from newborn goats stimulated with milk (control), β-glucan from Debaryomyces hansenii, or β-glucan from S. cerevisiae at pre-bleed and upon Lipopolysaccharide (LPS) challenge. Bars represent the mean ± SE (n = 4). Different letters indicate significant (p < 0.05) difference among groups.
upon a secondary stimulation with Pam3Cys. In another study, mice intraperitoneally injected with β-glucan from C. albicans and challenged with LPS resulted in an increased production of IL-6 and TNF-α serum cytokines (Garcia-Valtanen et al., 2017). Furthermore, Smith et al. (2017) found that IL-6 cytokine increased in whole blood of BCG vaccinated (trained) infants upon re-stimulation with Pam3Cys, heat-killed Candida albicans, or a lysate of Mycobacterium tuberculosis. On this regard, BCG-induced trained immunity in adults has been reported to primarily increase IL1-β, IL-6 and TNF-α cytokines (Kleinnijenhuis et al., 2012). In addition, Guerra-Maupome et al. (2019) showed an enhance of IL1-β, IL-6, and TNF-α cytokine production with aerosol BCG vaccination in young calves upon LPS or Pam3CSK4 re-stimulation. Accordingly, oral doses of D. hansenii-derived β-glucan in newborn goats induced trained immunity through enhanced cytokine production upon LPS challenge, which agreed with the trained immunity observed in mice and humans after parenteral administration of β-glucan or BCG. An interesting finding in this study was that the production of proinflammatory cytokines was unaffected in newborn goats stimulated with β-glucan from S. cerevisae, which suggested that D. hansenii-derived β-
glucan could have been a better option to induce innate memory in newborn goats. Additionally, transcription levels of same cell surface marker genes used in in vitro assay were analyzed in the in vivo experiment. The results confirmed that CD11b and F4/80 gene transcription up-regulated in blood cells from newborn goats stimulated with β-glucan from D. hansenii while expression CD11c gen was unaffected. As in vitro results discussed above, the in vivo studies also demonstrated that the expression of cell surface markers CD11b and F4/80 increased as previously reported in human or murine models trained with BCG or CL429, respectively (Kleinnijenhuis et al., 2012; Santecchia et al., 2019).
5. Conclusion Overall, β-glucan from D. hansenii may facilitate and prepare goat monocytes to respond against LPS challenge by increasing cell 8
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
protection (cell viability) through an enhanced phagocytic ability. In vivo, training with oral doses of D. hansenii-derived β-glucan induced a fast response in terms of enhanced respiratory burst activity, proinflammatory cytokine production, and transcription of cell surface macrophage markers. This study has demonstrated for the first time that trained immunity was induced with oral doses of β-glucan upon LPS challenge in mammals using newborn goats.
2105–2109. Ifrim, D.C., Quintin, J., Joosten, L.A., Jacobs, C., Jansen, T., Jacobs, L., Netea, M.G., 2014. Trained immunity or tolerance: opposing functional programs induced in human monocytes after engagement of various pattern recognition receptors. Clin. Vaccine Immunol. 21 (4), 534–545. Kemenade, B.M.L.V., Groeneveld, A., Rens, B.T.T.M., Rombout, J.H.W.M., 1994. Characterization of macrophages and neutrophilic granulocytes from the pronephros of carp (Cyprinus carpio). J. Exp. Biol. 187 (1), 143–158. Kleinnijenhuis, J., Quintin, J., Preijers, F., Joosten, L.A., Ifrim, D.C., Saeed, S., Xavier, R.J., 2012. Bacille Calmette-Guerin induces NOD2-dependent nonspecific protection from reinfection via epigenetic reprogramming of monocytes. Proc. Natl. Acad. Sci. U. S. A. 109 (43), 17537–17542. Levy, O., Wynn, J.L., 2014. A prime time for trained immunity: innate immune memory in newborns and infants. Neonatology 105 (2), 136–141. Litwack, G., 1995. Photometric determination of lysozyme activity. Proc. Soc. Exp. Biol. Med. 89 (3), 401–403. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25 (4), 402–408. Netea, M.G., Latz, E., Mills, K.H., O'Neill, L.A., 2015. Innate immune memory: a paradigm shift in understanding host defense. Nat. Immunol. 16, 675–679. Neumann, N.F., Fagan, D., Belosevi, M., 1995. Macrophage activating factor (s) secreted by mitogen stimulated goldfish kidney leukocytes synergize with bacterial lipopolysaccharide to induce nitric oxide production in teleost macrophages. Dev. Comp. Immunol. 19 (6), 473–482. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29 (9), 45. Quintin, J., Saeed, S., Martens, J.H., Giamarellos-Bourboulis, J., Ifrim, D.C., Logie, C., Joosten, L.A., 2012. Candida albicans infection affords protection against reinfection via functional reprogramming of monocytes. Cell Host Microbe 12 (2), 223–232. Rizzetto, L., Ifrim, D.C., Moretti, S., Tocci, N., Cheng, S.C., Quintin, J., Blok, B.A., 2016. Fungal chitin induces trained immunity in human monocytes during cross-talk of the host with Saccharomyces cerevisiae. J. Biol. Chem. 291 (15), 7961–7972. Rodríguez, A., Esteban, M., Meseguer, J., 2003. Phagocytosis and peroxidase release by seabream (Sparus aurata L.) leucocytes in response to yeast cells. Anat. Rec. 272 (1), 415–423. Saeed, S., Quintin, J., Kerstens, H.H., Rao, N.A., Aghajanirefah, A., Matarese, F., . Epigenetic programming of monocyte-to-macrophage differentiation and trained innate immunity. Science. 345 (6204), 1251086. Santecchia, I., Vernel-Pauillac, F., Rasid, O., Quintin, J., Gomes-Solecki, M., Boneca, I.G., Werts, C., 2019. Innate immune memory through TLR2 and NOD2 contributes to the control of Leptospira interrogans infection. PLoS Pathog. 15 (5), e1007811. Schrum, J.E., Crabtree, J.N., Dobbs, K.R., Kiritsy, M.C., Reed, G.W., Gazzinelli, R.T., Golenbock, D.T., 2018. Cutting edge: Plasmodium falciparum induces trained innate immunity. J. Immunol. 200 (4), 1243–1248. Singh, D.D., Pawaiya, R.V.S., Gururaj, K., Gangwar, N.K., Mishra, A.K., Singh, R., Kumar, A., 2018. Detection of Clostridium perfringens toxinotypes, enteropathogenic E. coli, Rota and corona viruses in the intestine of neonatal goat kids by molecular techniques. Indian J. Anim. Res. 88 (6), 655–661. Smith, S.G., Kleinnijenhuis, J., Netea, M.G., Dockrell, H.M., 2017. Whole blood profiling of bacillus Calmette–Guérin-induced trained innate immunity in infants identifies epidermal growth factor, IL-6, platelet-derived growth factor-AB/BB, and natural killer cell activation. Front. Immunol. 8, 644. Sohrabi, Y., Lagache, S.M., Lucia, S., Godfrey, R., Kahlesc, F., Bruemmer, D., Findeisen, H., 2018. mTOR-dependent oxidative stress regulates oxLDL-induced trained innate immunity in human monocytes. Front. Immunol. 9, 3155. Tourais-Esteves, I., Bernardet, N., Lacroix-Lamande, S., Ferret-Bernard, S., Laurent, F., 2008. Neonatal goats display a stronger TH1-type cytokine response to TLR ligands than adults. Dev. Comp. Immunol. 32 (10), 1231–1241. Walachowski, S., Tabouret, G., Fabre, M., Foucras, G., 2017. Molecular analysis of a shortterm model of β-glucans-trained immunity highlights the accessory contribution of GM-CSF in priming mouse macrophages response. Front. Immunol. 8, 1089. Wynn, J.L., Levy, O., 2010. Role of innate host defenses in susceptibility to early-onset neonatal sepsis. Clin. Perinatol. 37 (2), 307–337.
Declaration of competing interest The authors have no financial conflicts of interest. Acknowledgments This research was financially supported by grants from CONACYT, Mexico (INFR-2014-01/225924 and PDCPN2014-01/248033). The authors thank Juan Manuel Melero for facilitating goat blood samples and Margarita Mendoza Cruz from UABCS for help provided in blood sampling newborn goats during the bioassay and also appreciate Diana Fischer for editorial services. References Alexander, M.P., Fiering, S.N., Ostroff, G.R., Cramer, R.A., Mullins, D.W., 2016. Betaglucan-induced trained innate immunity mediates antitumor efficacy in the mouse lung. J. Immunol. 196 142-24. Angulo, M., Reyes-Becerril, M., Tovar-Ramírez, D., Ascencio, F., Angulo, C., 2018. Debaryomyces hansenii CBS 8339 β-glucan enhances immune responses and downstream gene signaling pathways in goat peripheral blood leukocytes. Dev. Comp. Immunol. 88, 173–182. Angulo, M., Reyes-Becerril, M., Cepeda-Palacios, R., Tovar-Ramírez, D., Esteban, M.Á., Angulo, C., 2019. Probiotic effects of marine Debaryomyces hansenii CBS 8339 on innate immune and antioxidant parameters in newborn goats. Appl. Microbiol. Biotechnol. 103 (5), 2339–2352. Arts, R.J., Blok, B.A., Aaby, P., Joosten, L.A., de Jong, D., van der Meer, J.W., Netea, M.G., 2015. Long‐term in vitro and in vivo effects of γ‐irradiated BCG on innate and adaptive immunity. J. Leukoc. Biol. 98 (6), 995–1001. Bekkering, S., Blok, B.A., Joosten, L.A., Riksen, N.P., van Crevel, R., Netea, M.G., 2016. In vitro experimental model of trained innate immunity in human primary monocytes. Clin. Vaccine Immunol. 23 (12), 926–933. Blok, B.A., Jensen, K.J., Aaby, P., Fomsgaard, A., van Crevel, R., Benn, C.S., Netea, M.G., 2019. Opposite effects of Vaccinia and modified Vaccinia Ankara on trained immunity. Eur. J. Clin. Microbiol. Infect. Dis. 38 (3), 449–456. Cheng, S.C., Quintin, J., Cramer, R.A., Shepardson, K.M., Saeed, S., Kumar, V., 2014. mTOR- and HIF-1alpha-mediated aerobic glycolysis as metabolic basis for trained immunity. Science 345 (6204), 1250684. Forrester, S.J., Kikuchi, D.S., Hernandes, M.S., Xu, Q., Griendling, K.K., 2018. Reactive oxygen species in metabolic and inflammatory signaling. Circ. Res. 122 (6), 877–902. Garcia‐Valtanen, P., Guzman‐Genuino, R.M., Williams, D.L., Hayball, J.D., Diener, K.R., 2017. Evaluation of trained immunity by β‐1, 3 (d)‐glucan on murine monocytes in vitro and duration of response in vivo. Immunol. Cell Biol. 95 (7), 601–610. Guerra-Maupome, M., Vang, D.X., McGill, J.L., 2019. Aerosol vaccination with Bacille Calmette-Guerin induces a trained innate immune phenotype in calves. PLoS One 14 (2), e0212751. Hickstein, D.D., Baker, D.M., Gollahon, K.A., Back, A.L., 1992. Identification of the promoter of the myelomonocytic leukocyte integrin CD11b. Proc. Natl. Acad. Sci. 89 (6),
9
Contents lists available at ScienceDirect
Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/devcompimm
Oral administration of Debaryomyces hansenii CBS8339-β-glucan induces trained immunity in newborn goats
T
Miriam Anguloa, Martha Reyes-Becerrila, Ramón Cepeda-Palaciosb, Carlos Anguloa,∗ a
Immunology & Vaccinology Group, Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Av. Instituto Politécnico Nacional 195, Playa Palo de Santa Rita Sur, La Paz, B.C.S., 23096, Mexico b Laboratorio de Sanidad Animal, Universidad Autónoma de Baja California Sur, Carretera al Sur km. 5.5, Col. Mezquitito, La Paz, B.C.S., 23080, Mexico
A R T I C LE I N FO
A B S T R A C T
Keywords: Ruminant Innate immune memory Marine yeast Polysaccharides Pathogen
Beta-glucans from yeast can induce trained immunity in in vitro and in vivo models. Intraperitoneal doses of βglucans in mammals have shown to induce trained immunity, but the training effects of orally administering βglucans are unknown. Newborn goats are susceptible to infections in the neonatal stage, so the induction of trained immunity could improve animal survival. This study aimed to describe the in vitro effects of immunological training by β-glucan from Debaryomyces hansenii (β-Dh) on caprine monocytes, as well as its in vivo effects using oral doses on newborn goats upon challenge with lipopolysaccharide (LPS). Hence in vitro, goat monocytes trained with β-Dh up-regulated the gene expression of macrophage surface markers (CD11b and F4/ 80) whereas enhanced cell survival and high phagocytic ability was found upon LPS challenge. In the in vivo experiment, newborn goats stimulated with two doses (day −7 and - 4) of β-Dh (50 mg/kg) and challenged (day 0) with LPS showed an increase in respiratory burst activity, IL-1β, IL-6, and TNFα production in plasma, and transcription of the macrophage surface markers. This study has demonstrated for the first time that trained immunity was induced with oral doses of β-glucan upon LPS challenge in mammals using newborn goats.
1. Introduction Trained immunity has been described as the ability of the innate immune system to enhance the response against a re-infection/stimulation with the same or different pathogen or pathogen-associated molecular patterns (PAMPs) (Netea et al., 2015). This concept has been widely described in plants and invertebrate animals. Recently, scientific evidence of cellular and molecular mechanisms has been found in mammals, such as mice and humans (Ifrim et al., 2014, Kleinnijenhuis et al., 2014). Stimuli that induce trained immunity are Bacille CalmetteGuérin (BCG) vaccine, Vaccinia Ankara, chimeric compounds (i.e. CL429), Plasmodium falciparum and yeast cell wall components, such as chitins and β-glucans (Arts et al., 2015; Blok et al., 2019; Schrum et al., 2018; Santecchia et al., 2019; Rizzetto et al., 2016; García-Valtanen et al., 2017), among others. Beta-glucans are polysaccharides that have well-known immunomodulatory effects. In this context, only those from Saccharomyces cerevisiae and Candida albicans have been tested and induced trained immunity in monocytes and macrophages of murine and human models (García-Valtanen et al., 2017; Bekkering et al., 2016; Alexander et al.,
2016). Trained monocytes and macrophages increased pro- and antiinflammatory cytokines by β-glucan in both in vitro and in vivo evaluations; and the trained mechanisms were associated with epigenetic and metabolic reprogramming of cells, which were mainly stable changes in histone trimethylation at H3K4 and increases in glycolysisdependent activation of mammalian target of rapamycin (mTOR) regulator, respectively (Quintin et al., 2012; Cheng et al., 2014). Remarkably, the functional monocyte reprogramming has also been associated with cell shape and cell surface marker modifications (Ifrim et al., 2014). The effects of yeast-derived β-glucans on trained immunity upon secondary stimulation in mice have been assessed by intraperitoneal administrations (Walachowski et al., 2017; García-Valtanen et al., 2017) while the effects of oral administration of β-glucans are unknown. On the other hand, in all animal species, the neonatal stage is a critical period sensitive to infections because of immune system immaturity, including caprine species (Tourais-Esteves et al., 2008). In this stage, newborn goats are in contact with different pathogens that cause infections and death (Singh et al., 2018). Recently, our research
∗ Corresponding author. Centro de Investigaciones Biológicas del Noroeste, S.C., Instituto Politécnico Nacional #195, Col. Playa Palo de Santa Rita, La Paz C.P., 23090, BCS, Mexico. E-mail address: [email protected] (C. Angulo).
https://doi.org/10.1016/j.dci.2019.103597 Received 1 October 2019; Received in revised form 26 November 2019; Accepted 21 December 2019 Available online 25 December 2019 0145-305X/ © 2019 Elsevier Ltd. All rights reserved.
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
group found that β-glucans from the marine yeast Debaryomyces hansenii CBS 8339 increased innate immune parameters in goat leukocytes before and upon challenge with Escherichia coli (Angulo et al., 2018). Thus, the induction of trained immunity in newborn goats could improve survival against infections; curiously, oral administration of D. hansenii CBS 8339 also enhanced their innate immune parameters (Angulo et al., 2019). Accordingly, this study aimed to examine whether oral stimuli with β-glucans from D. hansenii CBS8339 could induce trained immunity in caprine monocytes (in vitro) and newborn goats (in vivo) upon challenge with lipopolysaccharide (LPS) from E. coli.
USA). The transcriptional level of each target gene was corrected by the Eukaryotic initiation factor 2 (EIF2). The relative mRNA of each target gene in the treated groups versus the control group was calculated by Pfaffl equation (Pfaffl, 2001). Data for real-time PCR are expressed as the fold increase (mean ± standard error, SE). The values higher than 1 in the level of a gene express an increase, while values lower than 1 in the level of a gene express a decrease. 2.2.3. Cell viability Evaluation of cell viability of goat monocytes trained with β-glucan upon LPS challenge was performed using propidium iodide (PI) staining assay by flow cytometry. Briefly, 500 μl of goat cells trained were centrifuged (1500 rpm, 10 min), and the supernatant was discarded. Later, 400 μl of binding buffer and 5 μl of PI were added, mixed, and the cells were incubated in darkness for 15 min. After that, 400 μl of binding buffer were added, and the mix was filtrated by 40-μm sieves to fluorescence-activated cell sorting tubes (FACS, Becton and Dickinson, Mountain View, CA, USA). All samples were analyzed using a flow cytometer (S3e Cell Sorter, Biorad, Hercules, CA, USA), and PI was detected using red fluorescence (FL-3) detector. The results were expressed as live cell percentages.
2. Materials and methods 2.1. Glucan extraction Debaryomyces hansenii strain CBS 8339 was inoculated in 35 L of Yeast Peptone Dextrose broth (Sigma, St. Louis MO, USA) and incubated under agitation (150 rpm) at 30 °C for 48 h. The cell biomass was recovered by centrifugation (5000 rpm, 4 °C, 15 min) and lyophilized (FreeZone 18, LABCONCO, Kansas City, MO, USA) for 24 h. The glucan was extracted according to the methodology previously described by Angulo et al. (2018).
2.2.4. Phagocytic ability The phagocytic ability to engulf S. cerevisiae (strain S288C) was determined in goat trained monocytes with β-glucan from D. hansenii CBS 8339 after LPS challenge by flow cytometry (Rodríguez et al., 2003). S. cerevisiae cells were labeled with 5-([4,6-Dichlorotriazin-2-yl] amino) fluorescein hydrochloride (DTAF; Sigma, St. Louis, MO, USA) following the methodology performed by Angulo et al. (2018). Then, 60 μl of labeled-yeast cells were added to 100 μl (1 × 106 cells/ml) of trained monocytes, mixed by pipetting, and incubated at 22 °C for 30 min. After incubation, phagocytosis was stopped placing samples on ice, and 400 μl ice-cold phosphate buffered saline (PBS, pH 7.2) were added to each sample. The fluorescence of the non-phagocyted yeast cells was quenched by the addition of 40 μl of ice-cold trypan blue (0.4% in PBS). All samples were analyzed in a flow cytometer (S3e Cell Sorter, Biorad, Hercules, CA, USA) set to determine the phagocytic cells showing the highest forward scatter (FSC) and moderate side scatter (SSC). Phagocytic ability was expressed as the percentage of phagocytic cells.
2.2. In vitro evaluation 2.2.1. Isolation and stimulation of goat monocytes Goat peripheral blood monocytes were isolated by using Human Whole Blood Monocytes Isolation Kit (Bio Vision, Milpitas, CA, USA) and performed according to the instructions provided by the manufacturer. Thereafter, monocytes were resuspended in RPMI 1640 medium (Sigma, St. Louis, MO, USA) supplemented with fetal bovine serum (10%, Gibco, Grand Island, NY, USA), penicillin-streptomycin (100 IU/ml-100 mg/ml), and glutamine (1%). One ml of monocytes (1 × 106 cells/ml) were placed in both 24-well plates and 4-well culture slides (Corning, NY, USA) allowing adhesion at 37 °C for 1 h. After incubation, the media were removed and replaced as follows: 1 ml of the same medium (control); 1 ml of medium containing 5 μg of β-glucan from D. hansenii CBS 8339 (β-Dh); 1 ml of medium containing 20 ng of phorbol-12-myristate-13-acetate (PMA). After 24 h, the cells were washed with prewarmed (37 °C) RPMI medium; then, 1 ml of supplemented RPMI was placed in each well. Subsequently, the monocytes were incubated for five days to allow cell differentiation, in which cells were refreshed with a new medium at day 3 post-incubation. At the end of the cell differentiation period, culture media were removed, and monocytes were challenged with 1 ml RPMI medium containing 10 ng of LPS (Sigma, St. Louis, MO, USA). Supernatants from 24-well plates were collected at 24 h after challenge for gene expression, viability, and phagocytosis analyses. The cells placed in 4-well slide culture were stained with Giemsa (Sigma, St. Louis, MO, USA) and analyzed for morphological differentiation under Olympus Bx41 optic microscope (Olympus, America Inc., Melville, NY, USA).
2.3. In vivo evaluation 2.3.1. Animal feeding and sampling This experiment was carried out in the Sheep and Goat Research Unit of the Universidad Autonoma de Baja California Sur (UABCS), Mexico, and conducted in accordance with UABCS bioethical committee. Twelve Saanen × Nubian crossbred newborn males (3.56 ± 0.58 kg body weight) were divided into three experimental groups in separate pens of the Research Unit. At birth, each newborn goat was weighed, identified with a tag on the neck, and the umbilical cord was disinfected. Newborns were kept in stable conditions with free access to breast milk during the experimental trial (8 days). The experimental groups consisted of (1) Control (n = 4), (2) βglucan of D. hansenii (β-Dh, n = 4) and (3) β-glucan of S. cerevisiae (βSc, n = 4). Following the schedule described in Fig. 4A newborn goats of groups β-Dh and β-Sc were orally treated with two doses of 50 mg/kg of live body weight of β-glucan from D. hansenii and β-glucan from S. cerevisiae, respectively. The β-Dh and β-Sc doses were administered in 1 ml of goat's breast milk on days −7 and −4 using a syringe (3 ml). Each newborn in the control group received only 1 ml of goat's breast milk. Peripheral blood was obtained from each newborn on day −1 (pre-bleed) to evaluate the pre-existing immunological parameters. On day 0, all the goat kids were intraperitoneally injected with 1 ml of a solution containing 12.5 μg/kg live body weight of LPS in saline solution (0.85% NaCl). Blood was obtained from each goat kid at 2.5 h after
2.2.2. Gene expression The relative expression levels of cell surface markers (CD11b, CD11c and F4/80) and cytokine proinflammatory (IL-1β) genes were evaluated in goat trained monocytes with β-glucan from D. hansenii and challenged with LPS using real-time polymerase chain reaction (PCR) and the 2−ΔΔCT method (Livak and Schmittgen, 2001). The primers used in this study are listed in Table 1. Total RNA was extracted with TRIzol reagent (Life Technologies, Carlsbad, CA, USA) and treated with amplification grade DNase I (1 U/mg RNA, Life Technologies, Carlsbad, CA, USA). The first-strand cDNA was synthesized with ImProm-II™ Reverse Transcription System (Promega, Madison, WI, USA) following the manufacturer's instructions. Real-Time PCR was performed with a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) using Ssofast™ EVAGreen® Super Mix (Bio-Rad, Hercules, CA, 2
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
Table 1 Sequences of the primers used in this study of trained immunity by oral doses of D. hansenii-derived β-glucan in newborn goats. Gene
Abbreviation
Length of product (pb)
Accession No.
Primer sequence (5′– 3′)
Integrin subunit alpha M
CD11b
193
XM_05697735.3
F4/80
F4/80
198
NM_018050945.1
Integrin subunit alpha X
CD11c
194
XM_018040559.1
18S RNA
18s
100
DQ149973.1
Eukaryotic translation initiation factor 2B subunit beta
EIF2B2
180
XM_013967316.2
GAGAAAAACGCTGAAATCAAGG CATCACACTTCCACTTAGCTCTC GTGGAAATGCAGTATCTCGC CATTGCACTGAGATCTGTTGTC CAAAGCATTGTGACATTTGAC AAGTTGAGACGCAAGATGATG TCGGGGATTGCAATTATTC ACGGGCGGTGTGTACAAA ACAACGGAGAACATCGCAG ATTGACTGCCATCTCATGACC
PCR and the 2−ΔΔCT method (Table 1). The transcriptional level of each target gene was corrected by the 18s gene. The relative mRNA of each target gene in the treated groups versus the control group was calculated by Pfaffl equation (Pfaffl, 2001). Data for real-time PCR were expressed as fold increase (mean ± standard error, SE). Values higher than 1 in the level of a gene express an increase, while values lower than 1 in the level of a gene express a decrease.
LPS injection in BD Vacutainer® tubes with sodium heparin (Franklin Lakes, NJ, USA). Three ml of blood was used for respiratory burst activity and RNA extraction; while 2 ml of blood were allocated for plasma separation by centrifugation (500 g, 10 min) for nitric oxide production, lysozyme activity analysis, and cytokine production. 2.3.2. Respiratory burst The respiratory burst activity of goat monocytes was measured as the production of reactive oxygen intermediates using the nitro blue tetrazolium (NBT) reduction according to Kemenade et al. (1994). Fifty μl of blood were placed in 96-well plates and incubated at 37 °C for 1 h to allow cell adhesion. After incubation, NBT solution (1 mg/ml; Sigma, St. Louis, MO, USA) was added to each well and incubated in darkness for 2 h. Later, cells were washed with PBS and incubated with methanol (70% v/v) for 10 min. Subsequently, cells were washed and resuspended in 2M KOH-DMSO. The optical density (OD) was read at 655 nm in a microplate reader (BioRad, Model 3550 UV, Hercules, CA, USA).
2.4. Statistical analysis All data were performed by triplicate, and the mean ± standard error (SE) for each treatment was calculated. A one-way ANOVA was used to analyze the training of immune cells of goat kids with β-glucan from D. hansenii before and/or upon challenge with LPS using SPSS v.19.0 software (SPSS, Richmond, VA, USA). Means were separated by Duncan multiple range test. Differences were considered significant at P < 0.05. 3. Results
2.3.3. Nitric oxide production The nitric oxide production was determined according to Neumann et al. (1995). Briefly, 100 μl of plasma were incubated with 100 μl of Griess reagent in a 96-well plate, mixed, and incubated at room temperature in dark for 15 min. The OD was read at 562 nm in a microplate reader (3550UV, BioRad, Hercules, CA, USA). The data were expressed in nitrite concentration (μM).
3.1. In vitro evaluation of trained immunity 3.1.1. Goat trained monocytes with β-glucan from Debaryomyces hansenii morphologically differentiated to macrophages-like cells Goat monocytes were stimulated with β-glucan from D. hansenii CBS 8339 for 24 h. After this period, the cells were subjected to a period of differentiation for five days. On day 0, monocytes with the typical round morphology were observed while on day four and six, differentiation of larger cells and often-elongated morphology were observed in all treatments, showing a classical macrophage morphology (Fig. 1).
2.3.4. Lysozyme activity The lysozyme activity was evaluated in plasma following the methodology of Litwack (1995) with slight modifications. Briefly, 25 μl of standards and plasma samples were dispensed into 96-well plates per triplicate and 175 μl of Micrococcus lysodeikticus (75 mg/ml; M3770, Sigma, St. Louis, MO, USA) were added. Immediately, the plate was read at 450 nm in a microplate reader (BioRad, Model 3550 UV, Hercules, CA, USA). Serial dilutions of Hen egg white lysozyme (FIEWL) (Sigma, St. Louis, MO, USA) in phosphate/citrate buffer (0.1 M) were used at 0, 2.5, 5, 10, and 20 μg/ml for the standard curve. The lysozyme activity was calculated in each plasma sample from the standard curve.
3.1.2. Relative expression of macrophage cell surface marker genes upregulated in β–glucan and phorbol myristate acetate trained cells The transcriptional level of three cell surface marker genes was analyzed: CD11b gene mainly expressed in monocytes, CD11c gene predominantly expressed in dendritic cells, and F4/80 gene principally expressed in macrophages. After re-stimulation with LPS, the expression level of CD11b gene significantly increased only in the β-Dh group compared to the control and phorbol myristate acetate (PMA) groups (Fig. 2A). Moreover, the mRNA levels of F4/80 gene up-regulated (P < 0.05) in trained cells with β-glucan and PMA compared with the control group (Fig. 2B). In contrast, the relative expression of CD11c gene down-regulated (P < 0.05) in trained cells with β-glucan with respect to the control and PMA groups (Fig. 2C) whereas the expression of the proinflammatory cytokine IL-1β gene was similar among groups (Fig. 2D).
2.3.5. Goat cytokine detections by enzyme-linked ImmunoSorbent assay ELISA goat cytokine kits (MyBiosource, San Diego, CA, USA) were used to detected IL-1β (MBS1601368), IL-6 (MBS7606893), and TNF-α (MBS263127). Each cytokine concentration was determined using a standard curve following recombinant cytokine standards provided by the kit. 2.3.6. Gene expression analysis Same as in the in vitro gene expression analysis, the relative expression level of cell surface markers CD11b, CD11c, and F4/80 genes was evaluated in blood cells from trained newborn goats with β-glucan from D. hansenii before and after challenge with LPS using Real-Time
3.1.3. The training of goat monocytes with β-glucan increased cell viability upon lipopolysaccharide challenge Goat trained monocytes with β-glucan from D. hansenii showed a higher (P < 0.05) proportion of live cells (77.7%) compared to PMA 3
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
Fig. 1. In vitro differentiation of goat monocytes. Images taken at: (A) day 0 (untreated), (B) and (C) control, day 4 and 6, respectively; (D) and (E) β-glucan from Debaryomyces hansenii, day 4 and 6, respectively; (F) and (G) phorbol myristate acetate (PMA), day 4 and 6, respectively. All pictures were taken using the × 40 magnification objective. (H) Timeline diagram of treatment and culture of goat monocytes.
3.2. In vivo evaluation of trained immunity in newborn goats
and control groups (58.9% and 49.3%, respectively) after LPS challenge (Fig. 3A).
3.2.1. Respiratory burst activity increased in blood cells of newborn goats treated with β-glucan from Debaryomyces hansenii after LPS challenge On pre-bleed day (−1), the activity of respiratory burst in blood cells of newborn goats stimulated with β-glucan from D. hansenii (β-Dh) was similar to the control group while this activity decreased (P < 0.05) in blood cells of goat kids stimulated with β-glucan from S. cerevisiae (β-Sc) compared to the other groups. After LPS challenge, the respiratory burst activity significantly increased in blood cells from
3.1.4. Phagocytic ability increased in β-glucan-trained and LPS-challenged goat monocytes The training of goat immune innate cells with β-glucan from D. hansenii showed a significant (P < 0.05) increase in the phagocytic ability (32.9%) compared to cells stimulated with PMA (23.1%) and the control cells (21%) after LPS challenge (Fig. 3B). 4
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
Fig. 2. Relative mRNA expression of (A) CD11b, (B) CD11c, (C) F4/80, and (D) IL-1β gene in goat monocytes stimulated with RPMI, β-glucan from D. hansenii, or phorbol-12-myristate-13-acetate (PMA) upon Lipopolysaccharide (LPS) challenge. Bars represent the mean ± SE. Different letters indicate significant (p < 0.05) difference among groups.
newborn goats of the β-Dh group with respect to the β-Sc and control groups (Fig. 4B).
and control groups. In addition, the concentration of IL-6 significantly decreased in newborn goats of β-Sc group challenged with LPS in comparison to the other groups.
3.2.2. Effect of training with β-glucans on nitric oxide production in plasma of newborn goats Fig. 4C shows that the nitric oxide production in plasma of goat kids of all treatments was unaffected in the two samplings (pre-bleed and after LPS challenge). However, nitric oxide levels had a tendency to increase in β-Dh and β-Sc groups (P < 0.065) upon LPS challenge.
3.2.5. Gene expression of cell surface markers increased in newborn goats orally trained with β-glucan from Debaryomyces hansenii after LPS challenge The expression of CD11b, CD11c, and F4/80 cell surface marker genes were evaluated. The transcription levels of CD11b and F4/80 genes were significantly up-regulated only in blood cells from newborn goats trained with β-glucan from D. hansenii and challenged with LPS with respect to the other groups (Fig. 6A and B). In contrast, the expression level of CD11c gene remained unaffected in blood cells from newborn goats (Fig. 6C).
3.2.3. Lysozyme activity in plasma of newborn goats β-glucan-trained and LPS challenged The results of the lysozyme activity in plasma indicated similar levels among groups and sampling times (pre-bleed and after LPS challenge) as shown in Fig. 4D.
4. Discussion 3.2.4. The training of newborn goats with oral doses of β-glucan from Debaryomyces hansenii enhanced cytokine concentrations in plasma Concentrations of IL-1β, IL-6 and TNF-α pro-inflammatory cytokines were analyzed. The concentration patterns of IL-1β and TNF-α had a similar behavior in the three treatments and the two samplings (pre-bleed and after LPS challenge; Fig. 5A and C). Higher IL-1β and TNF-α concentrations (P < 0.05) were found in the plasma of newborn goats orally dosed with β-Dh compared with other groups. The concentration of IL-6 in pre-bleed significantly decreased in the newborn goats trained with β-Dh compared with β-Sc and control groups (Fig. 5B). Nevertheless, upon LPS challenge, the IL-6 concentration was higher (P < 0.05) in newborns of the β-Dh group with respect to β-Sc
Currently, trained innate immunity has been widely described in mammals, such as mice and humans. Intraperitoneal doses of β-glucans have shown to induce trained immunity after re-stimulation with pathogens or PAMPs; however, the training effects of β-glucan oral doses are unknown. Besides, as previously mentioned newborn goats are susceptible to infections in the neonatal stage, which substantially contributes to losses for breeders (Singh et al., 2018); thus, the induction trained immunity may improve animal survival. In a recent study, β-glucan stimulation protected goat leukocytes against challenge with E. coli (Angulo et al., 2018). Therefore, this study describes the in vitro effects of immunological training by β-glucan from D. hansenii on 5
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
macrophages (i.e. CD11b) after challenge with LPS. In contrast, GarciaValtanen et al. (2017) observed that the levels of cell surface markers F4/80 and CD11b decreased with respect to the control group in murine monocytes trained with C. albicans-derived β-glucan. In addition, the relative expression of CD11c gene down-regulated in cells from the βDh group compared with other groups, which indicated that monocytes could not differentiate dendritic cells in agreement with results in murine monocytes trained with β-glucans from C. albicans (GarcíaValtanen et al., 2017). Considering that cell/animal survival after an infection is critical, this study analyzed cell viability of goat monocytes trained with βglucan from D. hansenii upon LPS challenge. Living cell percentage was higher in the β-Dh group that in the PMA and control groups, which suggested cellular induced protection against a challenge with LPS. In comparison, the number of dead cells was lower in murine macrophages trained with β-glucan from S. cerevisiae after LPS challenge than that in the control group (Walachowski et al., 2017). Moreover, GarciaValtanen (2017) detected that stimulation with C. albicans-derived βglucan aided in survival of monocytes from both human and mouse upon LPS challenge. In in vivo experiments, trained immunity in mice with non-lethal doses of C. albicans increased survival after challenge with lethal doses of the same pathogen (Saeed, 2014). Consistently, our results revealed that β-glucan from D. hansenii could aid on the survival of goat monocytes during the differentiation period and after the challenge with LPS. To assess the influence of trained immunity on effector mechanisms of innate immunity, phagocytic ability was evaluated. The results showed that training with D. hansenii-derived β-glucan on goat monocytes upon LPS challenge increased phagocytic ability in comparison with the PMA and control groups. Interestingly, Rizzetto et al. (2016) demonstrated that human cells trained with chitin from S. cerevisiae increased the percentage E. coli- and C. albicans-containing (phagolysosomes) monocytes with respect to the control (not trained) monocytes. Our findings evidenced a greater capacity of goat trained monocytes with β-glucan from D. hansenii to phagocytize, which could lead to protection against pathogens. Additionally, to find whether D. hansenii-derived β-glucan induced trained immunity in newborn goats, an in vivo experiment was performed. Neonates have a significant dependence on innate immune system (Wynn and Levy, 2010) and clinical evidence demonstrates trained immunity in newborns (Levy and Wynn, 2014). Newborn goats also critically depend on innate immunity in early life for their defense against microbial infections. Remarkably, trained immunity is the phenomenon of memory of innate immune function after a stimulus that is not specific to the original stimulus, and which do not depend of the specific adaptive immune system (Smith et al., 2017). Interestingly, fish and mammals (including human beings) having adaptive immunity have been used as test models. Therefore, trained immunity in neonatal goat model in this study could be associated with oral administration of β-glucan from D. hansenii. Respiratory burst activity (reactive oxygen species (ROS) production) and nitric oxide production are antimicrobial responses to pathogens, and these responses were triggered by the invasion of microorganisms. ROS formation leads to the activation of transcription factors (i.e. HIF1a) involved in metabolic cell reprogramming during trained immunity (Cheng et al., 2014). In this study respiratory burst activity increased in blood cells from newborn goats of the β-Dh group in comparison with other groups. In contrast, an in vitro study showed that ROS production was unaffected in human primary monocytes trained with C. albicans-derived β-glucan upon a challenge with LPS; interestingly, BCG or oxLDL (Oxidized low-density lipoprotein) increased ROS production in trained monocytes (Bekkering et al., 2016). Similarly, Sohrabi et al. (2018) demonstrated that human monocytes trained with oxLDL increased ROS formation upon a re-stimulation with Pam3cys. Differences in origin and chemical structure of yeast glucans are related with the biological outcomes of trained immunity in
Figure 3. β-Glucan from D. hansenii increased cell survival and phagocytic ability upon Lipopolysaccharide (LPS) challenge in goat monocytes. (A) Cell viability and (B) phagocytic ability in goat monocytes stimulated with RPMI, βglucan from Debaryomyces hansenii or phorbol myristate acetate (PMA) upon LPS challenge. Bars represent the mean ± SE. Different letters indicate significant (p < 0.05) difference among groups.
caprine monocytes as well as its in vivo effects using oral doses on newborn goats upon challenge with LPS. Immunological status (trained immunity or tolerance) can determine the functional fate of monocytes and macrophages after infection or vaccination (Saeed, 2014). In vitro, monocytes can differentiate morphologically macrophages/dendritic-like cells in five days. The typical small round shape of monocytes on day 0 changed during the subsequent days of differentiation to more elongated cells, such as typical morphologies of macrophages and dendritic cells. This differentiation was observed in all treatments (β-Dh, PMA and control). Furthermore, trained cells with β-glucan lead to epigenetic reprogramming of monocytes, which have beeb associated with cell shape and cell surface marker modifications (Ifrim et al., 2014). To complement cell differentiation analysis, transcription levels of cell surface marker genes were analyzed. The changes in the expression of these markers may contribute to an increase or decrease in innate immune responses during cell training (Ifrim et al., 2014). Upon LPS challenge, the expression levels of CD11b gene up-regulated in cells trained with β-glucan compared with control and PMA groups. This result suggested a greater number of undifferentiated monocytes in β-Dh group or that these monocytes expressed an abundant number of CD11b transcripts; nevertheless, some monocytes could become differentiated because CD11b marker is, albeit to a lesser extent, expressed in macrophages (Hickstein et al., 1992). Likewise, the relative level of F4/80 gene was up-regulated in both β-Dh and PMA groups with respect to the control group. The relative up-regulation of F4/80 gene expression proved that β-glucan from D. hansenii and positive differentiation control (PMA) could stimulate monocytes differentiation to macrophages. Similarly, Ifrim et al. (2014) demonstrated that most human monocytes trained with β-glucan from Candida albicans expressed cell surface markers of 6
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
Fig. 4. Innate immune parameters increased in blood cells of newborn goats treated with β-glucans from Debaryomyces hansenii upon Lipopolysaccharide (LPS) challenge. (A) Timeline of the β-glucan dosage schedule in the newborn goats in vivo experiment. (B) Respiratory burst activity, (C) Nitric oxide production, and (D) Lysozyme activity in blood cells from newborn goat kids stimulated with milk (control), β-glucan from D. hansenii, or β-glucan from S. cerevisiae at pre-bleed and upon Lipopolysaccharide (LPS) challenge. Bars represent the mean ± SE (n = 4). Different letters indicate significant (p < 0.05) difference among groups.
monocyte and macrophage trained functions, such as the inflammatory response (Forrester et al., 2018). One of the key features of trained innate cells is the ability to release proinflammatory cytokines in response to subsequent challenge with pathogens or PAMPs (Netea et al., 2015). In this study, the production of three proinflammatory cytokines: IL1-β, IL-6 and TNF-α was evaluated. IL1-β, IL-6 and TNF-α concentration increased in the plasma of newborn goats trained with oral doses of D. hansenii-derived β-glucan upon LPS challenge. Curiously, proinflammatory cytokine concentrations in plasma were unaffected in newborn goats stimulated with βglucan from S. cerevisiae. In contrast, Walachowski et al. (2017) observed in an in vitro assay that mouse macrophages trained with βglucan from S. cerevisae increased IL1-β, IL-6 and TNF-α production
human/mouse monocytes (Walachoswski et., 2017; Saed et al., 2014). In this study the tendency of nitric oxide production to increase in plasma from newborn goats was stimulated with β-glucan from D. hansenii and β-glucan from S. cerevisiae (commercial control) upon LPS challenge compared to the control group. Remarkably, Santecchia et al. (2019) observed in an in vivo study that peritoneal cells of mice trained with intraperitoneal doses of CL429 increased nitric oxide production after ex vivo challenge with leptospires or LPS. Thus, nitric oxide is a potent antimicrobial compound that has been linked to trained immunity. Overall, the respiratory burst activity and nitric oxide production seem play a crucial role on trained immunity, which in newborn goats stimulated with β-glucan from D. hansenii could be related to trigger antimicrobial responses against pathogens and regulate
7
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
Fig. 5. Cytokine levels of (A) IL-1β, (B) IL-6, and (C) TNF-α in plasma from newborn goats stimulated with milk (control), β-glucan from Debaryomyces hansenii, or β-glucan from S. cerevisiae at pre-bleed and upon Lipopolysaccharide (LPS) challenge. Bars represent the mean ± SE (n = 4). Different letters indicate significant (p < 0.05) difference among groups.
Fig. 6. Relative mRNA expression of (A) CD11b, (B) CD11c, and (C) F4/80 gene in blood cells from newborn goats stimulated with milk (control), β-glucan from Debaryomyces hansenii, or β-glucan from S. cerevisiae at pre-bleed and upon Lipopolysaccharide (LPS) challenge. Bars represent the mean ± SE (n = 4). Different letters indicate significant (p < 0.05) difference among groups.
upon a secondary stimulation with Pam3Cys. In another study, mice intraperitoneally injected with β-glucan from C. albicans and challenged with LPS resulted in an increased production of IL-6 and TNF-α serum cytokines (Garcia-Valtanen et al., 2017). Furthermore, Smith et al. (2017) found that IL-6 cytokine increased in whole blood of BCG vaccinated (trained) infants upon re-stimulation with Pam3Cys, heat-killed Candida albicans, or a lysate of Mycobacterium tuberculosis. On this regard, BCG-induced trained immunity in adults has been reported to primarily increase IL1-β, IL-6 and TNF-α cytokines (Kleinnijenhuis et al., 2012). In addition, Guerra-Maupome et al. (2019) showed an enhance of IL1-β, IL-6, and TNF-α cytokine production with aerosol BCG vaccination in young calves upon LPS or Pam3CSK4 re-stimulation. Accordingly, oral doses of D. hansenii-derived β-glucan in newborn goats induced trained immunity through enhanced cytokine production upon LPS challenge, which agreed with the trained immunity observed in mice and humans after parenteral administration of β-glucan or BCG. An interesting finding in this study was that the production of proinflammatory cytokines was unaffected in newborn goats stimulated with β-glucan from S. cerevisae, which suggested that D. hansenii-derived β-
glucan could have been a better option to induce innate memory in newborn goats. Additionally, transcription levels of same cell surface marker genes used in in vitro assay were analyzed in the in vivo experiment. The results confirmed that CD11b and F4/80 gene transcription up-regulated in blood cells from newborn goats stimulated with β-glucan from D. hansenii while expression CD11c gen was unaffected. As in vitro results discussed above, the in vivo studies also demonstrated that the expression of cell surface markers CD11b and F4/80 increased as previously reported in human or murine models trained with BCG or CL429, respectively (Kleinnijenhuis et al., 2012; Santecchia et al., 2019).
5. Conclusion Overall, β-glucan from D. hansenii may facilitate and prepare goat monocytes to respond against LPS challenge by increasing cell 8
Developmental and Comparative Immunology 105 (2020) 103597
M. Angulo, et al.
protection (cell viability) through an enhanced phagocytic ability. In vivo, training with oral doses of D. hansenii-derived β-glucan induced a fast response in terms of enhanced respiratory burst activity, proinflammatory cytokine production, and transcription of cell surface macrophage markers. This study has demonstrated for the first time that trained immunity was induced with oral doses of β-glucan upon LPS challenge in mammals using newborn goats.
2105–2109. Ifrim, D.C., Quintin, J., Joosten, L.A., Jacobs, C., Jansen, T., Jacobs, L., Netea, M.G., 2014. Trained immunity or tolerance: opposing functional programs induced in human monocytes after engagement of various pattern recognition receptors. Clin. Vaccine Immunol. 21 (4), 534–545. Kemenade, B.M.L.V., Groeneveld, A., Rens, B.T.T.M., Rombout, J.H.W.M., 1994. Characterization of macrophages and neutrophilic granulocytes from the pronephros of carp (Cyprinus carpio). J. Exp. Biol. 187 (1), 143–158. Kleinnijenhuis, J., Quintin, J., Preijers, F., Joosten, L.A., Ifrim, D.C., Saeed, S., Xavier, R.J., 2012. Bacille Calmette-Guerin induces NOD2-dependent nonspecific protection from reinfection via epigenetic reprogramming of monocytes. Proc. Natl. Acad. Sci. U. S. A. 109 (43), 17537–17542. Levy, O., Wynn, J.L., 2014. A prime time for trained immunity: innate immune memory in newborns and infants. Neonatology 105 (2), 136–141. Litwack, G., 1995. Photometric determination of lysozyme activity. Proc. Soc. Exp. Biol. Med. 89 (3), 401–403. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCT method. Methods 25 (4), 402–408. Netea, M.G., Latz, E., Mills, K.H., O'Neill, L.A., 2015. Innate immune memory: a paradigm shift in understanding host defense. Nat. Immunol. 16, 675–679. Neumann, N.F., Fagan, D., Belosevi, M., 1995. Macrophage activating factor (s) secreted by mitogen stimulated goldfish kidney leukocytes synergize with bacterial lipopolysaccharide to induce nitric oxide production in teleost macrophages. Dev. Comp. Immunol. 19 (6), 473–482. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RTPCR. Nucleic Acids Res. 29 (9), 45. Quintin, J., Saeed, S., Martens, J.H., Giamarellos-Bourboulis, J., Ifrim, D.C., Logie, C., Joosten, L.A., 2012. Candida albicans infection affords protection against reinfection via functional reprogramming of monocytes. Cell Host Microbe 12 (2), 223–232. Rizzetto, L., Ifrim, D.C., Moretti, S., Tocci, N., Cheng, S.C., Quintin, J., Blok, B.A., 2016. Fungal chitin induces trained immunity in human monocytes during cross-talk of the host with Saccharomyces cerevisiae. J. Biol. Chem. 291 (15), 7961–7972. Rodríguez, A., Esteban, M., Meseguer, J., 2003. Phagocytosis and peroxidase release by seabream (Sparus aurata L.) leucocytes in response to yeast cells. Anat. Rec. 272 (1), 415–423. Saeed, S., Quintin, J., Kerstens, H.H., Rao, N.A., Aghajanirefah, A., Matarese, F., . Epigenetic programming of monocyte-to-macrophage differentiation and trained innate immunity. Science. 345 (6204), 1251086. Santecchia, I., Vernel-Pauillac, F., Rasid, O., Quintin, J., Gomes-Solecki, M., Boneca, I.G., Werts, C., 2019. Innate immune memory through TLR2 and NOD2 contributes to the control of Leptospira interrogans infection. PLoS Pathog. 15 (5), e1007811. Schrum, J.E., Crabtree, J.N., Dobbs, K.R., Kiritsy, M.C., Reed, G.W., Gazzinelli, R.T., Golenbock, D.T., 2018. Cutting edge: Plasmodium falciparum induces trained innate immunity. J. Immunol. 200 (4), 1243–1248. Singh, D.D., Pawaiya, R.V.S., Gururaj, K., Gangwar, N.K., Mishra, A.K., Singh, R., Kumar, A., 2018. Detection of Clostridium perfringens toxinotypes, enteropathogenic E. coli, Rota and corona viruses in the intestine of neonatal goat kids by molecular techniques. Indian J. Anim. Res. 88 (6), 655–661. Smith, S.G., Kleinnijenhuis, J., Netea, M.G., Dockrell, H.M., 2017. Whole blood profiling of bacillus Calmette–Guérin-induced trained innate immunity in infants identifies epidermal growth factor, IL-6, platelet-derived growth factor-AB/BB, and natural killer cell activation. Front. Immunol. 8, 644. Sohrabi, Y., Lagache, S.M., Lucia, S., Godfrey, R., Kahlesc, F., Bruemmer, D., Findeisen, H., 2018. mTOR-dependent oxidative stress regulates oxLDL-induced trained innate immunity in human monocytes. Front. Immunol. 9, 3155. Tourais-Esteves, I., Bernardet, N., Lacroix-Lamande, S., Ferret-Bernard, S., Laurent, F., 2008. Neonatal goats display a stronger TH1-type cytokine response to TLR ligands than adults. Dev. Comp. Immunol. 32 (10), 1231–1241. Walachowski, S., Tabouret, G., Fabre, M., Foucras, G., 2017. Molecular analysis of a shortterm model of β-glucans-trained immunity highlights the accessory contribution of GM-CSF in priming mouse macrophages response. Front. Immunol. 8, 1089. Wynn, J.L., Levy, O., 2010. Role of innate host defenses in susceptibility to early-onset neonatal sepsis. Clin. Perinatol. 37 (2), 307–337.
Declaration of competing interest The authors have no financial conflicts of interest. Acknowledgments This research was financially supported by grants from CONACYT, Mexico (INFR-2014-01/225924 and PDCPN2014-01/248033). The authors thank Juan Manuel Melero for facilitating goat blood samples and Margarita Mendoza Cruz from UABCS for help provided in blood sampling newborn goats during the bioassay and also appreciate Diana Fischer for editorial services. References Alexander, M.P., Fiering, S.N., Ostroff, G.R., Cramer, R.A., Mullins, D.W., 2016. Betaglucan-induced trained innate immunity mediates antitumor efficacy in the mouse lung. J. Immunol. 196 142-24. Angulo, M., Reyes-Becerril, M., Tovar-Ramírez, D., Ascencio, F., Angulo, C., 2018. Debaryomyces hansenii CBS 8339 β-glucan enhances immune responses and downstream gene signaling pathways in goat peripheral blood leukocytes. Dev. Comp. Immunol. 88, 173–182. Angulo, M., Reyes-Becerril, M., Cepeda-Palacios, R., Tovar-Ramírez, D., Esteban, M.Á., Angulo, C., 2019. Probiotic effects of marine Debaryomyces hansenii CBS 8339 on innate immune and antioxidant parameters in newborn goats. Appl. Microbiol. Biotechnol. 103 (5), 2339–2352. Arts, R.J., Blok, B.A., Aaby, P., Joosten, L.A., de Jong, D., van der Meer, J.W., Netea, M.G., 2015. Long‐term in vitro and in vivo effects of γ‐irradiated BCG on innate and adaptive immunity. J. Leukoc. Biol. 98 (6), 995–1001. Bekkering, S., Blok, B.A., Joosten, L.A., Riksen, N.P., van Crevel, R., Netea, M.G., 2016. In vitro experimental model of trained innate immunity in human primary monocytes. Clin. Vaccine Immunol. 23 (12), 926–933. Blok, B.A., Jensen, K.J., Aaby, P., Fomsgaard, A., van Crevel, R., Benn, C.S., Netea, M.G., 2019. Opposite effects of Vaccinia and modified Vaccinia Ankara on trained immunity. Eur. J. Clin. Microbiol. Infect. Dis. 38 (3), 449–456. Cheng, S.C., Quintin, J., Cramer, R.A., Shepardson, K.M., Saeed, S., Kumar, V., 2014. mTOR- and HIF-1alpha-mediated aerobic glycolysis as metabolic basis for trained immunity. Science 345 (6204), 1250684. Forrester, S.J., Kikuchi, D.S., Hernandes, M.S., Xu, Q., Griendling, K.K., 2018. Reactive oxygen species in metabolic and inflammatory signaling. Circ. Res. 122 (6), 877–902. Garcia‐Valtanen, P., Guzman‐Genuino, R.M., Williams, D.L., Hayball, J.D., Diener, K.R., 2017. Evaluation of trained immunity by β‐1, 3 (d)‐glucan on murine monocytes in vitro and duration of response in vivo. Immunol. Cell Biol. 95 (7), 601–610. Guerra-Maupome, M., Vang, D.X., McGill, J.L., 2019. Aerosol vaccination with Bacille Calmette-Guerin induces a trained innate immune phenotype in calves. PLoS One 14 (2), e0212751. Hickstein, D.D., Baker, D.M., Gollahon, K.A., Back, A.L., 1992. Identification of the promoter of the myelomonocytic leukocyte integrin CD11b. Proc. Natl. Acad. Sci. 89 (6),
9