ORP10, a cholesterol binding protein associated with microtubules, regulates apolipoprotein B-100 secretion

Biochimica et Biophysica Acta 1821 (2012) 1472–1484

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbalip

ORP10, a cholesterol binding protein associated with microtubules, regulates apolipoprotein B-100 secretion Eija Nissilä a, b, Yuki Ohsaki a, Marion Weber-Boyvat b, Julia Perttilä b, Elina Ikonen a, b, Vesa M. Olkkonen a, b,⁎ a b

Institute of Biomedicine, Anatomy, PO Box 63, FI-00014 University of Helsinki, Finland Minerva Foundation Institute for Medical Research, Biomedicum Helsinki 2U, Tukholmankatu 8, FI-00290 Helsinki, Helsinki, Finland

a r t i c l e

i n f o

Article history: Received 7 February 2012 Received in revised form 31 July 2012 Accepted 3 August 2012 Available online 11 August 2012 Keywords: apoB-100 Golgi Microtubule ORP10 Oxysterol-binding protein

a b s t r a c t ORP10/OSBPL10 is a member of the oxysterol-binding protein family, and genetic variation in OSBPL10 is associated with dyslipidemias and peripheral artery disease. In this study we investigated the ligand binding properties of ORP10 in vitro as well as its localization and function in human HuH7 hepatocytes. The pleckstrin homology (PH) domain of ORP10 selectively interacts with phosphatidylinositol-4-phosphate, while the C-terminal ligand binding domain binds cholesterol and several acidic phospholipids. Full-length ORP10 decorates microtubules (MT), while the ORP10 N-terminal fragment (aa 1–318) localizes at Golgi membranes. Removal of the C-terminal aa 712–764 of ORP10 containing a predicted coiled-coil segment abolishes the MT association, but allows partial Golgi targeting. A PH domain-GFP fusion protein is distributed mainly in the cytosol and the plasma membrane, indicating that the Golgi affinity of ORP10 involves other determinants in addition to the PH domain. HuH7 cells expressing ORP10-specific shRNA display increased accumulation of apolipoprotein B-100 (apoB-100), but not of albumin, in culture medium, and contain reduced levels of intracellular apoB-100. Pulse-chase analysis of cellular [35S]apoB-100 demonstrates enhanced apoB-100 secretion by cells expressing ORP10-specific shRNA. The apoB-100 secretion phenotype is replicated in HepG2 cells transduced with the ORP10 shRNA lentiviruses. As a conclusion, the present study dissects the determinants of ORP10 association with MT and the Golgi complex and provides evidence for a specific role of this protein in β-lipoprotein secretion by human hepatocytes. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Atherosclerosis is a major cause of cardiovascular diseases and a leading cause of death. It is a complex, chronic disease characterized by lipid accumulation and inflammation within the intima layer of the vessel wall [1]. It is also a major cause of morbidity and mortality in type 2 diabetes and metabolic syndrome [2]. A crucial reason for accelerated atherosclerosis in diabetes and metabolic syndrome is dyslipidemia, characterized by increased very-low-density lipoprotein (VLDL) and reduced high-density-lipoprotein (HDL) levels [3]. Elevated hepatic VLDL secretion is a typical feature of type 2 diabetes, accounting in part for diabetic dyslipidemia [4,5]. Peripheral insulin resistance leads

Abbreviations: apoB-100, apolipoprotein B-100; EGFP, enhanced green fluorescent protein; ER, endoplasmic reticulum; GST, glutathione-S-transferase; LDLR, low-density lipoprotein receptor; MT, microtubule; OHC, hydroxycholesterol; ORD, OSBP-related domain; ORP, OSBP-related protein; OSBP, oxysterol binding protein; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PH, pleckstrin homology; PtdIns(4)P, phosphatidylinositol-4-phosphate; shRNA, short hairpin RNA; siRNA, small interfering RNA; TAG, triacylglycerol ⁎ Corresponding author at: Minerva Foundation Institute for Medical Research, Biomedicum 2U, FI-00290 Helsinki, Finland. Tel.: +358 9 19125705; fax: +358 9 19125701. E-mail address: vesa.olkkonen@helsinki.fi (V.M. Olkkonen). 1388-1981/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.bbalip.2012.08.004

to an increased flux of free fatty acids to the liver, resulting in enhanced TAG synthesis, decreased apoB-100 degradation, and elevated secretion of VLDL [6,7]. Hepatocytes secrete VLDL particles, which contain most of the circulating TAG. VLDL is composed of a core of neutral lipids, which is surrounded by phospholipids, cholesterol and the apolipoprotein apoB-100. ApoB-100 is an essential component of VLDL and its metabolites intermediate-density (IDL) and low-density (LDL) lipoproteins. The assembly of VLDL starts in the endoplasmic reticulum (ER) with microsomal TAG transfer of protein-mediated partial lipidation of apoB-100, after which bulk of the neutral TAG is added to the apoB-100-containing particle [8–11]. The nascent VLDL particle is thought to be transported from the hepatic ER to the Golgi via specific ER-derived transport vesicles [12,13]. Increasing evidence suggests that OSBP-related proteins (OSBP/ORPs) are involved in dyslipidemias. OSBP was isolated as a cytoplasmic highaffinity receptor for several oxysterols [14–16]. In mammals, including humans, the OSBP-like (OSBPL) gene family consists of 12 members, which display different expression patterns, subcellular localization and substrate specificity. Most ORPs share two highly conserved structural features: a pleckstrin homology (PH) domain at the amino-terminus and a ~400-amino acid OSBP-related ligand binding domain (ORD) at the carboxy-terminus [17]. ORPs are divided into six subfamilies, of

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

which subfamily VI includes the closely related ORP10 and ORP11. Single nucleotide polymorphisms (SNPs) in subfamily VI genes (OSBPL10 and ‐11) have been associated in dyslipidemic diseases. ORP11 expression was up-regulated in the visceral adipose tissue of obese men with high risks of cardiovascular disease [18]. Further investigation associated a number of SNPs in the OSBPL11 gene with cardiovascular disease risk factors, including hypertension, LDL-cholesterol plasma levels and hyperglycemia [19]. Our previous study showed that polymorphisms in the OSBPL10 gene are associated with high serum TAG levels in Finnish dyslipidemic subjects [20]. In addition, polymorphisms in the OSBPL10 gene were reported to be associated with high LDL cholesterol [21] and peripheral arterial disease [22] in Japanese subjects. In the present study we characterize the ligand binding properties of ORP10 in vitro, the determinants of its localization, and function of the protein in apoB-100 secretion by cultured human HuH7 and HepG2 hepatocytes.

1473

2.3. Antibodies Polyclonal OSBPL10 antibody was purchased from Proteintech Inc. (Chicago, IL), and rabbit antiserum against ORP9 was a kind gift from Prof. Neale Ridgway (Dalhousie Univ., Halifax, Canada). Anti-actin rabbit polyclonal antibody and anti-β-tubulin monoclonal antibody (TUB 2.1) were from Sigma-Aldrich (St. Louis, MO), and anti-GFP was from Roche Diagnostics (Mannheim, Germany). Anti-GM130 monoclonal antibody was from BD Bioscience (San Jose, CA) and rabbit anti-GST was from Santa Cruz Biotechnology (Santa Cruz, CA). Goat antiapolipoprotein B-100 antibody was from Rockland Immunochemicals Inc. (Gilbertsville, PA), rabbit LDLR antibody was from Cayman Chemical (Ann Arbor, MI), and anti-GFP was from Roche Diagnostics (Mannheim, Germany). Fluorescent secondary antibodies (fAlexa Fluor-488 and ‐594 goat anti-mouse and anti-rabbit IgG), and monoclonal antibody against the Xpress® epitope, were purchased from Molecular Probes/Invitrogen (Carlsbad, CA).

2. Materials and methods 2.4. Cell culture 2.1. Protein purification and phospholipid binding assay GST, GST-ORP10 PH domain (aa 70–176), and GST-ORP10 OSBPrelated domain (ORD) (aa 306–764) fusion proteins, expressed in Escherichia coli BL21(DE3), were purified on glutathione–Sepharose 4B (GE Healthcare, Waukesha, WI). PIP Strips® membranes (Molecular Probes/Invitrogen, Carlsbad, CA) were blocked using Tris-buffered saline (TBS), 0.1% Tween 20 (TBS-T) with 3% fatty acid-free BSA. The membranes were then incubated overnight at 4 °C with 5 μg/ml of purified GST-ORP10 PH domain or ORD, or plain GST in TBS-T with 3% BSA. Additional incubation and wash steps were performed according to the product manual. The bound proteins were detected by using antibodies against GST (Santa Cruz Biotechnology Inc., Santa Cruz, CA) and mouse anti-rabbit IgG conjugated with Alexa800 (Rockland Inc., Gilbertsville, PA). The membranes were scanned and analyzed using Odyssey infrared reader (Licor Biosciences, Lincoln, NE).

2.2. Sterol binding assays Cholesterol binding assay was carried out as in [23]. Briefly, dioleoyl-PC (0.45 mM) and egg PE (0.05 mM; Sigma-Aldrich, St. Louis, MO) with 1 mol% [3H]cholesterol (specific activity 720 dpm/pmol) were prepared by drying down lipids in chloroform under nitrogen and rehydrating them in 25 mM HEPES (pH 7.4), 150 mM NaCl for 1 h at room temperature. Liposomes (400-nm diameter) were prepared by filter extrusion using the Lipofast system (Avestin, Ottawa, ON, Canada) and aliquots containing 100 pmol cholesterol were incubated with the above buffer alone, plain GST, GST-ORP10 ORD, or GST-ORP10 ORD Δ412–415 (25, 50, or 100 pmol) for 30 min at 25 °C. Liposomes were sedimented by centrifugation at 100,000 ×g for 25 min at 4 °C and radioactivity in the supernatant and the pellet was measured by liquid scintillation counting. In vitro oxysterol binding assays were performed as described in [24]. Binding of [ 3H] labeled 7-ketocholesterol (65 Ci/mmol; American Radiolabeled Chemicals, St. Louis, MO), 25-hydroxycholesterol (20 Ci/mmol), 22(R) hydroxycholesterol (20 Ci/mmol; American Radiolabeled Chemicals), or 27-hydroxycholesterol (45 Ci/mmol; a gift from Prof. Ingemar Björkhem, Karolinska Institute, Huddinge, Sweden) to the purified GST-ORP10 ORD was assayed. Briefly, proteins (1 μM) were incubated overnight at +4 °C with 5, 10, 20, 40, and 80 nM [3H]oxysterol in the absence or presence of a 40-fold excess of the corresponding unlabeled oxysterol (purchased from Sigma-Aldrich; except 27-hydroxycholesterol, which was from I. Björkhem). The free sterol was thereafter removed with charcoaldextran, and the protein-bound [3H]sterol remaining in the supernatant was analyzed by liquid scintillation counting.

The human hepatoma cell lines HuH7 [25] and HepG2 (ATCC HB-8065) were cultured in Eagle's minimal essential medium with Earle's salts (EMEM, Sigma-Aldrich, St. Louis, MO), 20 mM Hepes, pH 7.4, 10% fetal bovine serum (FBS; Gibco/Invitrogen, Grand Island, NY), 100 U/ml penicillin, and 100 μg/ml streptomycin. During experiments assessing apoB-100 synthesis, secretion, or uptake, the cells were incubated, as indicated, in EMEM, 5% delipidated serum, or in serum-free EMEM.

2.5. cDNA constructs The full-length ORP10 cDNA (NM_017784.4) has been previously described [20]. N-terminal ORP10 (aa 1–318), C-terminal ORP10 (aa 306–764), PH domain of ORP10 (aa 70–176) and truncated ORP10 (aa 1–711) fragments were generated by PCR and cloned into (BamHI, EcoRI or HindIII–BamHI sites of) pEGFP-C1 or pEGFP-C2 (Clontech/ Takara Bio, Mountain View, CA). The deletion of aa 412–415 (DLTK) was introduced into pEGFP-ORP10 by using the Quick Change XL site-directed mutagenesis kit (Stratagene, Los Angeles, CA) according to the manufacturer's instructions. For bimolecular fluorescence complementation analysis, full-length ORP10, ORP11 (NM_022776), ORP9L (NM_024586), and ORP1L (AF323726) open reading frames were PCR amplified and inserted into Venus-based BiFC vectors as C-terminal fusions with the Vn (aa 1–172) and Vc (aa 155–238) fragments [26]. For co-immunoprecipitation experiments the ORP9L cDNA was cloned between the EcoRI/XhoI sites of pcDNA4HisMaxC (Invitrogen).

2.6. Analysis of the subcellular localization of ORP10 HuH7 cells were transfected for 24 h using Lipofectamine 2000 (Invitrogen), fixed with paraformaldehyde and processed for immunofluorescence microscopy essentially as described previously [27]. The immunofluorescence double stainings and pretreatments of the cells were performed as earlier described by [28]. The specimens were analyzed using a Leica TCS SP2 laser scanning confocal microscope. Microtubule localization of ORP10 constructs was analyzed by counting the number of cells showing co-localization with β-tubulin per total number of transfected cells. A minimum of 60 cells per construct were analyzed. Golgi localization of ORP10 constructs was analyzed by determining Pearson's coefficient for co-localization of GFP-ORP10 constructs with GM130. A minimum of 40 cells per ORP10 construct were analyzed.

1474

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

2.7. Bimolecular fluorescence complementation (BiFC) analysis HuH7 cells were cotransformed with compatible plasmids encoding the fusion proteins ORP10/pVnC1 combined with ORP9L/pVcC1, ORP11/ pVnC1 combined with ORP9L/pVcC1 (positive control), or ORP9L/ pVcC1 combined with ORP1L/pVnC1 (negative control). The plasmid pCherry-Golgi (Dr. I. Kaverina, Vanderbilt Univ., Nashville, TN) was co-transfected as a transfection efficiency control and as a Golgi marker; in some experiments the ER marker pRFP-Sec61β (Dr. Joachim Füllekrug, Univ. of Heidelberg, Heidelberg, Germany) was used as a transfection control. The cells were incubated for a total of 24 h at 37 °C, and fluorescence emission in the GFP (for Venus BiFC) and Cherry channels was imaged by using a Zeiss Axio Observer Z1 microscope with an ECPlnN 40×/0.75 DICII objective and a Colibri laser. Images were recorded with the Axio Vision Rel. 4.8.1 software (Carl Zeiss Imaging Solutions GmbH).

1% sodium dodecyl sulfate, 50 mm Tris–HCl, pH 7.4, protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany) and phosphatase inhibitors (PhosStop, Roche). The crude extracts were cleared by centrifugation at 16,000×g for 3 min, and the protein concentration of the supernatant was determined. The proteins were electrophoresed on Laemmli gels and electrotransferred to Hybond-C Extra nitrocellulose (GE Healthcare). Unspecific binding of antibodies was blocked with, and all antibody incubations were carried out in 5% fat-free powdered milk in 10 mM Tris–HCl, pH 7.4, 150 mM NaCl, and 0.05% Tween 20. The bound primary antibodies were visualized with horseradish peroxidase-conjugated goat anti-rabbit or -mouse IgG (Bio-Rad) and the enhanced chemiluminescence system (GE Healthcare) or Alexa800 dye conjugated mouse anti-rabbit IgG (Rockland Inc.) and Odyssey infrared reader (Licor Biosciences). Quantifications were performed using the Fiji software. 2.12. Analysis of cellular apoB-100 turnover

2.8. Co-immunoprecipitation HuH7 cells were transfected for 24 h with pEGFP-C1/ORP10 either alone or together with pcDNA4HisMaxC/ORP9L by using Lipofectamine 2000 (Invitrogen). The cells were lysed in 10 mM Hepes, pH 7.6, 150 mM NaCl, 0.5 mM MgCl2, 10% glycerol, 0.5% Triton X-100, protease inhibitor cocktail (Roche Diagnostics). Immunoprecipitation was carried out with Xpress® antibody as previously described [27]. The immunocomplexes were resolved on a reducing SDS-PAGE and analyzed by Western blotting with anti-Xpress and anti-GFP antibodies. 2.9. Generation of HuH7 and HepG2 cells with ORP10 stably silenced HuH7 and HepG2 cells were infected with Mission™ (Sigma-Aldrich) lentiviral particles, TRCN0000147511 (shORP10.3) and TRCN0000149806 (shORP10.5) carrying cDNA for human ORP10-specific shRNAs, and a control virus (shNT) encoding a non-targeting shRNA. Pools of transduced cells were selected with puromycin (HuH7, 5 μg/ml; HepG2, 2 μg/ml) according to the manufacturer's protocol. The relative degree of ORP10 silencing in the cell pools was determined at the mRNA by qPCR (primers, forward tgtgagtgcgaggagaagagac and reverse cgtgttccaggagcctcaac), and by Western blotting with an ORP10 antibody (Proteintech). 2.10. Assays for apoB-100 and albumin secretion HuH7 or HepG2 cells transduced with the shRNA lentiviruses (see above) were cultured in 12-wells in serum-containing growth medium for 24 h. The cells were washed with phosphate-buffered saline and transferred into serum-free culture medium. The medium and the cells were harvested at 6, 12, and 24 h. Similar experiments were carried out in the HuH7 cell by transient transfection of ORP10, ORP9L or non-targeting control siRNA for 48 h with the Interferin® reagent (Polyplus, Illkirch, France). The siRNAs used were: siORP10.2 (sense strand GAGAAUUUCCUGUGGAU-UAdTdT) [20] and ORP9L, Silencer Select® s41693 (Invitrogen) and non-targeting control siRNA (siNT, sense strand UAGCGACUAAACACAUCAAdTdT). The apoB-100 concentration in the medium was determined with a specific sandwich enzyme-linked immunosorbent assay (ELISA; Mabtech, Nacka Strand, Sweden) and the values were normalized for the total cell protein determined using the Pierce® DC Protein Assay (Thermo Scientific, Rockford, IL). Albumin concentration in the medium was determined using a specific ELISA (Alpha Diagnostics, San Antonio, TX). In some experiments the proteasome inhibitor MG132 (20 μM, Calbiohem) was included in the incubation medium. 2.11. Western blotting Protein samples for SDS-PAGE were prepared by homogenizing cultured cells in 150 mM NaCl, 1% Triton-X-100, 0.5% sodium deoxycholate,

Cells grown in 10% FBS/EMEM on 3 cm dishes were washed with warm PBS and incubated in pulse medium [methionine/cysteine free RPMI 1640 medium (Sigma-Aldrich R7513) supplemented with 2 mM L-glutamine (Sigma-Aldrich) and 100 μCi/ml of [ 35S]methionine/cysteine (EasyTag Express Protein labeling Mix, PerkinElmer NEG77200)] for 30 min. After rinsing 3 times with PBS, the cells were further incubated in chase medium (serum free EMEM with 2 mM L-glutamine and 150 μg/ml unlabelled methionine). At the indicated time, cells were washed with cold PBS and lysed in 200 μl of lysis buffer (1% NP40, 50 mM Tris–HCl, pH 8.0, 150 mM NaCl, 1 mM EDTA, and CLAP protease inhibitor cocktail, Sigma-Aldrich) for 1 h at +4 °C. After centrifugation in a microfuge at 13,000 rpm for 15 min, the supernatants were collected and pre-cleared for 1 h with 10 μl of Protein G-Sepharose (GE healthcare). After spinning down at 2000 rpm for 5 min, the supernatants were incubated overnight with 2.5 μg/ml goat anti-apoB antibody (Rockland), followed by precipitation for 4 h at 4 °C with 20 μl of Protein G-Sepharose. The samples were washed 5 times with lysis buffer, and the final pellets were mixed with 2 × Laemmli sample buffer, boiled, and subjected to SDS-PAGE on 6% acrylamide gels. The gels were fixed (25% methanol, 10% acetic acid) for 30 min, followed by signal enhancement with Amplify Fluorographic Reagent (GE healthcare) for 15 min, dried, and exposed to X-ray film (Hyperfilm MP, GE healthcare) for 1 day. 2.13. Analysis of [ 3H]triglyceride biosynthesis and secretion To measure TAG biosynthesis, lentivirally transduced HuH7 cells cultured on 6-well plates at a density of 1× 106 cells per well were pulse-labeled for 30 min at 37 °C with [3H]oleic acid (16.5 mCi/well; GE Healthcare) in serum-free medium followed by a chase period of 90 min. After washing twice with PBS, cells were scraped into 900 μl of ice-cold 2% (w/v) NaCl. Aliquots of 100 μl were withdrawn for protein analysis. From the remaining 800 μl, lipids were extracted and separated by TLC on silica gel plates by using petroleum ether/diethyl ether/acetic acid (60:40:1) as the solvent. The plates were dried and stained with iodine vapor. The TAG band was scraped, and [ 3H] radioactivity was measured by liquid-scintillation counting, and the results were normalized for total cell protein. To determine TAG secretion, 350 μM oleic acid–0.5% BSA complexes containing [ 3H]oleic acid (16.1 μCi/well; 7 Ci/mmol; GE Healthcare) were added to the cells. After 105 min, the cells were washed three times with PBS, and the medium was replaced with serum-free DMEM. The medium and cells were harvested after 3 h. The cell samples and medium samples were treated further as in the TAG synthesis assay. To determine total cellular TAG content, the cells were cultured on 6-well plates overnight in medium with 5% delipidated serum. After washing three times with PBS, lipids were extracted and analyzed by TLC as described above. The separated lipids were stained with iodine vapor and quantified by using the Fiji software.

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

2.14. Quantification of DiI-LDL uptake

3. Results

HuH7 cells with silenced ORP10 and controls were cultured for 24 h on 48-well plates in EMEM, 5% delipidated serum. Serum-free medium or 50-fold excess of unlabeled LDL was first added to the cells for 9 min at 37 °C thereafter 3.5 μg/ml of DiI-LDL (Molecular Probes) was added and incubated at 37 °C for 30 min. The plate was then cooled on ice and washed 3 times with cold PBS. The cells were lysed in 200 ml of PBS, 1% NP-40. 120 ml of each lysate was pipetted to a 96-well plate for fluorescence measurement (excitation at 540 nm/emission at 590 nm) using PHERAstar microplate reader (BMG Labtech, Ortenberg, Germany). The fluorescence was normalized for total cell protein.

3.1. ORP10 binds phosphoinositides and cholesterol

A

1.

9.

2.

10.

3.

11.

4.

12.

5.

13.

6.

14.

7.

15.

8.

16.

GST-ORP10 (PH domain)

1475

The C-terminal ligand binding ORD domains of a number of ORPs have been shown to bind oxysterols or cholesterol, while the pleckstrin homology (PH) domains present in most mammalian ORPs show affinity for phosphoinositides (reviewed in [29]). The PH domains of OSBP, ORP9 and ORP11 have been demonstrated to bind several phosphoinositides, including phosphatidylinositol-4-phosphate, PtsIns(4)P, which plays an essential role in targeting the Golgi complex [23,28,30,31]. To examine the ligand binding properties of ORP10, we purified from E. coli GST

GST

GST-ORP10 (ORD)

Spot intensity (I.I.)

300 250 200 150 100 50 0

Cholesterol bound, %

B

100 90 80 70 60 50 40 30 20 10 0

ORP10 Δ412415 ORP10 WT GST Buffer only 25

50

100

Protein amount, pmol Fig. 1. ORP10 binds acidic phospholipids and extracts cholesterol from phospholipid vesicles. A. PIP Strips® membranes probed with GST-ORP10 PH domain, GST-ORP10 ORD or plain GST as a negative control (indicated at the bottom). The integrated intensities (I.I.) of the spots in the bar diagram show binding efficiency of the GST-ORP10 PH domain (black bars) and GST-ORP10 ORD (white bars) to the different phospholipids. B. The ORP10 ORD binds cholesterol. Cholesterol binding was assayed by measuring the ability of GST-ORP10 ORD (WT), GST-ORP10 ORD Δ412–415, or plain GST (negative control) to extract [3H]cholesterol from large unilamellar PC-PE vesicles containing 1 mol% cholesterol. The background release of [3H]cholesterol is indicated by specimens incubated with buffer only. The data represents mean ± SEM (n = 4–6).

1476

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

3.2. Determinants of ORP10 subcellular localization

fusion proteins of the ORP10 PH domain (aa 70–176) and ORD (aa 306–764) and determined their binding to nitrocellulose membranes with 15 different immobilized phospholipids, using plain GST as a negative control. The PH domain of ORP10 bound strongly PtdIns(4)P (Fig. 1A) and displayed weaker affinity for PtdIns(3)P, -(3,4)P2, -(3,5)P2, and -(4,5)P2. Also the ORP10 ORD bound acidic phospholipids, however, with a different specificity: It showed high affinity for PtdIns(3)P, PtdIns(4)P, PtdIns(5)P and phosphatidic acid, and bound more weakly to the other phosphoinositides as well as to phosphatidylserine (Fig. 1A). To analyze binding of sterol ligands by the ORP10 ORD we carried out oxysterol binding assays employing [3H]labeled 25-hydroxycholesterol (OHC), 22(R)-OHC, 27-OHC or 7-ketocholesterol. Cholesterol binding was assayed by measuring the ability of GST-ORP10 ORD to extract [3H]cholesterol from large unilamellar PC-PE vesicles containing 1 mol% cholesterol (100–120 pmol cholesterol per assay). Similar to data reported for the closely related ORP9L [23], no specific binding of the oxysterols was observed (data not shown). However, the ORP10 ORD was able to extract on the average 46% or 49% of the [3H]cholesterol from PC-PE vesicles at the 50 and 100 pmol protein quantities, respectively, while the corresponding amounts of the negative control protein GST released 27 and 30% of the [3H]cholesterol (Fig. 1B). Previously, a four-amino acid deletion in the lid of the ORD of OSBP [32], ORP1L [33], ORP4L [34] and ORP9 [23] was shown to result in defective sterol binding. We generated in ORP10 ORD the corresponding deletion, Δ412–415 (amino acid residues DLTK). Interestingly, the mutant displayed in the in vitro assay an equal or even higher cholesterol extraction capacity than the wild-type ORD (Fig. 1B), similar to the corresponding mutant of ORP1 [33]. We envision that this unexpected behavior most likely reflects a conformational change in the lid region that exposes hydrophobic amino acid residues interacting with cholesterol.

To examine the subcellular localization ORP10 and its determinants we expressed EGFP-ORP10 or its truncated/mutated forms (Fig. 2A) in HuH7 cells and visualized them by using confocal microscopy. Similar to our previous study [20], EGFP-ORP10 displayed a filamentous pattern co-localizing with β-tubulin, consistent with microtubule (MT) association of the full-length protein (Fig. 3A). The C-terminal ORD, ORP10 (306–764) appeared to be mostly cytosolic and nuclear, but also showed partial co-localization with β-tubulin in some cells (Fig. 3B). Fig. 3C shows that the N-terminal fragment (aa 1–318) did not associate with MT. Likewise, the ORP10 PH domain alone (aa 70–176; Fig. 3D) showed no MT association. Using the Coils (http://www.ch.embnet. org/) and SMART programs (http://smart.embl-heidelberg.de/) we found a strong prediction for a coiled-coiled forming segment near the C-terminus of ORP10 (aa 712–740) (Fig. 2B). Therefore, we created a C-terminally truncated EGFP-ORP10 (1–711) lacking this segment (Figs. 3E and 4E). Confocal microscopy of this construct demonstrated loss of microtubule association, indicating that the C-terminal coiledcoil region is required for the MT association of ORP10. Likewise, the ORD lid deletion mutant, ORP10 Δ412–415, showed loss of microtubule association, displaying a cytosolic pattern with additional strongly stained dotty structures (Fig. 3F), suggesting that, in addition to the C-terminal coiled-coil region, a native ORD conformation is required for the ORP10 MT association. Quantification of the MT association of the different ORP10 constructs supported the above interpretations, the full-length ORP10 decorates MT in 94% and ORP10 (306–764) in 41% of transfected cells; the MT association of the other constructs was negligible (Table 1). As we found the ORP10 PH domain to specifically bind PtdIns(4)P present at the Golgi complex and the plasma membrane [35], the

PHD

EGFP

PHD

C-terminal ORP10(306-764)

ORD

ORD

ORP10(1-711)

EGFP

PHD

ORP10 (Δ412-415)

EGFP

PHD

OF

EGFP PHD ORD

OF

PH domain ORP10(70-176)

EGFP

OF

EGFP

N-terminal ORP10(1-318)

OF

A Full length ORP10

ORD 100 aa

OF

PHD Pleckstrin homology domain OSBP fingerprint

ORD OSBP-related domain

Coiled - coil probability

B 1 0.8 0.6 0.4 0.2 0 100

200

300

400 500

600

700

aa Fig. 2. The EGFP-ORP10 constructs used in the study and a prediction of coiled-coil structures in the ORP10 protein. A. Illustration of full-length and truncated EGFP-ORP10 constructs used in this study. B. Prediction of coiled-coil structures in ORP10 by using the Coils (http://www.ch.embnet.org/) program. The y-axis indicates coiled-coil probability and the x-axis ORP10 amino acid residues.

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

EGFP

A

Full length ORP10

B

C-terminal ORP10(306-764)

C

N-terminal ORP10(1-318)

D

PH domain ORP10(70-176)

E

ORP10(1-711)

F

ORP10 (Δ412-415)

β-tubulin

1477

Overlay

Fig. 3. Full length ORP10 localizes on microtubules. HuH7 cells transfected with EGFP-ORP10 constructs and co-stained with an antibody against β-tubulin were visualized by confocal fluorescence microscopy. A. EGFP-Full length ORP10; B. C-terminal EGFP-ORP10 (306–764); C. N-terminal EGFP-ORP10 (1–318); D. EGFP-ORP10 PH domain (70–176); E. EGFP-ORP10 (1–711); F. EGFP-ORP10 (Δ412–415). The channels displayed are identified at the top. Bar, 10 μm.

N-terminal ORP10 (1–318) displaying a perinuclear, Golgi-like localization (Fig. 3C), we explored the association of the different ORP10 constructs with the Golgi complex marked with an antibody against GM130 (Golgi matrix protein of 130 kDa). Full-length ORP10 displayed partial overlap with the Golgi elements, which appeared to associate with MTs in the perinuclear region (Fig. 4A). The C-terminal fragment ORP10 (306–764) displayed no significant Golgi targeting (Fig. 4B), whereas the N-terminal ORP10 fragment (1–318) co-localized extensively with GM130. The ORP10 PH domain, ORP10 (70–176), was distributed in the nucleus and the cytosol, with some weak co-localization with GM130 and occasional plasma membrane targeting (Fig. 4D). The C-terminally truncated ORP10 (1–711) was distributed predominantly in the cytosol, with additional dotty structures part of which colocalized with the Golgi marker (Fig. 4E). Similarly, the ORD mutant

ORP10 (Δ412–415) showed a cytosolic-like distribution and dotty structures some of which co-localized with GM130 (Fig. 4F). Quantification of the overlap of the ORP10 constructs with GM130 confirmed the strongest co-localization of the N-terminal ORP10 (1–318)(Pearson's coefficient 0.415), and a weaker degree of overlap (coefficient 0.206– 0.289) by the full-length ORP10, the PH domain (70–176), ORP10 (1–711), and the Δ412–415 deletion mutant, whereas the C-terminal fragment ORP10 (306–764) showed no detectable overlap with GM130 (Table 1). 3.3. ORP10 associates with ORP9L at specific subcellular sites An earlier high-throughput study using affinity-MS technique demonstrated that ORP10 dimerizes with the related ORP9L [36]. We

1478

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

EGFP

A

Full length ORP10

B

C-terminal ORP10(306764)

C

N-terminal ORP10(1-318)

D

PH domain ORP10(70-176)

E

ORP10(1-711)

F

ORP10 (Δ412-415)

GM130

Overlay

Fig. 4. The N-terminus of ORP10 targets the Golgi complex. Huh7 cells transfected with EGFP-ORP10 constructs and stained with Golgi-specific GM130 antibody were visualized by confocal fluorescence microscopy. A. EGFP-Full length ORP10; B. EGFP-C-terminal ORP10 (306–764); C. EGFP-N-terminal ORP10 (1–318), co-localization with GM130 is indicated with arrows; D. EGFP-ORP10 PH domain (70–176); E. EGFP-ORP10 (1–711), co-localization with GM130 is indicated with an arrow; F. EGFP-ORP10 (Δ412–415). The channels displayed are identified at the top. Bar, 10 μm.

therefore employed the bimolecular fluorescence complementation technique [BiFC; [37]] to visualize in live cells the interaction of ORP10 with ORP9L. In these experiments ORP9 was fused with the used Venus aa 154–238 and ORP10 with the used Venus aa 1–172. A

corresponding ORP9L–ORP11 pair was used as a positive control and the ORP9L–ORP1L-pair as a negative control (ORP1L localizes on late endosomes; [38]). A BiFC signal with a perinuclear emphasis and partial co-localization with the fluorescent Cherry-Golgi marker was

Table 1 Quantification of the co-localization of ORP10 constructs with microtubules (stained for β-tubulin) and the Golgi complex (stained for GM130). ORP10

Microtubular localization (% of cells) Golgi localization (Pearson's coefficient)

Full-length

C-terminal (306–764)

N-terminal (1–318)

PH domain (70–176)

1–711

Δ412–415

94 0.289

41 N.D.

4 0.415

3 0.206

5 0.230

6 0.276

N.D., not determined due to no detectable co-localization with GM130.

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

observed in cells expressing the ORP9L and ORP10 constructs (Fig. 5A). Consistent with the results of Zhou et al. [28], a similar BiFC signal, but with a more extensive Golgi co-localization was detected in cells expressing the positive controls, ORP9L and ORP11 (Fig. 5B), while cells expressing the ORP9L–ORP1L pair were devoid of BiFC fluorescence (Fig. 5C). To further confirm the association of ORP10 with ORP9L suggested by the BiFC analysis, we carried out coimmunoprecipitation of the two proteins from the lysate of HuH7 cells transfected with GFP-ORP10 either alone or together with Xpress®-epitope tagged ORP9L, followed by precipitation with the Xpress® antibody. ORP10 was co-precipitated from the double transfected cells, whereas no signal was detected from cells transfected with GFP-ORP10 alone, evidencing a specific complex of the two proteins (Fig. 5D). Quantification (in 3 experiments) of the total Xpress-ORP9L and GFP-ORP10 in the cell lysates used and in the immunoprecipitates (IP) revealed that approximately 50% of the total lysate ORP9L was recovered in the IP, the proportion for ORP10 being 4%, corresponding to the fact that 8% complexed with all ORP9L in the lysate. Comparison of the lysate ORP9L and ORP10 levels, as well as unpublished observations on ORP9L and ORP10 carrying the same epitope tag, suggested that the absolute expression level of GFP-ORP10 was markedly higher than that of Xpress-ORP9L. Therefore,

1479

the efficiency of ORP10 association with the stoichiometrically less abundant ORP9L is most likely considerably more than 8%. 3.4. ORP10 regulates hepatocellular apoB-100 secretion To study the role of ORP10 in apoB-100 secretion and triglyceride metabolism we created HuH7 hepatoma cell pools in which endogenous ORP10 was stably silenced with shRNA lentiviruses. Two independent ORP10-specific shRNA constructs, shORP10.3 and shORP10.5, were employed, resulting in a 80–90% reduction of the ORP10 protein as compared to cells transduced with a lentivirus expressing a non-targeting shRNA (Fig. 6A). To examine β-lipoprotein secretion by ORP10 silenced hepatic cells, the cellular and medium apoB-100 levels after 24 h incubation in lipid-free medium (containing 5% delipidated serum) were analyzed by Western blotting. This analysis revealed that in both shORP10.3 and shORP10.5 cell growth media there was a significant increase of apoB-100, while the cellular levels of the apolipoprotein were significantly reduced (Fig. 6B and C). Similar experiments with a more quantitative assessment of medium apoB-100 content at different incubation time points were carried out by employing ELISA assays that specifically detect apoB-100, or albumin as a marker for general protein secretion.

Fig. 5. Interaction of ORP10 with ORP9L can be illustrated using the BiFC technique. HuH7 cells were transfected with the indicated constructs. A. BiFC interaction signal of ORP9L fused with Venus aa 154–238 and ORP10 fused with Venus aa 1–172. B. The BiFC interaction signal of ORP9L fused with Venus aa 154–238 and ORP11 with Venus aa 1–172 (positive control). C. The ORP9L–ORP1L-pair (negative control), together with RFP-SEC61β used to identify transfected cells. Colors of the labels above the panels refer to the color of each signal in Merge. Bar, 10 μm. D. ORP10 is co-immunoprecipitated with ORP9L. HuH7 cells were transfected with GFP-ORP10 alone or with Xpress-ORP9L and GFP-ORP10 (identified above the panels), and ORP9L complexes were immunoprecipitated from cell lysates with anti-Xpress®. The precipitates were Western blotted with anti-Xpress® and anti-GFP antibodies (identified on the right). H, IgG heavy chain. The panels on the left represent blots of the lysates and on the right the precipitates (Co-IP). The lysate loading was 1/20 relative to the precipitates; the Lysates panels are from the same blots as the Co-IP, but represent a longer exposure. Approximately 50% of the lysate ORP9L and 4% of the ORP10 were recovered in the immunoprecipitates.

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

ORP10.3

ORP10.5

NT shRNA

A

NT shRNA

1480

85 kDa

ORP10 β-actin

C

ORP10.5

ORP10.3

NT shRNA

ORP10.3

NT shRNA

B

ORP10.5

42 kDa

10

*

9 8 7

*

6

medium 250

5 4

ApoB-100

3 2

cells

** **

1

250 (kDa)

0

Medium NT

Cells

ORP10.3

shRNA

ORP10.5

Fig. 6. Silencing of ORP10 in HuH7 cells: Western blot analysis of apoB-100 in the ORP10 silenced cells and their culture medium. A. Western blot analysis of ORP10 in cells expressing non-targeting (NT) shRNA, shORP10.3 and shORP10.5. Probing with β-actin antibody is shown as a loading control. B. Huh7 cells expressing non-targeting or ORP10-specific shRNAs were incubated for 24 h in medium containing 5% delipidated serum, followed by Western analysis of apoB-100 in total cell lysates and aliquots of the culture medium. C. Quantification of the cell and medium apoB-100 from the Western blots. The ratios of the values for shORP10.3 or shORP10.5 to the ones for NT shRNA cells are shown. The results represent mean±SEM (n=4, *pb 0.05, **pb 0.01, t-test).

Silencing of ORP10 induced a significant increase of apoB-100 in the growth medium (Fig. 7A): At 12 h, the increase in medium apoB-100 was 30% (shORP10.3) or 48% (shORP10.5) as compared to shNT control cells; at 24 h, the corresponding numbers were 63% (P=0.016) and 137% (P=0.005). No difference was detected in the amount of albumin in the medium after 6 h or 24 h incubations (Fig. 7C). To seek for further

B

Medium apoB-100 600 500

NT shRNA

*

shORP10.3

400

*

shORP10.5

300 200 100

[3H]TAG synthesis 30

* *

25 20 15 10 5 0

0

C

DPM/mg cellprot. X 1000

ng/mg cell prot.

A

verification of a role of ORP10 in hepatocyte β-lipoprotein secretion, we transduced another human hepatoma cell line, HepG2, with the ORP10specific and non-targeting shRNA lentiviruses, and assayed the secretion of apoB-100 into serum-free culture medium by the HepG2 cell pools. These cells secreted higher amounts of apoB-100 than the HuH7 cells. Similar to the HuH7 model, ORP10 silencing in HepG2 resulted in an

6

12 hours

24

Medium albumin 25

NT shRNA

D

shORP10.3

[3H]TAG secretion 60000

*

24h

15 10 5

DPM/mg cell prot.

μg/mg cell prot.

6h

20

shORP10.5

50000 40000 30000 20000 10000 0

0

NT shRNA shORP10.3 shORP10.5

NT shRNA

shORP10.3

Fig. 7. ApoB-100 and albumin production and [3H]triacylglycerol (TAG) synthesis/secretion by ORP10 silenced HuH7 cells. A. ApoB-100 production was determined using ELISA from serum-free culture medium of HuH7 cells expressing non-targeting (NT shRNA) or ORP10-specific shRNAs (shORP10.3 and shORP10.5) after 6-h, 12-h and 24-h incubation, and the results were normalized for total cell protein. B. TAG synthesis in the silenced HuH7 cells was measured after pulse-labeling for 30 min at 37 °C with [3H]oleic acid in serum free medium followed by a chase period of 90 min. C. Albumin production was determined using ELISA from culture medium of the HuH7 cells after 6-h and 24-h incubation in serum free medium. D. [3H]TAG secretion into growth medium was analyzed after 105-min labeling of the cells with 350 μM oleic acid–0.5% BSA complexes containing [3H] oleic acid and 3-h chase. Data are presented as mean ± SEM (n = 4, *p b 0.05, t-test).

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

a non-targeting shRNA (Fig. 8A and B). This could be due either to more rapid degradation of the apoB-100 via the ER-associated degradative pathway (ERAD, [40]), or to enhanced secretion of the labeled apolipoprotein. Due to a low level of apoB-100 secreted by HuH7 cells and limitations in the sensitivity of pulse-chase/immunoprecipitation, we were unable to reliably analyze the [ 35S]apoB-100 secreted into the chase medium. To assess whether the observed increase in apoB-100 accumulation in the growth medium of ORP10 knock-down cells could be due to altered proteasomal degradation of the newly synthesized apoB-100, we therefore assayed with ELISA the appearance of apoB-100 in the growth medium in the absence and presence of the proteasomal inhibitor MG132. ORP10 silencing had a similar effect on apoB-100 accumulation under both conditions (Fig. 8C), suggesting that the impact of ORP10 reduction is not directed at the proteasome-mediated ERAD of apoB-100, but rather at the secretion process. The association of ORP10 with ORP9L ([36] and results in Section 3.3) prompted us to study a putative role of an ORP10–ORP9L complex in apoB-100 secretion. We therefore subjected HuH7 cells to siRNAmediated silencing of ORP9L or ORP10, by using previously established siRNA tools [20,28]. ELISA analysis of secreted apoB-100 in the culture medium of the silenced cells after 24 h incubation revealed a significant, 80% increase of the apolipoprotein in the medium of ORP10 silenced cells, whereas the apoB-100 concentration did not differ between controls and the ORP9L silenced cells (Fig. 8D). The lack of effect by ORP9L reduction suggests that, even though part of the cellular ORP10 is associated with ORP9L, ORP9L may not function in the distinct ORP10-containing complex responsible for regulating apoB-100 secretion. To investigate the possibility that apoB-100 re-uptake might be affected upon ORP10 silencing, we analyzed the cellular expression level of LDL receptor (LDLR), and carried out LDL uptake experiments

enhancement of apoB-100 secretion as determined with the ELISA assay, detected at the 12 h time point as a trend and at the 24 h time point as a significant increase of medium apoB-100 (Supplemental Fig. 1). To evaluate the role of ORP10 in hepatocellular triglyceride biosynthesis, we labeled the lentivirally transduced HuH7 cells for 30 min with [ 3H]oleic acid and measured the cellular [ 3H]TAG radioactivity. Consistent with the data reported earlier for cells transiently transfected with ORP10 siRNA [20] we found ORP10 silencing with the two shRNAs to increase triglyceride synthesis by 83% (shORP10.3; p = 0.003) and 112% (shORP10.5; p = 0.001) (Fig. 7B). However, analysis of the total TAG content of the cells by thin layer chromatography or enzymatic quantification revealed no increase of cellular TAG in the ORP10 silenced cell pools (data not shown). Therefore, we analyzed [3H]TAG in the culture medium. The shORP10.3 cells were labeled for 105 min with [3H]oleic acid, followed by a 3-h chase. To enhance TAG synthesis and secretion by the HuH7 cells which under standard growth conditions secrete little TAG [39], these experiments were carried out with cells that were prior to labeling treated overnight with 350 μM oleic acid complexed with BSA. Consistent with increased apoB-100 in the medium, [ 3H]TAG in the medium was increased by 102% (p=0.008) for shORP10.3 cells as compared to the control cells (Fig. 7D). The observed difference in apoB-100 accumulation in the growth medium of ORP10-deficient and control cells could in principle be due either to enhanced apoB-100 secretion or to reduced re-uptake via the LDL receptor pathway. To investigate the potential role of apoB-100 secretion, we carried out pulse-chase experiments in which apoB-100 in control and shORP10.3 cells was biosynthetically labeled with [35S] methionine/cysteine, and the reduction of cellular apoB-100 was monitored as a function of time. In the shORP10.3 cells, the cellular apoB-100 was turned over more rapidly than in control cells expressing

A

B

Chase (min)

NT shRNA

shORP10.3

60 30 15 0

0 15 30 60

(%) 150 100 50

250 (kDa)

0

C ng apoB-100/mg protein

1481

900 800 700 600 500 400 300 200 100 0

* 0

15 30 Chase (min) NT

60

NT shRNA shORP10.3

**

NT shRNA NT shRNA+MG132

**

shORP10.3 shORP10.3+MG132

** ** 6h

24h

ng apoB-100/mg protein

D 700 600

6h

500

24h

**

400 300 200 100 0

siNT

siORP9

siORP10

Fig. 8. ApoB-100 turn-over is enhanced in cells with silenced ORP10. ApoB-100 turnover in HuH7 cells expressing non-targeting shRNA (NT shRNA) or shORP10.3 was analyzed in pulse-chase experiments employing [35S]methionine/cysteine labeling, apoB-100 immunoprecipitation, SDS-PAGE and autoradiography. A. SDS-PAGE gel of cells at the indicated chase time points. B. Quantification of the results, relative cellular [35S]apoB-100 quantity (time point 0 was set at 100%). C. The impact of proteasome inhibitor MG132 (20 μM) on apoB-100 production into serum-free culture medium of NT shRNA and shORP10.3 cells after 6- or 24-h incubation was measured by using a specific ELISA, and the results were normalized for total cell protein. D. ORP9L silencing does not modify apoB-100 production. HuH7 cells were transiently transfected with non-targeting (siNT), ORP9L-specific (siORP9) or ORP10-specific (siORP10) siRNAs, and apoB-100 in culture medium after 6- or 24-h incubation was quantified with ELISA. The results represent mean ± SEM (n = 4, *p b 0.05, **p b 0.01, t-test; comparison to the corresponding NT shRNA expressing cells or siNT-transfected cells).

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

employing fluorescent DiI-labeled LDL. The shORP10.3 HuH7 cells displayed a reduced cellular level of LDLR (Fig. 9A and B) and, consistently, reduced uptake of DiI-LDL (Fig. 9C and D), while the shORP10.5 cells displayed an LDLR level (Fig. 9A and B) and DiI-LDL uptake (Fig. 9C and D) similar to that of the controls. These differences in LDL uptake are unlikely to explain the observed increase of apoB-100 in the growth medium of ORP10 silenced cells, since the two independent cell pools both show that this apoB-100 phenotype diverged in DiI-LDL uptake.

lipoprotein metabolism [41], it will in the future be of importance to study ORP10 function not only in hepatocytes but also in an intestinal model. The observation that the ORP10 ORD has the capacity to bind cholesterol but not oxysterols is reminiscent of the results reported for the closely related ORP9L [23]. Moreover, we have been unable to demonstrate oxysterol binding by the closest homologue of ORP10, ORP11 (Y. Zhou and V.M. Olkkonen, unpublished). These findings indicate that the branch of the ORP phylogenetic tree consisting of ORP9, -10, and ‐11 [17] may represent proteins whose main ligand is cholesterol, not oxysterol. Furthermore, our data demonstrates that the ORP10 ORD shows affinity for practically all acidic phospholipids probed. The affinity for acidic phospholipids is a property shared by yeast Osh4p and Osh6p as well as mammalian ORP1S, ORP2, and ORP9S [42–46]. Our data did not reproduce the relatively specific binding of the ORP10 ORD to PtdIns(3)P reported in [45]. One possible reason for this discrepancy is the use of different fusion protein break-points in the two studies: our ORP10 ORD consisted of aa 306–764, while that of Fairn and McMaster carried ORP10 aa 174–764. Interestingly, association of Osh4p with acidic phospholipids mediated by two distinct regions on the surface of the sterol-binding ORD domain was shown to play an important role in sterol binding and transfer by the protein [47]. Similarly, binding of the ORP10 ORD to phospholipids on membrane surfaces could facilitate extraction of cholesterol from the membranes. Of the mammalian ORPs, OSBP, ORP9L and the ORP5 ORD, have been demonstrated to transfer cholesterol between membranes in vitro [23,48], and ORP1S and ORP2 were reported to be capable of cholesterol transport in live cells [49]. Whether ORP10 has the capacity to transfer cholesterol between subcellular compartments is an interesting question subject to future investigation. PH domains are best known for their ability to bind phosphoinositides (PIPs), even though less than 10% of all PH domains show high affinity for specific PIPs [50]. Our in vitro data demonstrate a high specificity of the

4. Discussion

NT shRNA ORP10.3 ORP10.5

NT shRNA ORP10.3 ORP10.5

A

NT shRNA ORP10.3 ORP10.5

NT shRNA ORP10.3 ORP10.5

Our previous human genetic findings suggested that ORP10 gene polymorphisms associate with high serum triglyceride levels and in vitro cell culture studies proposed ORP10 to play a role in cellular lipid metabolism [20]. In this study we dissected the determinants of ORP10 subcellular targeting and further explored the role of ORP10 in β-lipoprotein metabolism using HuH7 and HepG2 hepatoma cells subjected to stable shRNA-mediated ORP10 silencing. Our major results show the ability of ORP10 ORD to bind cholesterol and acidic phospholipids, but not oxysterols, and the specific affinity of the ORP10 PH domain for PtdIns(4)P. ORP10 localizes on microtubules, but also displays Golgi targeting mediated by the N-terminal PH domain-containing region. Even though we do not have evidence on a direct interaction of ORP10 with tubulins, our earlier finding that ORP10 decorates tubulin paracrystals arising upon treatment of cells with vinblastine, suggests an intimate association of this ORP with tubulin [20]. Our data on shRNA expressing HuH7 and HepG2 cells suggest that ORP10 silencing facilitates hepatocyte β-lipoprotein secretion—in other words, the endogenous ORP10 negatively regulates β-lipoprotein production. This finding could explain the genetic findings suggesting association of OSBPL10 genetic variation with dyslipidemias and atherosclerosis [20–22]. However, considering that the liver and the intestine together coordinate lipid and

B

130

LDL-R

100 75 55

-actin

Relative LDL-R quantity

1482

1.6 1.4 1.2 1 0.8 0.6 0.4 0.2

*

0

35 (kDa)

NT shRNA

ORP10.3

ORP10.5

D 45

350

Specific uptake (%)

x 10000

DiI-LDL uptake (Fluorescence/mg cell prot.)

C 300 250 200 150 100 50

35 30

*

25 20 15 10 5 0

0

50x unlab. LDL

40

NT shRNA shORP10.3 shORP10.5! +

-

+

-

+

NT shRNA shORP10.3 shORP10.5

-

Fig. 9. LDL receptor expression and DiI-LDL uptake by ORP10 silenced HuH7 cells. A. LDLR Western blot of NT shRNA, shORP10.3, and shORP10.5 cells cultured for 24 h in medium containing 5% delipidated serum B. Quantification of the Western results; mean ± SEM (n = 4, *p b 0.05, t-test). C. Uptake of DiI-LDL was assayed at 37 °C for 30 min and measured as fluorescence of lysed samples of cells incubated in the presence or absence of 50× excess of unlabeled LDL (indicated at the bottom). D. Specific uptake of DiI-LDL (difference between values in the presence and absence of unlabeled LDL), mean ± SEM (n = 6, *p b 0.05, t-test).

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

ORP10 PH domain for PtdIns(4)P, and weak binding of PtdIns(3)P, -(3,4) P2, -(3,5)P2, and -(4,5)P2. This PH domain thus seems to be different from the PH domains of OSBP, ORP9 and ORP11, which bind in vitro PtdIns(4)P and also other PIPs with similar efficiency [23,28,30,31]. Despite the observed PtdIns(4)P binding, the ORP10 PH domain alone did not target the Golgi as efficiently as the N-terminal fragment ORP10 (1–318) and it also showed some affinity for the plasma membrane, the other major location of PtdIns(4)P [50]. The Golgi targeting capacity of the ORP10 PH domain thus seems to be weaker than that of the OSBP PH domain, which associates quite extensively with the Golgi complex [51]; the finding suggests that the N-terminal region of ORP10 carries other determinants, which, together with the PH domain, are required for efficient targeting of ORP10 (1–318) to Golgi membranes. Studies on the determinants of ORP10 localization demonstrated that the full-length protein is associated with microtubules (MT). The MT association was lost in the truncated forms of ORP10: the N-terminal fragment (aa 1–318), the PH domain (aa 70–176), and the C-terminally truncated ORP10 (aa 1–711), as well as in the sterol-binding pocket lid deletion mutant ORP10 (Δ412–415). The C-terminal fragment (aa 306–764) displayed partial MT association. The N-terminal ORP10 (1–318), and partially also the C-terminally truncated ORP10 (aa 1–711) and ORP10 (Δ412–415), are associated with the Golgi complex. These observations suggest that the MT localization determinants of ORP10 are situated close to the C-terminus, the region of aa 712–764, which contains a predicted coiled-coil forming helical motif. The MT targeting is disturbed when the sterol binding fold is distracted by the deletion of aa 412–415, and somewhat impaired when the N-terminal portion of the protein is removed (in the ORD fragment 306–764). This conclusion is consistent with the earlier findings suggesting an intimate interplay of the N- and C-terminal domains of ORP family members, OSBP [52] and ORP3 [53]. The Golgi targeting of ORP10 is in our experiments enhanced when the protein is manipulated by truncation: the N-terminal fragment 1–318 displays strong Golgi association, demonstrating an inherent Golgi affinity of this aa segment and suggesting that the MT affinity masks an inherent Golgi specificity of ORP10. It remains to be determined whether the Golgi targeting of full-length endogenous ORP10 can be induced by a yet unidentified physiologic stimulus, as is the case for OSBP [54]. BiFC and co-immunoprecipitation analyses suggest the presence of a specific interaction of ORP9L with ORP10 at perinuclear ER and Golgi membranes at which ORP9L is anchored via interactions of its FFAT motif with VAP proteins [55]. It is important to realize that the BiFC technique only visualizes the portion of the expressed ORP10 fusion protein that interacts with ORP9L: hence the difference from the predominantly MT-associated distribution of ORP10 (when expressed alone) is not unexpected. The present findings provide evidence for a functional role of hepatocyte ORP10 in β-lipoprotein secretion, while we found no effect of ORP10 silencing on general protein secretion as measured by albumin quantification. The MT association of ORP10, the Golgi affinity displayed by its N-terminal determinants and the altered apoB-100 secretion detected in ORP10-silenced cells suggest that the protein may be involved in secretory pathway membrane trafficking. ApoB-100 exits the ER in carrier vesicles distinct from those employed by regular secretory proteins [12]; we find it possible that ORP10 could have a function in the trafficking of this vesicle subtype. Overexpression of the close relative of ORP10, ORP9S, was recently shown to modify secretory protein transport from the ER to the Golgi [23], and the yeast ORP Osh4p/Kes1p is an established negative regulator of Golgi-derived vesicular transport [56,57]. We therefore envision that ORP10 could, in analogy, act as a negative regulator of ER–Golgi transport of apoB-100. The enhanced apoB-100 secretion could also be connected with the observation that ORP10 silencing increased the incorporation of [ 3H]oleic acid into TAG. We find it possible that small changes in the functional properties of microtubules in ORP10 knock-down cells could result in subtle alterations in the topological arrangement of ER cisternae and lipid droplets,

1483

sites at which TAG synthesis, storage and secretion are organized, with impacts apoB-100 stability and VLDL secretion [58]. However, we could not detect a consistent increase of total cellular TAG; neither did we observe by fluorescence microcopy differences in the size or distribution of Bodipy558/568-C12 or ‐493/503 stained lipid droplets between ORP10 knock-down and control HuH7 or HepG2 cells (data not shown). Therefore, if the impact of ORP10 silencing on apoB-100 secretion was related to a more abundant TAG supply during apoB-100 synthesis and folding in the ER [59], this would represent an increase in TAG available locally, not the total cellular TAG pool. Such an impact should be associated with increased stability of the newly synthesized cellular apoB-100, which was not detected. A stabilization effect, however, would in our pulsechase experiments be counteracted by enhanced apoB-100 secretion, resulting in a complex sum effect. The present experimental set-up therefore does not allow us to draw conclusions on possible small changes in apoB-100 stability. Even though we found evidence on a physical complex between ORP10 and ORP9L, siRNA-mediated silencing of ORP9L did not enhance apoB-100 secretion by HuH7 cells. While a majority of ORP10 localizes on MT, the BiFC analysis localized the ORP10– ORP9L interaction at perinuclear membranes in the Golgi region. We find it possible that (i) the ORP10 function involving negative regulation of apoB-100 secretion is executed by an ORP10 pool (putatively MT-associated) not complexed with ORP9L, or (ii) the residual amount of ORP9L remaining in the siRNA-transfected cells is sufficient to carry out a negative regulatory function. As a conclusion, we characterize in the present study the ligand binding properties of ORP10 in vitro, the subcellular localization of the protein and its molecular determinants, as well as the function of ORP10 in hepatocellular apoB-100 production. The findings pave way for future work aimed at a detailed understanding of the role of ORPs as modifiers of human lipoprotein metabolism, dyslipidemias, and atherogenesis. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.bbalip.2012.08.004. Acknowledgements The technical assistance from Liisa Arala, Eeva Jääskeläinen, Seija Puomilahti and Pirjo Ranta is gratefully acknowledged. This work was supported by grants from the Academy of Finland (grant 121457 to V.M.O.; grants 131429 and 131489 to E.I.), the Sigrid Juselius Foundation, the Finnish Foundation for Cardiovascular Research, The Novo Nordisk Foundation, the Liv och Hälsa Foundation, the Magnus Ehrnrooth Foundation (to V.M.O.), and the European Union FP7 (LipidomicNet, agreement no. 202272). The funding agencies had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript. References [1] P. Libby, Inflammation in atherosclerosis, Nature 420 (2002) 868–874. [2] J. Nigro, N. Osman, A.M. Dart, P.J. Little, Insulin resistance and atherosclerosis, Endocr. Rev. 27 (2006) 242–259. [3] G.M. Reaven, Multiple CHD risk factors in type 2 diabetes: beyond hyperglycaemia, Diabetes Obes. Metab. 4 (Suppl. 1) (2002) S13–S18. [4] M. Adiels, J. Westerbacka, A. Soro-Paavonen, A.M. Hakkinen, S. Vehkavaara, M.J. Caslake, C. Packard, S.O. Olofsson, H. Yki-Jarvinen, M.R. Taskinen, J. Boren, Acute suppression of VLDL1 secretion rate by insulin is associated with hepatic fat content and insulin resistance, Diabetologia 50 (2007) 2356–2365. [5] M. Myerson, C. Ngai, J. Jones, S. Holleran, R. Ramakrishnan, L. Berglund, H.N. Ginsberg, Treatment with high-dose simvastatin reduces secretion of apolipoprotein B-lipoproteins in patients with diabetic dyslipidemia, J. Lipid Res. 46 (2005) 2735–2744. [6] G. Boden, Obesity, insulin resistance and free fatty acids, Curr. Opin. Endocrinol. Diabetes Obes. 18 (2011) 139–143. [7] H.N. Ginsberg, Insulin resistance and cardiovascular disease, J. Clin. Invest. 106 (2000) 453–458. [8] S.O. Olofsson, L. Asp, J. Boren, The assembly and secretion of apolipoprotein B-containing lipoproteins, Curr. Opin. Lipidol. 10 (1999) 341–346. [9] C.A. Alexander, R.L. Hamilton, R.J. Havel, Subcellular localization of B apoprotein of plasma lipoproteins in rat liver, J. Cell Biol. 69 (1976) 241–263.

1484

E. Nissilä et al. / Biochimica et Biophysica Acta 1821 (2012) 1472–1484

[10] G.S. Shelness, M.F. Ingram, X.F. Huang, J.A. DeLozier, Apolipoprotein B in the rough endoplasmic reticulum: translation, translocation and the initiation of lipoprotein assembly, J. Nutr. 129 (1999) 456S–462S. [11] A. Bakillah, A. El Abbouyi, The role of microsomal triglyceride transfer protein in lipoprotein assembly: an update, Front. Biosci. 8 (2003) d294–d305. [12] S.A. Siddiqi, VLDL exits from the endoplasmic reticulum in a specialized vesicle, the VLDL transport vesicle, in rat primary hepatocytes, Biochem. J. 413 (2008) 333–342. [13] S. Siddiqi, A.M. Mani, S.A. Siddiqi, The identification of the SNARE complex required for the fusion of VLDL-transport vesicle with hepatic cis-Golgi, Biochem. J. 429 (2010) 391–401. [14] F.R. Taylor, A.A. Kandutsch, Oxysterol binding protein, Chem. Phys. Lipids 38 (1985) 187–194. [15] P.A. Dawson, D.R. Van der Westhuyzen, J.L. Goldstein, M.S. Brown, Purification of oxysterol binding protein from hamster liver cytosol, J. Biol. Chem. 264 (1989) 9046–9052. [16] P.A. Dawson, N.D. Ridgway, C.A. Slaughter, M.S. Brown, J.L. Goldstein, cDNA cloning and expression of oxysterol-binding protein, an oligomer with a potential leucine zipper, J. Biol. Chem. 264 (1989) 16798–16803. [17] M. Lehto, S. Laitinen, G. Chinetti, M. Johansson, C. Ehnholm, B. Staels, E. Ikonen, V.M. Olkkonen, The OSBP-related protein family in humans, J. Lipid Res. 42 (2001) 1203–1213. [18] L. Bouchard, A. Tchernof, Y. Deshaies, S. Marceau, O. Lescelleur, S. Biron, M.C. Vohl, ZFP36: a promising candidate gene for obesity-related metabolic complications identified by converging genomics, Obes. Surg. 17 (2007) 372–382. [19] L. Bouchard, G. Faucher, A. Tchernof, Y. Deshaies, S. Marceau, O. Lescelleur, S. Biron, C. Bouchard, L. Perusse, M.C. Vohl, Association of OSBPL11 gene polymorphisms with cardiovascular disease risk factors in obesity, Obesity (Silver Spring) 17 (2009) 1466–1472. [20] J. Perttilä, K. Merikanto, J. Naukkarinen, I. Surakka, N.W. Martin, K. Tanhuanpää, V. Grimard, M.R. Taskinen, C. Thiele, V. Salomaa, A. Jula, M. Perola, I. Virtanen, L. Peltonen, V.M. Olkkonen, OSBPL10, a novel candidate gene for high triglyceride trait in dyslipidemic Finnish subjects, regulates cellular lipid metabolism, J. Mol. Med. 87 (2009) 825–835. [21] H. Koriyama, H. Nakagami, T. Katsuya, H. Akasaka, S. Saitoh, K. Shimamoto, T. Ogihara, Y. Kaneda, R. Morishita, H. Rakugi, Variation in OSBPL10 is associated with dyslipidemia, Hypertens. Res. 33 (2010) 511–514. [22] H. Koriyama, H. Nakagami, T. Katsuya, K. Sugimoto, H. Yamashita, Y. Takami, S. Maeda, M. Kubo, A. Takahashi, Y. Nakamura, T. Ogihara, H. Rakugi, Y. Kaneda, R. Morishita, Identification of evidence suggestive of an association with peripheral arterial disease at the OSBPL10 locus by genome-wide investigation in the Japanese population, J. Atheroscler. Thromb. 17 (2010) 1054–1062. [23] M. Ngo, N.D. Ridgway, Oxysterol binding protein-related protein 9 (ORP9) is a cholesterol transfer protein that regulates Golgi structure and function, Mol. Biol. Cell 20 (2009) 1388–1399. [24] R. Hynynen, M. Suchanek, J. Spandl, N. Back, C. Thiele, V.M. Olkkonen, OSBP-related protein 2 is a sterol receptor on lipid droplets that regulates the metabolism of neutral lipids, J. Lipid Res. 50 (2009) 1305–1315. [25] H. Nakabayashi, K. Taketa, K. Miyano, T. Yamane, J. Sato, Growth of human hepatoma cells lines with differentiated functions in chemically defined medium, Cancer Res. 42 (1982) 3858–3863. [26] T. Zhou, S. Li, W. Zhong, T. Vihervaara, O. Beaslas, J. Perttilä, W. Luo, Y. Jiang, M. Lehto, V.M. Olkkonen, D. Yan, OSBP-related protein 8 (ORP8) regulates plasma and liver tissue lipid levels and interacts with the nucleoporin Nup62, PLoS One 6 (2011) e21078. [27] M. Johansson, M. Lehto, K. Tanhuanpää, T.L. Cover, V.M. Olkkonen, The oxysterolbinding protein homologue ORP1L interacts with Rab7 and alters functional properties of late endocytic compartments, Mol. Biol. Cell 16 (2005) 5480–5492. [28] Y. Zhou, S. Li, M.I. Mäyränpää, W. Zhong, N. Back, D. Yan, V.M. Olkkonen, OSBP-related protein 11 (ORP11) dimerizes with ORP9 and localizes at the Golgi-late endosome interface, Exp. Cell Res. 316 (2010) 3304–3316. [29] T. Vihervaara, M. Jansen, R.L. Uronen, Y. Ohsaki, E. Ikonen, V.M. Olkkonen, Cytoplasmic oxysterol-binding proteins: sterol sensors or transporters? Chem. Phys. Lipids 164 (2011) 443–450. [30] T.P. Levine, S. Munro, The pleckstrin homology domain of oxysterol-binding protein recognises a determinant specific to Golgi membranes, Curr. Biol. 8 (1998) 729–739. [31] T.P. Levine, S. Munro, Targeting of Golgi-specific pleckstrin homology domains involves both PtdIns 4-kinase-dependent and -independent components, Curr. Biol. 12 (2002) 695–704. [32] R.J. Perry, N.D. Ridgway, Oxysterol-binding protein and vesicle-associated membrane protein-associated protein are required for sterol-dependent activation of the ceramide transport protein, Mol. Biol. Cell 17 (2006) 2604–2616. [33] T. Vihervaara, R.L. Uronen, G. Wohlfahrt, I. Björkhem, E. Ikonen, V.M. Olkkonen, Sterol binding by OSBP-related protein 1L regulates late endosome motility and function, Cell. Mol. Life Sci. 68 (2011) 537–551. [34] J.P. Wyles, R.J. Perry, N.D. Ridgway, Characterization of the sterol-binding domain of oxysterol-binding protein (OSBP)-related protein 4 reveals a novel role in vimentin organization, Exp. Cell Res. 313 (2007) 1426–1437.

[35] G.R. Hammond, G. Schiavo, R.F. Irvine, Immunocytochemical techniques reveal multiple, distinct cellular pools of PtdIns4P and PtdIns(4,5)P(2), Biochem. J. 422 (2009) 23–35. [36] M.E. Sowa, E.J. Bennett, S.P. Gygi, J.W. Harper, Defining the human deubiquitinating enzyme interaction landscape, Cell 138 (2009) 389–403. [37] A.M. Robida, T.K. Kerppola, Bimolecular fluorescence complementation analysis of inducible protein interactions: effects of factors affecting protein folding on fluorescent protein fragment association, J. Mol. Biol. 394 (2009) 391–409. [38] M. Johansson, V. Bocher, M. Lehto, G. Chinetti, E. Kuismanen, C. Ehnholm, B. Staels, V.M. Olkkonen, The two variants of oxysterol binding protein-related protein-1 display different tissue expression patterns, have different intracellular localization, and are functionally distinct, Mol. Biol. Cell 14 (2003) 903–915. [39] S.J. Meex, U. Andreo, J.D. Sparks, E.A. Fisher, Huh-7 or HepG2 cells: which is the better model for studying human apolipoprotein-B100 assembly and secretion? J. Lipid Res. 52 (2011) 152–158. [40] L.R. Lapierre, D.L. Currie, Z. Yao, J. Wang, R.S. McLeod, Amino acid sequences within the beta1 domain of human apolipoprotein B can mediate rapid intracellular degradation, J. Lipid Res. 45 (2004) 366–377. [41] C. Xiao, J. Hsieh, K. Adeli, G.F. Lewis, Gut-liver interaction in triglyceride-rich lipoprotein metabolism, Am. J. Physiol. Endocrinol. Metab. 301 (2011) E429–E446. [42] G.D. Fairn, C.R. McMaster, Identification and assessment of the role of a nominal phospholipid binding region of ORP1S (oxysterol-binding-protein-related protein 1 short) in the regulation of vesicular transport, Biochem. J. 387 (2005) 889–896. [43] P. Wang, W. Duan, A.L. Munn, H. Yang, Molecular characterization of Osh6p, an oxysterol binding protein homolog in the yeast Saccharomyces cerevisiae, FEBS J. 272 (2005) 4703–4715. [44] Y. Xu, Y. Liu, N.D. Ridgway, C.R. McMaster, Novel members of the human oxysterol-binding protein family bind phospholipids and regulate vesicle transport, J. Biol. Chem. 276 (2001) 18407–18414. [45] G.D. Fairn, C.R. McMaster, The roles of the human lipid-binding proteins ORP9S and ORP10S in vesicular transport, Biochem. Cell Biol. 83 (2005) 631–636. [46] R. Hynynen, S. Laitinen, R. Käkelä, K. Tanhuanpää, S. Lusa, C. Ehnholm, P. Somerharju, E. Ikonen, V.M. Olkkonen, Overexpression of OSBP-related protein 2 (ORP2) induces changes in cellular cholesterol metabolism and enhances endocytosis, Biochem. J. 390 (2005) 273–283. [47] T.A. Schulz, W.A. Prinz, Sterol transport in yeast and the oxysterol binding protein homologue (OSH) family, Biochim. Biophys. Acta 1771 (2007) 769–780. [48] X. Du, J. Kumar, C. Ferguson, T.A. Schulz, Y.S. Ong, W. Hong, W.A. Prinz, R.G. Parton, A.J. Brown, H. Yang, A role for oxysterol-binding protein-related protein 5 in endosomal cholesterol trafficking, J. Cell Biol. 192 (2011) 121–135. [49] M. Jansen, Y. Ohsaki, L. Rita Rega, R. Bittman, V.M. Olkkonen, E. Ikonen, Role of ORPs in sterol transport from plasma membrane to ER and lipid droplets in mammalian cells, Traffic 12 (2011) 218–231. [50] M.A. Lemmon, Pleckstrin homology (PH) domains and phosphoinositides, Biochem. Soc. Symp. 74 (2007) 81–93. [51] T.A. Lagace, D.M. Byers, H.W. Cook, N.D. Ridgway, Altered regulation of cholesterol and cholesteryl ester synthesis in Chinese-hamster ovary cells overexpressing the oxysterol-binding protein is dependent on the pleckstrin homology domain, Biochem. J. 326 (1997) 205–213. [52] P.Y. Wang, J. Weng, S. Lee, R.G. Anderson, The N terminus controls sterol binding while the C terminus regulates the scaffolding function of OSBP, J. Biol. Chem. 283 (2008) 8034–8045. [53] M. Lehto, R. Hynynen, K. Karjalainen, E. Kuismanen, K. Hyvärinen, V.M. Olkkonen, Targeting of OSBP-related protein 3 (ORP3) to endoplasmic reticulum and plasma membrane is controlled by multiple determinants, Exp. Cell Res. 310 (2005) 445–462. [54] N.D. Ridgway, P.A. Dawson, Y.K. Ho, M.S. Brown, J.L. Goldstein, Translocation of oxysterol binding protein to Golgi apparatus triggered by ligand binding, J. Cell Biol. 116 (1992) 307–319. [55] J.P. Wyles, N.D. Ridgway, VAMP-associated protein-A regulates partitioning of oxysterol-binding protein-related protein-9 between the endoplasmic reticulum and Golgi apparatus, Exp. Cell Res. 297 (2004) 533–547. [56] M. Fang, B.G. Kearns, A. Gedvilaite, S. Kagiwada, M. Kearns, M.K. Fung, V.A. Bankaitis, Kes1p shares homology with human oxysterol binding protein and participates in a novel regulatory pathway for yeast Golgi-derived transport vesicle biogenesis, EMBO J. 15 (1996) 6447–6459. [57] X. Li, M.P. Rivas, M. Fang, J. Marchena, B. Mehrotra, A. Chaudhary, L. Feng, G.D. Prestwich, V.A. Bankaitis, Analysis of oxysterol binding protein homologue Kes1p function in regulation of Sec14p-dependent protein transport from the yeast Golgi complex, J. Cell Biol. 157 (2002) 63–77. [58] S.O. Olofsson, P. Bostrom, L. Andersson, M. Rutberg, J. Perman, J. Boren, Lipid droplets as dynamic organelles connecting storage and efflux of lipids, Biochim. Biophys. Acta 1791 (2009) 448–458. [59] G.S. Shelness, J.A. Sellers, Very-low-density lipoprotein assembly and secretion, Curr. Opin. Lipidol. 12 (2001) 151–157.