Orientation of separated DNA strands of coliphage 186 relative to its genetic map

Gene, 15 (1981) 95-98 Elsevier/North-HollandBiomedicalPress

95

Short C o m m u n i c a t i o n s Orientation o f separated D N A strands of coliphage 186 relative to its genetic map (Strandseparation in p o l y ( U , G ~ C l gradient; AMV reverse transcriptase; cohesive ends;Escherichia coli) Bill Kalionis and ]. Barry Egan Department of Biochemistry, The University of Adelaide, Adelaide, South Australia 5000 (Australia) (Received May 5th, 1981) (Accepted May 20th, 1981)

SUMMARY The 3'-terminus of the l strand of phage 186 double-stranded DNA was radioactively labeled by the reaction catalysed by AMV reverse transcriptase, under conditions where the r strand remained unlabeled. Upon strand separation in a poly(U, G)-CsCI equilibrium density gradient, radioactivity was found to be associated with the peak of lower buoyant density (L), thereby specifying the I strand. The peak with the higher buoyant density (H) contains the r strand.

INTRODUCTION

convention established for coliphage X (Szybalski,

1969). Studies are currently underway in t~s laboratory on the in vivo transcription pattern of the coliphage 186 genome. A model for transcription during 186 lytic development has been proposed, based on pulse labeling at different times after prophage induction and hybridizing the RNA extracts to cloned restriction fragments of 186 (Finnegan and Egan, 1981). Further characterization of the transcription pattern requires a knowledge of the direction of transcription, as can be obtained by studies of hybridization to the separated strands of 186 DNA. The DNA strands of 186 can be resolved on a poly(U, G)~.sEI gradient into a higher density strand (H) and a lower density strand (L), as shown in Fig. 1. The purpose of this communication is to correlate the H and L strands on such a gradient with the l and r strands of the I86 genetic map (Fig. 2), following the

Abbreviations: AMV,avian myeloblastosisvirus; kb, kik~base pairs.

H

4~..w

0"8

1

•,= 04

N

g o •~

increasing buoyant density

\

0.,

IO

20 FRACTION

30

40

5

NO.

Fig. 1. Separation of the strands of 186 DNA by heat denaturation in the presence of poly(U,G), followedby CsCIequilibrium density gradient centrifugation (see Szybaiskiet aL, 1971), The peak with the higher buoyant density is denoted the heavy (H)strand and the peak with the lower buoyant density, the light (L) strand. The first ten fractions contain unbound poly0Ll,G).

0378-1119/81/0000-00001502-50 © 1981 EIseviedNorth-HollandBiomedicalPress

% MATERIALS AND METHODS

Mater.s Reagents were obtained from the following sources: CsCI (optic~ purity), Harshaw Chemical Co.; poly(U, G), Sigma Chemical Co., a I mg/ml stock solution in 0.1 mM EDTA pH 7.6 was stored, frozen at -15°C; AMV reverse transcriptase was a gift from J.R.E. Wells; [a-3zP]dGTP (300-400 Ci/mmol) was a gift from R.H. Syraons.

density of 1.74 g/ml. Centrifugation was for 60 h at 30000 rev./min and 8°C. Gradients were fractionated by puncturing the bottom of the tube and the absorbance at 260 am of each fraction was determined. Where radioactive DNA was used, the Cerenkov radiation of each fraction was determined at 50% efficiency. (e) Labeling 186 DNA with [wa2P]dGTP The 50/d reaction mix contained 100 mM KCI, 8 mM MgCI2, 8 mM dithiothreitol, 50 mM Tris. HCI pH 8.3, 1 #M [o~-32p]dGTP and 30 pg phage 186 DNA (previously heated to 75°C for 5 min followed by rapid chilling to denature the cohesive ends). One unit of AMV reverse transcriptase was added and incubation proceeded for 30 min at 37°C. The reaction mix was phenol extracted and unincorporated radioactivity removed by fractionation on a Sephadex G-50 column. Fractions containing radioactive DNA Were pooled, ethanol-precipitated and resuspended in 30 ~1 1 mM EDTA pH 8.0. Unlabeled phage 186 DNA was added to give a total of 100/zg of DNA. Strand separation was as described in MATERIALS AND METHODS (d).

(b) Preparation of bacteriophage 186clts was prepared as described by Saint and Egan (1979). (c) Preparation of phage DNA 186clts DNA was prepared as described by Finnegan and Egan (1979).

(d) Separation of 186 DNA strands (see Szybalski et al., 1971) Immediately before use, 100 pl of the poly(U, G) stock solution and 50/,tl 1 mM EDTA pH 8.0 were placed in a glass tube and immersed in boiling water for 2 rain, followed by rapid chilling in an ice slurry. After addition of 100/~1 of a 1 mg/ml solution of phage 186 DNA and 3 ~tl 1 N NaOH, the mixture was again boiled for 5 min, chilled, and 170/.tl of 0.5 M "Iris-HCI pH 8.5 added immediately. The total volume was made up to 8 ml by addition of water and CsCI, in appropriate proportions to give a f'mal

3"~ mRNA

5'G 0"?

3-3

5'

Z strand ! H r strand

RESULTS AND DISCUSSION

The orientation of the genetic map of phage 186 with respect to the physical map is presented in Fig. 2 and follows the convention used for lambdoid phages with the replication genes to the fight, and the structural genes to the left. Saint and Egan (1979) mapped

G 23.6

F

S

att int cI 5 ~ 3 '

A

i

AS' 2-4

E c o R I site

Fig. 2. Orier.~ation of the physical map of 186 DNA with respect to the genetic map (Finnegan and Egan, 1979). The genetic map is written with terminal gene W (head gene) on the left end of the moleculeand terminal geneA (replication gene) on the right. The functio~:s assigned to the genes were described by Finnegan and Egan (1979). The sizes of the EcoRI fragments are in kb. Strand designation! and r follows the conventionproposed by Szybalski(1969).

97

S*

I-'----3e

I strand

GGCG TGGCGGGGA

kb

----..-

A AGCATTGCGCGC

3' GTGGGCA

,.

ACGCGCG

-..-----4

CACCCGTCCGCACCGCCCCTTTCGTA r strand

31

S~

Fig. 3. Base sequence of the cohesive ends of phage 186 DNA. Two 5' extensions of 19 nucleotides protrude from the 30-kb doublestranded 186 DNA. AMV reverse transcriptase catalyses the polymerization reaction whereby complementary deoxyribonucleoside triphosphates are sequentially added to the 3'-termini in a 5' -* 3' direction. Omitting dATP from the reaction (and also dCTP and dTTP) allows only the l strand to be radioactively labeled with [a-a :Zp]dGTP.

the position of restriction fragments of 186 DNA and these were subsequently oriented with respect to the genetic map by Finnegan and Egan (1979). At each end of the chromosomal DNA there is a 5'-extension of 19 bases (Murray and Murray, 1973), one terminating with deoxyguanylate, the other with deoxyadenylate. Murray et al. 0 9 7 7 ) reported that the 5'-terminal G was associated with tD~ 0.7-kb EcoRl fragment of 186 DNA, and the 5'-terminal A with the 2.4-kb EcoRl fragment, thus orienting the 5'-termini with respect to the genetic map as shown in Fig. 2. The base sequence of the cohesive ends of the 186 genome is illustrated in Fig. 3. In an in vitro reaction mixture containing 186 DNA and the four deoxyribo-

increastn~ buoyan! H(r)

dens*ly

L(:)

*-¢2 x

0,3 m

•,i

O'2 4(

ia .

4(

o

0,1

lo

2~o

3o

,o

FRACTION NO.

Fig. 4. A26o and tadioactiviW prof'fles of fractions collected from a CsCl gradient where 186 double-stranded DNA had been radioactively labeled using |a-z2P]dGTP as the only substrate for AMV reverse transc~iptase. Labeled 186 DNA was mixed with unlabeled carrier 186 DNA and the strands were separated as described in MATERIALSAND METHODS (d). It was confnmed by restriction analysis that only the terminal 2.4-kb fragment was labeled after EcoRI digestionof the labeled 186 DNA (data not shown). The first ten fractions contain unbound poly(U,G). -=, absorbance; , cpm.

nucleoside triphosphates as substrates, AMV reverse transcriptase will catalyse the polymerization of the sequences complementary to the 19-base extensions by using the 3'-termini as primers and polymerizing in the 5' -* 3' direction. By omitting dATP from the reaction mix, polymerization wil~ not occur at the 3'-terminus of the r strand, whereas 12 bases will be added before the need ofdATP in the polymerization at the 3'-terminus of the l strand. Alternatively, if only [a-32P]dGTP were present, then only the I strand would be labeled with two bases. The latter protocol was followed, and the labeled DNA, after mixing with unlabeled cartier 286 DNA ~as heat denatured in the presence of poly(U,G) and the strands separated by CsCl equilibrium density gradient centrifugation. A comparison of the A26o profile with the radioactivity of each fraction collected from the gradient is presented in Fig. 4 and shows that the radioactivity is associated with the peak of lower buoyant density (L) in the gradient. This strand alone was labeled in the AMV reverse transcriptase-catalysed reaction and therefore the peak with the lower buoyant density is identified as the 1 strand. The peak with the higher buoyant density, the heavy (H) strand, contains the r strand. The separated strands can now be used to hybridize mRNA species from 186 infection, and thereby to orient the transcripts relative to the genetic map.

ACKNOWLEDGMENTS We wish to thank Sylvi:: Francis for her media preparations and the Australian Research Grants Committee for their financial support.

98 REFERENCES Finnegan, J. and Egan, J.B.: Physical nap of the cofiphage 186 chromosome, L Gene content of the BamHI, Pstl and other restriction fragments. MoL Gen. Genet. 172 (1979) 287-293. Finneg~n, J. and Egan, J.B.: In vivo transcription studies of coL~ph~e 186.J. ViroL 38 (1981) 987-995. Murray, K., Isaksson-Forsen, A.G., Cl~Hbegg, M. and En_glund, P.T.: Symmetrical nucleotide sequences in the : recogr~ion sites for the ter function of bacteriophages P2, 229 a~d 186. J. MoL BioL 112 (1977) 471-489. Murray, K. and Murray, N.E.: Terminal nuclcotide sequences of DNA from temperate coliphages. Nature New Biol. 243 (1973) 134-139.

Saint, R.B. and Egan, J.B.: Rest,iction cleavage maps of coilphage 186 and P2. Mol. Gen. Genet. 171 (1979) 79-89. Szybalski, W.: Initiation and patterns of transcription during phage development. Canadian Cancer Confezence (Proceedings of the Eighth Canadian Cancer Research Conference, Honey Harbor, Ont., 1968), VoL 8, Pergamon, Oxford, 1969, pp. 183"215. Szybalski, W., Kubinski, H., H r a ~ Z. and Summers, W.C.: Analytical and preparative separation of the complementary DNA strands, in (L. Grossman and K. Moldave, Eds.), Methods in Enzymology, VoL 21, Nucleic Adds, Part D, Academic Press, New York, 1971, pp. 383-413. Communicated by Z. l h a ~