- Email: [email protected]
Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13
Biochemical and Biophysical Research Communications xxx (2015) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13 Haiqing Li a, 1, Zhonghe Zhang c, 1, Zhiqiang Chen a, *, Dongdong Zhang b, ** a b c
Department of Orthopedic Surgery, Liaocheng People's Hospital, 67 Dongchang West Road, Liaocheng 252000, China Department of Ultrasound, Liaocheng People's Hospital, 67 Dongchang West Road, Liaocheng 252000, China Department of Orthopedic Surgery, Liaocheng Hospital of Traditional Chinese Medicine, Liaocheng 252000, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 21 August 2015 Accepted 25 August 2015 Available online xxx
The aim of present study was to characterize long non-coding RNA (lncRNA) AK141205 as a cellular regulator of osteogenic differentiation of mice mesenchymal stem cells (MSCs) towards osteogenic growth peptide (OGP) stimulation. Mice MSCs cells were isolated, transfected with si-AK141205, pcDNAAK141205 or control, and stimulated with OGP. The AK141205, CXC chemokine ligand-13 (CXCL13), and osteogenic differentiation-associated parameters were determined by western blotting or quantitative RT-PCR. To determine the role of AK141205/CXCL13 in SMCs osteogenic differentiation, SMCs subjected to co-transfection of pcDNA-AK141205 and si-CXCL13 or si-AK141205 and pcDNA-CXCL13, and were submitted for osteogenic differentiation-associated parameters analyses. The results showed that stimulation of SMCs with OGP induced upregulation of both AK141205 and CXCL13, and osteogenic differentiation of MSCs. Transfection of si-AK141205 partly suppressed OGP-induced formation of calcium salt nodules, alkaline phosphatase (ALP) activity and osteogenic differentiation-associated gene expression, suggesting key regulatory role of AK141205. Analysis of CXCL13 expression in SMCspcDNAAK141205 revealed that AK141205 positively promoted CXCL13 expression via acetylation of H4 histone in the promoter region. This signal transduction was demonstrated to be essential for OGP-induced osteogenic differentiation of MSCs through osteogenic differentiation analysis in simultaneously AK141205/CXCL13 controlled SMCs. In summary, we report a completely novel role of AK141205/CXCL13 as a regulator of OGP-induced osteogenic differentiation of SMCs. Our finding provides a potential therapeutic targeting of AK141205 for enhancing disease-treatment effect of SMCs. © 2015 Published by Elsevier Inc.
Keywords: Alkaline phosphatase (ALP) activity AK141205 Mesenchymal stem cells Osteogenic growth peptide Runx2
1. Introduction Adult bone mesenchymal stem cells (MSCs) are one of members of stem/progenitor cell family and were distributed in the bone marrow stroma. Evidences point out that the MSCs were progenitors of different cell lineages and are capable of multiple differentiation potential, including lineages including fibroblasts, osteoblasts, adipocytes, or chondrocytes [1]. The multipotent SMCs have been applied MSCs into clinical therapy on account of tissue
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (Z. Chen), [email protected] (D. Zhang). 1 These authors contributed equally.
regeneration and homeostasis, due to their characteristic of easy isolation and osteogenesis-directed differentiation potential [2]. However, the underlying mechanism of MSCs to differentiate into osteoblasts in response to signals from its microenvironment remains to be elaborated [3]. Over the last decades, bioactive molecule-assisted SMCs strategies have been aroused a lot of attention. Laminin, fibroblast growth factor, and bone morphogenic protein-2 which are coloaded with SMCs on the surfaces of graft substantially enhance MSCs differentiation [4], and improve osteogenesis [5]. Notably, the osteogenic growth peptide (OGP), a short, linear tetradecapeptide and initially was found in the serum of human, was regarded as a inducer for osteogenic differentiation of MSCs [6,7]. When coincubated with MSCs, OGP promotes osteogenic differentiation because of its regulatory role in alkaline phosphatase (ALP) activity
http://dx.doi.org/10.1016/j.bbrc.2015.08.112 0006-291X/© 2015 Published by Elsevier Inc.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
2
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
and mineralized nodule formation, and stimulated osteoblastspecific mRNA expression of Osteocalcin (BGP) [8]. Although evidences pointed out OGP effectively enhanced MSCs differentiation into osteoblasts, the potential mechanism of the process has not been elucidated completely. The genetic networks controlling stem cell differentiation are the focus of intense interest, due to their obvious therapeutic potential. Recently, a noteworthy class of potential regulatory RNAs, long non-coding RNAs (lncRNA) in lineage commitment of MSCs, arouses researchers' attention [9]. Since it was initially founded, lncRNA was reflected in diverse biological roles including those in modulation of phenotypic transcriptional factors of SMCs, such as Runx2, a key element for osteoblasts [10,11]. A notable property of some mammalian lncRNAs is their ability to control expression of key transcriptional factors in develop and disease, for example through promoter modification [12]. Presently, aberrant AK141205, a novel and potentially differentiation-related lncRNA [13] were observed in process of multidirectional differentiation of stem cells through promoting or inhibiting differentiation activity. Here, we report lncRNA AK141205 and determine whether AK141205 in involved in SMCs osteogenic differentiation induced by OGP. 2. Material and methods 2.1. Cell isolation, differentiation MSCs were isolated and harvested from male SpragueeDawley rats (aged 6 weeks; 200e250 g). Briefly, femurs were isolated form the anesthetized rats (Xylasin 2% in 1 mg/kg as premedication and Ketamin HCl 10% in 60 mg/kg) and were subjected to wash by a complete culture medium that consist of low glucose DMEM (LDMEM, Gibco), 10% fetal bovine serum (FBS; Hyclone, Logan, Utah), 100 U/ml penicillin (Hyclone) and 100 mg/ml streptomycin (Hyclone). The flushing medium was applied to nylon mesh and cells were harvested from filtered fluid by centrifugation for 5 min at 50 g. Cells were re-suspending in medium and cultured in humidified air containing 5% CO2, at 37 C. After 3 days incubation, non-adherent cells were washed out. Adherent cells were passaged and the fourth generation cells were used for the subsequent experiments. To induce SMCs differentiation into osteoblast, MSCs were cultured in differential medium that contained 50 mg/ml ascorbic acid, 10 mmol/L sodium b-glycerophosphate, and 10 nmol/L dexamethasone for 1 week. To evaluate the effect of OGP on osteoblastic differentiation, the medium was additionally added with 10 nM OGP with equal volume PBS as control. Synthetic linear OGP used in this experiment was obtained from GL Biochem (Shanghai) Ltd. (Shanghai, People's Republic of China) and diluted in phosphate buffered solution (PBS). Trichostatin A was obtained from Abcam (Cambridge, MA,USA) and diluted with Dimethyl sulfoxide (DMSO).
well were added with 10% CDC and incubated for 15 min at room temperature. The supernatant was collected for absorbance value detection at A562 nm. Alizarin red content was calculated using standard curve which made basing on gradient dilution of 2% alizarin red. Independent experiments performed in triplicate. 2.3. ALP activity assay Identical numbers of SMCs (104/ml) were seeded in 48 wellplates and incubated with differential medium for 7 days. After incubation, the plates were washed by PBS and were applied for analysis of ALP activity using an ALP assay kit (DALP; BioAssay Systems, CA, USA), following the manufacturer's instructions. In brief, total proteins of cell layers were extracted with Protein Extract Reagents (Pierce, USA) and protein concentration was determined using Bradford protein assay (Pierce Rockford, IL). Samples were prepared according to kit introduction. For reaction procedure, 0.02 ml volume of sample was mixed with 0.1 ml working solution. The final reaction volume was up to 0.2 ml through supplied with distilled water. Reaction was processed at 37 C for 30 min and stopped by adding 100 ml 0.2 mol/L NaOH. The absorbance value of the yellow product was measured using with a HTS 7000 Plus Bio Assay reader (Perkin Elmer Life Sciences, USA) at a 405 nm-wavelength. ALP activity was calculated from a standard curve after normalizing to the total protein content. The final ALP activity was expressed as nmol of p-nitrophenol formation/ng of total proteins. 2.4. Western blotting assay Cells which have been experienced experiments were harvested and lyzed in cold buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 10 mM Na4P2O7, 20 mM NaF, 1 mM Na3VO4, 10 mg/ml aprotinin) for analysis of protein expression using western blotting. Total protein were extracted by centrifugation of lysate at 10 000 g for 15 min. Equal 40 mg protein extracts were electrophoresed on 5%e10% SDS- polyacrylamide gel electrophoresis and transferred on polyvinylidene fluoride membrane. After blocked by 5% skim milk powder (dilute in PBST), membrane was incubated with primary antibodies as follows: goat anti-mouse CXCL13 (1:1000; R&D Systems Inc. Minneapolis, MN, USA), rabbit anti-mouse Runx2 (1:200; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), rabbit osteocalcin (1:1000; SigmaeAldrich, St. Louis, MO, USA), goat anti-mouse osteopontin (1:1000; SigmaeAldrich) and b-actin antibody (acted as an internal control, 1:1000, Santa Cruz Biotech) at 4 C overnight. The next day, secondary peroxidaseconjugated antibodies were added (1:5000, Santa Cruz Biotech) at room temperature for 2 h. Immuno-reactive proteins were finally visualized by the ECL Western Blotting detection kit (Pierce, Rockford, IL, USA).
2.2. Alizarin red staining
2.5. Construction of pcDNA-CXCL13 and pcDNA-AK141205 plasmid
The formation of calcium salt nodules of osteogenic differentiation of SMCs was assessed using alizarin Red staining. A density of 104/ml were cultured under the condition of differentiation in 24 well-plate for 7 days and washed by PBS. Cells stuck at the bottom of the cell culture dish were fixed by paraformaldehyde for 30 min at 4 C. Fixing solution was removed from cells followed by addition of staining solution (0.1% alizarin red (SigmaeAldrich, USA) TriseHCl (pH 8.3)). Staining process was last for 30 min at 37 C. Staining solution was washed out with extensively distilled water and number of calcium salt nodules was recorded and pictured under bright field microscopy. The positive is indicated as dark red. Each
Eukaryotic expression vector pcDNA3.1 as well as the CXCL13 and AK141205 gene fragment was digested with XhoI and HindIII. The target genes and pcDNA3.1 (10:1) were incubated at 4 C overnight for linkage reaction. The next day, the construction of pcDNA-CXCL13 or pcDNA-AK141205 recombinant plasmid were harvested and transformed into JM109 competent Escherichia coli under condition of 37 C for 12 h. After the incubation, colonies were randomly selected for cultivation in liquid LB medium that contains ampicillin. Recombinant plasmids were transfected into SMCs cells using Lipofectamine 2000 following manufacture's protocols. Cells were harvested at 48 h post transfection.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
3
2.6. RNA interference
2.7. miRNA isolation and analysis
Inhibition of CXCL13 and AK141205 expression in SMCs were achieved using specific complementary strand mediated mRNA degradation. Double stranded siRNAs (20 nM), which were obtained from Ambion (CA, Austin, TX, USA) with non-specific strand as negative control, were constructed with pBLOCK-iT™ 6-DEST Vector (V487; Invitrogen, USA) to form si-CXCL13, si-AK141205 or NC. The constructs of were transfected together with or without pcDNA-CXCL13 or AK141205 into SMCs with Lipofectamine 2000 for 48 h. Total cell lysates obtained were analyzed by Western blotting or by quantitative real-time PCR.
AK141205 expression was determined using quantitative realtime PCR (qRT-PCR). Total RNA from treated cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's introduction. After purification and quantification, RNA (1 mg) was applied to reverse transcribed using the QuantiMir RT Kit (System Biosciences) according to the manufacturer's instructions. The product cDNA was quantified using real time PCR using TaqMan Universal PCR master mix with the addition of SYBR Green Master Mix (Applied Biosciences, USA) and specific primers for AK141205 as well as for internal reference (GAPDH).
Fig. 1. AK141205 regulates OGP-induced SMCs differentiation MSCs were incubated in differential medium in the presence or absence of 10 nM OGD with equal volume of PBS as control. On day 0, 4, 8, 12 and 16 post treatment, (A) AK141205 and (B) CXCL13 mRNA were determined using quantitative RT-PCR, respectively. SMCs were pre-transfected with siAK141205 with non-specific strand as si-control for 48 h and were then exposed to 10 nM OGD for 12 h (C) AK141205 expression. (D) Alizarin red cell calcium nodule staining was performed to analyze calcium salt nodules. (E) ALP activity was determined. (F) Protein levels of Runx2, osteocalcin (OCN) and osteopontin (OPN) were determined by western blotting. Data were presented as mean ± SD. *p < 0.05 compared with no OGD treatment. #p < 0.05 compared with si-AK141205.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
4
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
The transcript content was normalized to GAPDH level. The primer sets for real-time qPCR is following: AK141205, forward primer, TGAGAAAAGACATTTGTCCTGGAAGAC; reverse primer, CTCCCAATAATAAGTAGCCAGTGACAT; GAPDH, forward primer, ATGGGTGGAATCATATTGGAA-3’; reverse primer, 50 -GAAGGTCGGAGTCAACGGATT-30 . 2.8. Chromatin immunoprecipitation (ChIP) assay SMCs were transfected with pcDNA-AK141205 or blank vector for 48 h and were applied to analysis of acetylation of CXCL13 promoter using Chromatin immunoprecipitation (ChIP) assay with EZ ChIP Chromatin Immunoprecipitation Kit (Upstate Biotechnology, NY, USA). In brief, after fixed with 1% formaldehyde solution, cells were lysed with SDS lysis kit. The cross-linked chromatin DNA in lysate was sonicated into fragments and incubated with rabbit anti-acetylated-histone H3 or H4 antibody (Millipore, Bedford, MA, USA) for detecting the acetylation of CXCL13 promoter. After retro-crosslinking, DNA was purified using phenol/chloroform extracting methods and subsequently analyzed by PCR with specific primers. All real-time ChIP assays were performed from three or more independent experiments. 2.9. Statistical analysis Statistical analysis was performed using GraphPad Prism 5.01 software. Statistical comparisons were made between two groups with the t-test and between multiple groups with one-way ANOVA. The quantitative data were presented as the mean ± standard deviations (SD). A value of p < 0.05 was considered significant unless otherwise described.
3. Results 3.1. AK141205 regulates OGP-induced SMCs differentiation SMCs were incubated in differential medium to trigger in vitro osteoblast directed-differentiation and 10 nM osteogenic growth peptide (OGP) was added with an equal volume of PBS as control. Quantitative RT-PCR was performed to determine AK141205 and CXCL13 mRNA expression on day 0, 4, 8, 12 and 16 post OGP treatments. The results showed that AK141205 level was timedependently upregulated and was significantly elevated eight days after incubation (Fig. 1A). In addition, expression level of CXCL13 was also increased along with days during OGP triggered SMCs (Fig. 1B). Next, we analyzed the effect of OGP on SMCs differentiation by evaluating formation of calcium salt nodules, ALP activity and osteogenesis differentiation-related protein expression and also investigated the involving AK141205 in this progress by silencing cellular AK141205 (Fig. 1C). Alizarin red cell calcium nodule staining was performed to detect the number of calcium salt nodules as indicated in Fig. 1D, in which showed OGP significantly increased formation of calcium salt nodules in comparison with no OGP treatment and this promotion effect was abrogated by AK141205 silencing. ALP activity of SMCs was enhanced by 10 nM OGP and was partly suppressed by knock down of AK141205 (Fig. 1E). Western blotting showed that OGP treatment caused higher expression of Runx2, osteocalcin (OCN) and osteopontin (OPN) protein, which was reversed by si-AK141205 (Fig. 1F). All these data suggested that OGP can enhance osteogenic differentiation of SMCs mediated by AK141205.
Fig. 2. Overexpression of AK141205 enhances CXCL13 expression. AK141205 was overexpressed by SMCs transfected with pcDNA-AK141205 plasmid for 48 h with a blank plasmid (pcDNA) as control. (A) Acetylation level of H3 histone and H4 histone were determined using ChIP assay. (B) Expression levels of CXCL13 mRNA and CXCL13 protein were determined. (C) Expression levels of CXCL13 were determined in TSA (trichostatin A; 50 nM), a histone deacetylase inhibitor, treated MSCs, and equal volume of DMSO was as control. (D) Western blot analysis was performed to detect HDAC1 expression in pcDNA-AK141205-treated SMCs. Data were presented as mean ± SD. **p < 0.05 compared with pcDNA or DMSO.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
3.2. AK141205 promotes CXCL13 expression through increasing promoter histone acetylation Previous study revealed that CXCL13, a constitutively expressed chemokine, is correlated with bone formation loss-related diseases [14], as well as possesses a potential function of promoting osteogenesis differentiation [15]. We next controlled cellular AK141205 level by MSCs transfected with pcDNA-AK141205 and investigated the effect of AK141205 on CXCL13 expression. By analysis of histone acetylation, we observed that AK141205 overexpression substantially increased H4 histone acetylation, but had no effect on the H3 acetylation compared with blank plasmid (Fig. 2A). Additionally, MSCs exposed to pcDNA-AK141205 expressed higher mRNA and
5
protein levels of CXCL13 (Fig. 2B). Moreover, Trichostatin A, a histone deacetylase inhibitor, significantly enhanced CXCL13 expression in levels of mRNA and protein (Fig. 2C). Also AK141205 overexpression suppressed HDAC1 (histone deacetylase 1) expression (Fig. 2D). 3.3. CXCL13 mediates AK141205 regulating Runx2, OCN and OPN expression Above data suggested that AK141205/CXCL13 axis was involved in process of SMCs osteogenic differentiation. We next investigated the possible effect of it on osteogenic differentiation-related parameters through simultaneously managing cellular AK141205 and
Fig. 3. AK141205/CXCL13 regulates SMCs differentiation. MSCs were co-transfected with (A) pcDNA-AK141205 and si-CXCL13 or (B) si-AK141205 and pcDNA-CXCL13 for 48 h before expression levels of CXCL13, Runx2, OCN and OPN were determined. (C) Calcium salt nodules and (D) ALP activity were evaluated in combination of pcDNA-AK141205 and si-CXCL13 treated SMCs. (E) Calcium salt nodules and (F) ALP activity were evaluated in cells transfected with pcDNA-AK141205 or pcDNA-CXCL13. Data were presented as mean ± SD. * p < 0.05 compared with pcDNA. #p < 0.05 compared with pcDNA-AK141205.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
6
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
CXCL13 expression. Western blotting showed that expression levels of CXCL13, Runx2, OCN and OPN were enhanced by AK141205 overexpression, however, pro-expression action of AK141205 was abrogated by silencing CXCL13 (Fig. 3A). On the contrary, decreased CXCL13, Runx2, OCN and OPN expressions induced by knock down of AK141205 were elevated by CXCL13 overexpression (Fig. 3B). These data suggested a signal transmission function of AK141205/ CXCL13 on osteogenic differentiation, which was further demonstrated by analysis of calcium salt nodules (Fig. 3C) and ALP activity (Fig. 3D). In addition, only AK141205 overexpression or CXCL13 overexpression also promoted SMCs osteogenic differentiation being showed by increased calcium salt nodules formation (Fig. 3E) and ALP activity (Fig. 3F). The data showed that overexpressed AK141205 induced increased numbers of calcium salt nodules and activity of ALP were partly suppressed by CXCL13 silencing. 3.4. AK141205/CXCL13 mediates OGC-induced SMCs differentiation To explore whether AK141205/CXCL13 axis is involved in OGCinduced SMCs differentiation, SMCs were treated with pcDNA-
AK141205 and si-CXCL13 before exposed to 10 nM OGP and osteogenic differentiation-related parameters was analysis. Results showed that combination of AK141205 overexpression and CXCL13 silencing effectively reversed decreased number of calcium salt nodules (Fig. 4A), activity of ALP (Fig. 4B) and expression of Runx2, OCN and OPN (Fig. 4C) induced by OGP. 4. Discussion Recently, Hindorff and his colleague performed a study of genome-wide association loci for human diseases and traits, and point out that only 7% of disease-associated single nucleotide polymorphisms (SNPs) are located in protein-coding regions, whereas the other 93% are in noncoding regions [16]. This evidence makes both non-coding miRNA and lncRNA ideal therapeutic target. More recently, lncRNA have been suggested to have abundant roles in developmental and adult tissue regulation. In our present study, the upregulation of AK141205 was proved to be involved in osteogenic growth peptide (OGP)-triggered osteogenic differentiation of mesenchymal stem cells (MSCs). Furthermore, by
Fig. 4. AK141205/CXCL13 mediates OGC-induced SMCs differentiation. After SMCs co-treated with pcDNA-AK141205 and si-CXCL13, cells were exposed to 10 nM OGC. (A) Calcium salt nodules, (B) ALP activity and (C) CXCL13, Runx2, OCN and OPN expression were determined. Data were presented as mean ± SD. *p < 0.05 compared with no OGD treatment. # p < 0.05 compared with 10 nM þ pcDNA. $p < 0.05 compared with 0 nM þ pcDNA-AK141205þsi-control.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
managing cellular AK141205 of SMCs, we identified the regulatory role of lncRNA AK141205 in osteogenic differentiation of MSCs, which mediated by enhancement of CXCL13 expression. Osteoblast-directed differentiation of MSCs is a controlled physiological process, in particular promoted by bioactive molecule. Previous evidence pointed out a promotion effect of OGP on osteogenic differentiation, nevertheless, no clear evidence for a molecular mechanism supporting this process. We focus the 10 nM OGP, an applicable concentration osteoblasts [17], and explored the possible mechanism underlying. By assessment of bone formationrelated parameters in OGP-trigged SMCs, we confirmed the proosteogenesis differentiation characteristic of OGP using the judgment criteria of increased ALP activity [6], formation of calcium salt nodules [7] and expression of osteogenesis-related protein [7]. Also, we observed that OGP induced upregulation of AK141205 as well as enhanced CXCL13 expression. This led us to examine the function correlation of AK141205 and CXCL13 in OGP-triggered osteogenic differentiation of SMCs. CXCL13 is a member of the CXC homeostatic functional group of chemokines which was found to be essential for functional maintenance of osteoblast [18,19] as well as was suggested to promote SMCs migration and differentiation [20]. Exogenous administration of CXCL13 recombination protein significantly enhanced SMCs to differentiate into osteoblast [15]. Our finding of CXCL13 over-expression enhanced SMCs to differentiate into osteoblast also supported the potential role of CXCL13 in osteogenic differentiation (data not shown). Upon to observation of the abnormal expression CXCL13 in OGP-triggered SMCs, we speculated expression regulation of CXCL13 might be essential for OGP-induced osteogenic differentiation. The biological process of protein expression is a multilevel regulation mechanism, particularly in aspects of modifications of chromosome [21]. LncRNAs are such the controllers that were revealed to participate in expression of functional genes by DNA methylation, histone modification, and post-transcription regulation [22]. Therefor we treated MSCs with 50 -Aza-dC, a demethylating reagent (data not shown), and trichostatin A, a histone deacetylase inhibitor, and investigated their roles in expression of CXCL13. The result of this experiment shows that only trichostatin A enhances expression of CXCL13 suggesting important role of histone acetylation in CXCL13 expression regulation. Our present data in Fig. 2 confirms this phenomenon, which revealed that AK141205 regulated CXCL13 expression by acetylation modification H4 histone. Given to this, we will focus on the mechanism by which AK141205 regulates histone acetylation in the next study. The confirmation of regulatory relationships between AK141205 and CXCL13 caused us to investigate their involvement in osteogenic differentiation of SMCs. Cells were incubated with plasmid integrated with AK141205 or CXCL13 gene together with AK141205 or CXCL13 interference sequence before exposed to differential medium. By result of osteogenesis-related parameters analysis, we come to the conclusion that AK141205 promoted osteogenic differentiation of SMCs (Fig. 3) mediated by increased expression CXCL13. Our data also indicates the key role of endogenous CXCL13 in progress of SMCs differentiating into osteoblast, which is in accordance with previous study [15]. In addition, AK141205/ CXCL13 signal axis was observed in OGP-induced osteogenic differentiation of SMCs shown in Fig. 4. In summary, the current study suggests that, in differential medium-incubated MSCs, AK141205 induced by OGP may enhance expression of CXCL13 and osteogenic differentiation-related event occurrence including formation of calcium salt nodules, increased ALP activity and osteogenesis related gene expression. The mechanism involved may serve to explain the fact that the bioactive molecule-OGP effect on MSCs under the condition of osteogenic differentiation.
7
Declaration of interest The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported. Transparency document Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2015.08.112. References [1] F.O. Kurt, H.S. Vatansever, Potential clinical use of differentiated cells from embryonic or mesenchymal stem cells in orthopeadic problems, Curr. Stem Cell Res. Ther. (2015). [2] S. Huang, L. Xu, Y. Zhang, Y. Sun, G. Li, Systemic and local administration of allogeneic bone marrow derived mesenchymal stem cells promotes fracture healing in rats, Cell Transplant. (2015). [3] C.M. Kaneto, P.S. Lima, D.L. Zanette, K.L. Prata, J.M. Pina Neto, F.J. de Paula, W.A. Silva Jr., Col1a1 and mir-29b show lower expression levels during osteoblast differentiation of bone marrow stromal cells from osteogenesis imperfecta patients, BMC Med. Genet. 15 (2014) 45. [4] Y.K. Wang, C.S. Chen, Cell adhesion and mechanical stimulation in the regulation of mesenchymal stem cell differentiation, J. Cell. Mol. Med. 17 (2013) 823e832. [5] L. Polo-Corrales, M. Latorre-Esteves, J.E. Ramirez-Vick, Scaffold design for bone regeneration, J. Nanosci. Nanotechnol. 14 (2014) 15e56. [6] G. An, Z. Xue, B. Zhang, Q.K. Deng, Y.S. Wang, S.C. Lv, Expressing osteogenic growth peptide in the rabbit bone mesenchymal stem cells increased alkaline phosphatase activity and enhanced the collagen accumulation, Eur. Rev. Med. Pharmacol. Sci. 18 (2014) 1618e1624. [7] C. Chen, H. Li, X. Kong, S.M. Zhang, I.S. Lee, Immobilizing osteogenic growth peptide with and without fibronectin on a titanium surface: effects of loading methods on mesenchymal stem cell differentiation, Int. J. Nanomedicine 10 (2015) 283e295. [8] H.B. Zhu, Osteogenic actions of the osteogenic growth peptide on bovine marrow mesenchymal stromal cells in culture, Veterinarni Med. 53 (2008) 501e509. [9] C.E. Tye, J.A. Gordon, L.A. Martin-Buley, J.L. Stein, J.B. Lian, G.S. Stein, Could lncrnas be the missing links in control of mesenchymal stem cell differentiation? J. Cell. Physiol. 230 (2015) 526e534. [10] W. Yu, Y. Qiao, X. Tang, L. Ma, Y. Wang, X. Zhang, W. Weng, Q. Pan, Y. Yu, F. Sun, J. Wang, Tumor suppressor long non-coding rna, mt1dp is negatively regulated by yap and runx2 to inhibit foxa1 in liver cancer cells, Cell. Signal. 26 (2014) 2961e2968. [11] L. Zhu, P.C. Xu, Downregulated lncrna-ancr promotes osteoblast differentiation by targeting ezh2 and regulating runx2 expression, Biochem. Biophys. Res. Commun. 432 (2013) 612e617. [12] P. Han, C.P. Chang, Long non-coding rna and chromatin remodeling, RNA Biol. (2015), 0. [13] J. Sheik Mohamed, P.M. Gaughwin, B. Lim, P. Robson, L. Lipovich, Conserved long noncoding rnas transcriptionally regulated by oct4 and nanog modulate pluripotency in mouse embryonic stem cells, Rna 16 (2010) 324e337. [14] G. Lisignoli, S. Cristino, S. Toneguzzi, F. Grassi, A. Piacentini, C. Cavallo, A. Facchini, E. Mariani, Il1beta and tnfalpha differently modulate cxcl13 chemokine in stromal cells and osteoblasts isolated from osteoarthritis patients: evidence of changes associated to cell maturation, Exp. Gerontol. 39 (2004) 659e665. [15] F. Tian, X.L. Ji, W.A. Xiao, B. Wang, F. Wang, Cxcl13 promotes osteogenic differentiation of mesenchymal stem cells by inhibiting mir-23a expression, Stem Cells Int. 2015 (2015) 632305. [16] L.A. Hindorff, P. Sethupathy, H.A. Junkins, E.M. Ramos, J.P. Mehta, F.S. Collins, T.A. Manolio, Potential etiologic and functional implications of genome-wide association loci for human diseases and traits, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 9362e9367. [17] S.M. Miguel, M. Namdar-Attar, T. Noh, B. Frenkel, I. Bab, Erk1/2-activated de novo mapkapk2 synthesis is essential for osteogenic growth peptide mitogenic signaling in osteoblastic cells, J. Biol. Chem. 280 (2005) 37495e37502. [18] G. Lisignoli, A. Piacentini, S. Toneguzzi, F. Grassi, M. Tschon, S. Cristino, A. Facchini, E. Mariani, Age-associated changes in functional response to cxcr3 and cxcr5 chemokine receptors in human osteoblasts, Biogerontology 4 (2003) 309e317. [19] B. Tonnarelli, C. Manferdini, A. Piacentini, K. Codeluppi, N. Zini, S. Ghisu, A. Facchini, G. Lisignoli, Surface-dependent modulation of proliferation, bone matrix molecules, and inflammatory factors in human osteoblasts, J. Biomed. Mater. Res. Part A 89 (2009) 687e696. [20] Y. Zhang, C. Ma, Y. Yu, M. Liu, C. Yi, Are cxcl13/cxcr5/fak critical regulators of mscs migration and differentiation? Med. Hypotheses 84 (2015) 213e215. [21] X. Li, A. Ghezzi, H.R. Krishnan, J.B. Pohl, A.Y. Bohm, N.S. Atkinson, A histone modification identifies a DNA element controlling slo bk channel gene expression in muscle, J. Neurogenet. (2015) 1e11. [22] C. Kanduri, Long noncoding rnas: lessons from genomic imprinting, Biochimica Biophysica Acta (2015).
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13 Haiqing Li a, 1, Zhonghe Zhang c, 1, Zhiqiang Chen a, *, Dongdong Zhang b, ** a b c
Department of Orthopedic Surgery, Liaocheng People's Hospital, 67 Dongchang West Road, Liaocheng 252000, China Department of Ultrasound, Liaocheng People's Hospital, 67 Dongchang West Road, Liaocheng 252000, China Department of Orthopedic Surgery, Liaocheng Hospital of Traditional Chinese Medicine, Liaocheng 252000, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 21 August 2015 Accepted 25 August 2015 Available online xxx
The aim of present study was to characterize long non-coding RNA (lncRNA) AK141205 as a cellular regulator of osteogenic differentiation of mice mesenchymal stem cells (MSCs) towards osteogenic growth peptide (OGP) stimulation. Mice MSCs cells were isolated, transfected with si-AK141205, pcDNAAK141205 or control, and stimulated with OGP. The AK141205, CXC chemokine ligand-13 (CXCL13), and osteogenic differentiation-associated parameters were determined by western blotting or quantitative RT-PCR. To determine the role of AK141205/CXCL13 in SMCs osteogenic differentiation, SMCs subjected to co-transfection of pcDNA-AK141205 and si-CXCL13 or si-AK141205 and pcDNA-CXCL13, and were submitted for osteogenic differentiation-associated parameters analyses. The results showed that stimulation of SMCs with OGP induced upregulation of both AK141205 and CXCL13, and osteogenic differentiation of MSCs. Transfection of si-AK141205 partly suppressed OGP-induced formation of calcium salt nodules, alkaline phosphatase (ALP) activity and osteogenic differentiation-associated gene expression, suggesting key regulatory role of AK141205. Analysis of CXCL13 expression in SMCspcDNAAK141205 revealed that AK141205 positively promoted CXCL13 expression via acetylation of H4 histone in the promoter region. This signal transduction was demonstrated to be essential for OGP-induced osteogenic differentiation of MSCs through osteogenic differentiation analysis in simultaneously AK141205/CXCL13 controlled SMCs. In summary, we report a completely novel role of AK141205/CXCL13 as a regulator of OGP-induced osteogenic differentiation of SMCs. Our finding provides a potential therapeutic targeting of AK141205 for enhancing disease-treatment effect of SMCs. © 2015 Published by Elsevier Inc.
Keywords: Alkaline phosphatase (ALP) activity AK141205 Mesenchymal stem cells Osteogenic growth peptide Runx2
1. Introduction Adult bone mesenchymal stem cells (MSCs) are one of members of stem/progenitor cell family and were distributed in the bone marrow stroma. Evidences point out that the MSCs were progenitors of different cell lineages and are capable of multiple differentiation potential, including lineages including fibroblasts, osteoblasts, adipocytes, or chondrocytes [1]. The multipotent SMCs have been applied MSCs into clinical therapy on account of tissue
* Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (Z. Chen), [email protected] (D. Zhang). 1 These authors contributed equally.
regeneration and homeostasis, due to their characteristic of easy isolation and osteogenesis-directed differentiation potential [2]. However, the underlying mechanism of MSCs to differentiate into osteoblasts in response to signals from its microenvironment remains to be elaborated [3]. Over the last decades, bioactive molecule-assisted SMCs strategies have been aroused a lot of attention. Laminin, fibroblast growth factor, and bone morphogenic protein-2 which are coloaded with SMCs on the surfaces of graft substantially enhance MSCs differentiation [4], and improve osteogenesis [5]. Notably, the osteogenic growth peptide (OGP), a short, linear tetradecapeptide and initially was found in the serum of human, was regarded as a inducer for osteogenic differentiation of MSCs [6,7]. When coincubated with MSCs, OGP promotes osteogenic differentiation because of its regulatory role in alkaline phosphatase (ALP) activity
http://dx.doi.org/10.1016/j.bbrc.2015.08.112 0006-291X/© 2015 Published by Elsevier Inc.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
2
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
and mineralized nodule formation, and stimulated osteoblastspecific mRNA expression of Osteocalcin (BGP) [8]. Although evidences pointed out OGP effectively enhanced MSCs differentiation into osteoblasts, the potential mechanism of the process has not been elucidated completely. The genetic networks controlling stem cell differentiation are the focus of intense interest, due to their obvious therapeutic potential. Recently, a noteworthy class of potential regulatory RNAs, long non-coding RNAs (lncRNA) in lineage commitment of MSCs, arouses researchers' attention [9]. Since it was initially founded, lncRNA was reflected in diverse biological roles including those in modulation of phenotypic transcriptional factors of SMCs, such as Runx2, a key element for osteoblasts [10,11]. A notable property of some mammalian lncRNAs is their ability to control expression of key transcriptional factors in develop and disease, for example through promoter modification [12]. Presently, aberrant AK141205, a novel and potentially differentiation-related lncRNA [13] were observed in process of multidirectional differentiation of stem cells through promoting or inhibiting differentiation activity. Here, we report lncRNA AK141205 and determine whether AK141205 in involved in SMCs osteogenic differentiation induced by OGP. 2. Material and methods 2.1. Cell isolation, differentiation MSCs were isolated and harvested from male SpragueeDawley rats (aged 6 weeks; 200e250 g). Briefly, femurs were isolated form the anesthetized rats (Xylasin 2% in 1 mg/kg as premedication and Ketamin HCl 10% in 60 mg/kg) and were subjected to wash by a complete culture medium that consist of low glucose DMEM (LDMEM, Gibco), 10% fetal bovine serum (FBS; Hyclone, Logan, Utah), 100 U/ml penicillin (Hyclone) and 100 mg/ml streptomycin (Hyclone). The flushing medium was applied to nylon mesh and cells were harvested from filtered fluid by centrifugation for 5 min at 50 g. Cells were re-suspending in medium and cultured in humidified air containing 5% CO2, at 37 C. After 3 days incubation, non-adherent cells were washed out. Adherent cells were passaged and the fourth generation cells were used for the subsequent experiments. To induce SMCs differentiation into osteoblast, MSCs were cultured in differential medium that contained 50 mg/ml ascorbic acid, 10 mmol/L sodium b-glycerophosphate, and 10 nmol/L dexamethasone for 1 week. To evaluate the effect of OGP on osteoblastic differentiation, the medium was additionally added with 10 nM OGP with equal volume PBS as control. Synthetic linear OGP used in this experiment was obtained from GL Biochem (Shanghai) Ltd. (Shanghai, People's Republic of China) and diluted in phosphate buffered solution (PBS). Trichostatin A was obtained from Abcam (Cambridge, MA,USA) and diluted with Dimethyl sulfoxide (DMSO).
well were added with 10% CDC and incubated for 15 min at room temperature. The supernatant was collected for absorbance value detection at A562 nm. Alizarin red content was calculated using standard curve which made basing on gradient dilution of 2% alizarin red. Independent experiments performed in triplicate. 2.3. ALP activity assay Identical numbers of SMCs (104/ml) were seeded in 48 wellplates and incubated with differential medium for 7 days. After incubation, the plates were washed by PBS and were applied for analysis of ALP activity using an ALP assay kit (DALP; BioAssay Systems, CA, USA), following the manufacturer's instructions. In brief, total proteins of cell layers were extracted with Protein Extract Reagents (Pierce, USA) and protein concentration was determined using Bradford protein assay (Pierce Rockford, IL). Samples were prepared according to kit introduction. For reaction procedure, 0.02 ml volume of sample was mixed with 0.1 ml working solution. The final reaction volume was up to 0.2 ml through supplied with distilled water. Reaction was processed at 37 C for 30 min and stopped by adding 100 ml 0.2 mol/L NaOH. The absorbance value of the yellow product was measured using with a HTS 7000 Plus Bio Assay reader (Perkin Elmer Life Sciences, USA) at a 405 nm-wavelength. ALP activity was calculated from a standard curve after normalizing to the total protein content. The final ALP activity was expressed as nmol of p-nitrophenol formation/ng of total proteins. 2.4. Western blotting assay Cells which have been experienced experiments were harvested and lyzed in cold buffer (50 mM Tris (pH 7.4), 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 10 mM Na4P2O7, 20 mM NaF, 1 mM Na3VO4, 10 mg/ml aprotinin) for analysis of protein expression using western blotting. Total protein were extracted by centrifugation of lysate at 10 000 g for 15 min. Equal 40 mg protein extracts were electrophoresed on 5%e10% SDS- polyacrylamide gel electrophoresis and transferred on polyvinylidene fluoride membrane. After blocked by 5% skim milk powder (dilute in PBST), membrane was incubated with primary antibodies as follows: goat anti-mouse CXCL13 (1:1000; R&D Systems Inc. Minneapolis, MN, USA), rabbit anti-mouse Runx2 (1:200; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), rabbit osteocalcin (1:1000; SigmaeAldrich, St. Louis, MO, USA), goat anti-mouse osteopontin (1:1000; SigmaeAldrich) and b-actin antibody (acted as an internal control, 1:1000, Santa Cruz Biotech) at 4 C overnight. The next day, secondary peroxidaseconjugated antibodies were added (1:5000, Santa Cruz Biotech) at room temperature for 2 h. Immuno-reactive proteins were finally visualized by the ECL Western Blotting detection kit (Pierce, Rockford, IL, USA).
2.2. Alizarin red staining
2.5. Construction of pcDNA-CXCL13 and pcDNA-AK141205 plasmid
The formation of calcium salt nodules of osteogenic differentiation of SMCs was assessed using alizarin Red staining. A density of 104/ml were cultured under the condition of differentiation in 24 well-plate for 7 days and washed by PBS. Cells stuck at the bottom of the cell culture dish were fixed by paraformaldehyde for 30 min at 4 C. Fixing solution was removed from cells followed by addition of staining solution (0.1% alizarin red (SigmaeAldrich, USA) TriseHCl (pH 8.3)). Staining process was last for 30 min at 37 C. Staining solution was washed out with extensively distilled water and number of calcium salt nodules was recorded and pictured under bright field microscopy. The positive is indicated as dark red. Each
Eukaryotic expression vector pcDNA3.1 as well as the CXCL13 and AK141205 gene fragment was digested with XhoI and HindIII. The target genes and pcDNA3.1 (10:1) were incubated at 4 C overnight for linkage reaction. The next day, the construction of pcDNA-CXCL13 or pcDNA-AK141205 recombinant plasmid were harvested and transformed into JM109 competent Escherichia coli under condition of 37 C for 12 h. After the incubation, colonies were randomly selected for cultivation in liquid LB medium that contains ampicillin. Recombinant plasmids were transfected into SMCs cells using Lipofectamine 2000 following manufacture's protocols. Cells were harvested at 48 h post transfection.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
3
2.6. RNA interference
2.7. miRNA isolation and analysis
Inhibition of CXCL13 and AK141205 expression in SMCs were achieved using specific complementary strand mediated mRNA degradation. Double stranded siRNAs (20 nM), which were obtained from Ambion (CA, Austin, TX, USA) with non-specific strand as negative control, were constructed with pBLOCK-iT™ 6-DEST Vector (V487; Invitrogen, USA) to form si-CXCL13, si-AK141205 or NC. The constructs of were transfected together with or without pcDNA-CXCL13 or AK141205 into SMCs with Lipofectamine 2000 for 48 h. Total cell lysates obtained were analyzed by Western blotting or by quantitative real-time PCR.
AK141205 expression was determined using quantitative realtime PCR (qRT-PCR). Total RNA from treated cells was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's introduction. After purification and quantification, RNA (1 mg) was applied to reverse transcribed using the QuantiMir RT Kit (System Biosciences) according to the manufacturer's instructions. The product cDNA was quantified using real time PCR using TaqMan Universal PCR master mix with the addition of SYBR Green Master Mix (Applied Biosciences, USA) and specific primers for AK141205 as well as for internal reference (GAPDH).
Fig. 1. AK141205 regulates OGP-induced SMCs differentiation MSCs were incubated in differential medium in the presence or absence of 10 nM OGD with equal volume of PBS as control. On day 0, 4, 8, 12 and 16 post treatment, (A) AK141205 and (B) CXCL13 mRNA were determined using quantitative RT-PCR, respectively. SMCs were pre-transfected with siAK141205 with non-specific strand as si-control for 48 h and were then exposed to 10 nM OGD for 12 h (C) AK141205 expression. (D) Alizarin red cell calcium nodule staining was performed to analyze calcium salt nodules. (E) ALP activity was determined. (F) Protein levels of Runx2, osteocalcin (OCN) and osteopontin (OPN) were determined by western blotting. Data were presented as mean ± SD. *p < 0.05 compared with no OGD treatment. #p < 0.05 compared with si-AK141205.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
4
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
The transcript content was normalized to GAPDH level. The primer sets for real-time qPCR is following: AK141205, forward primer, TGAGAAAAGACATTTGTCCTGGAAGAC; reverse primer, CTCCCAATAATAAGTAGCCAGTGACAT; GAPDH, forward primer, ATGGGTGGAATCATATTGGAA-3’; reverse primer, 50 -GAAGGTCGGAGTCAACGGATT-30 . 2.8. Chromatin immunoprecipitation (ChIP) assay SMCs were transfected with pcDNA-AK141205 or blank vector for 48 h and were applied to analysis of acetylation of CXCL13 promoter using Chromatin immunoprecipitation (ChIP) assay with EZ ChIP Chromatin Immunoprecipitation Kit (Upstate Biotechnology, NY, USA). In brief, after fixed with 1% formaldehyde solution, cells were lysed with SDS lysis kit. The cross-linked chromatin DNA in lysate was sonicated into fragments and incubated with rabbit anti-acetylated-histone H3 or H4 antibody (Millipore, Bedford, MA, USA) for detecting the acetylation of CXCL13 promoter. After retro-crosslinking, DNA was purified using phenol/chloroform extracting methods and subsequently analyzed by PCR with specific primers. All real-time ChIP assays were performed from three or more independent experiments. 2.9. Statistical analysis Statistical analysis was performed using GraphPad Prism 5.01 software. Statistical comparisons were made between two groups with the t-test and between multiple groups with one-way ANOVA. The quantitative data were presented as the mean ± standard deviations (SD). A value of p < 0.05 was considered significant unless otherwise described.
3. Results 3.1. AK141205 regulates OGP-induced SMCs differentiation SMCs were incubated in differential medium to trigger in vitro osteoblast directed-differentiation and 10 nM osteogenic growth peptide (OGP) was added with an equal volume of PBS as control. Quantitative RT-PCR was performed to determine AK141205 and CXCL13 mRNA expression on day 0, 4, 8, 12 and 16 post OGP treatments. The results showed that AK141205 level was timedependently upregulated and was significantly elevated eight days after incubation (Fig. 1A). In addition, expression level of CXCL13 was also increased along with days during OGP triggered SMCs (Fig. 1B). Next, we analyzed the effect of OGP on SMCs differentiation by evaluating formation of calcium salt nodules, ALP activity and osteogenesis differentiation-related protein expression and also investigated the involving AK141205 in this progress by silencing cellular AK141205 (Fig. 1C). Alizarin red cell calcium nodule staining was performed to detect the number of calcium salt nodules as indicated in Fig. 1D, in which showed OGP significantly increased formation of calcium salt nodules in comparison with no OGP treatment and this promotion effect was abrogated by AK141205 silencing. ALP activity of SMCs was enhanced by 10 nM OGP and was partly suppressed by knock down of AK141205 (Fig. 1E). Western blotting showed that OGP treatment caused higher expression of Runx2, osteocalcin (OCN) and osteopontin (OPN) protein, which was reversed by si-AK141205 (Fig. 1F). All these data suggested that OGP can enhance osteogenic differentiation of SMCs mediated by AK141205.
Fig. 2. Overexpression of AK141205 enhances CXCL13 expression. AK141205 was overexpressed by SMCs transfected with pcDNA-AK141205 plasmid for 48 h with a blank plasmid (pcDNA) as control. (A) Acetylation level of H3 histone and H4 histone were determined using ChIP assay. (B) Expression levels of CXCL13 mRNA and CXCL13 protein were determined. (C) Expression levels of CXCL13 were determined in TSA (trichostatin A; 50 nM), a histone deacetylase inhibitor, treated MSCs, and equal volume of DMSO was as control. (D) Western blot analysis was performed to detect HDAC1 expression in pcDNA-AK141205-treated SMCs. Data were presented as mean ± SD. **p < 0.05 compared with pcDNA or DMSO.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
3.2. AK141205 promotes CXCL13 expression through increasing promoter histone acetylation Previous study revealed that CXCL13, a constitutively expressed chemokine, is correlated with bone formation loss-related diseases [14], as well as possesses a potential function of promoting osteogenesis differentiation [15]. We next controlled cellular AK141205 level by MSCs transfected with pcDNA-AK141205 and investigated the effect of AK141205 on CXCL13 expression. By analysis of histone acetylation, we observed that AK141205 overexpression substantially increased H4 histone acetylation, but had no effect on the H3 acetylation compared with blank plasmid (Fig. 2A). Additionally, MSCs exposed to pcDNA-AK141205 expressed higher mRNA and
5
protein levels of CXCL13 (Fig. 2B). Moreover, Trichostatin A, a histone deacetylase inhibitor, significantly enhanced CXCL13 expression in levels of mRNA and protein (Fig. 2C). Also AK141205 overexpression suppressed HDAC1 (histone deacetylase 1) expression (Fig. 2D). 3.3. CXCL13 mediates AK141205 regulating Runx2, OCN and OPN expression Above data suggested that AK141205/CXCL13 axis was involved in process of SMCs osteogenic differentiation. We next investigated the possible effect of it on osteogenic differentiation-related parameters through simultaneously managing cellular AK141205 and
Fig. 3. AK141205/CXCL13 regulates SMCs differentiation. MSCs were co-transfected with (A) pcDNA-AK141205 and si-CXCL13 or (B) si-AK141205 and pcDNA-CXCL13 for 48 h before expression levels of CXCL13, Runx2, OCN and OPN were determined. (C) Calcium salt nodules and (D) ALP activity were evaluated in combination of pcDNA-AK141205 and si-CXCL13 treated SMCs. (E) Calcium salt nodules and (F) ALP activity were evaluated in cells transfected with pcDNA-AK141205 or pcDNA-CXCL13. Data were presented as mean ± SD. * p < 0.05 compared with pcDNA. #p < 0.05 compared with pcDNA-AK141205.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
6
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
CXCL13 expression. Western blotting showed that expression levels of CXCL13, Runx2, OCN and OPN were enhanced by AK141205 overexpression, however, pro-expression action of AK141205 was abrogated by silencing CXCL13 (Fig. 3A). On the contrary, decreased CXCL13, Runx2, OCN and OPN expressions induced by knock down of AK141205 were elevated by CXCL13 overexpression (Fig. 3B). These data suggested a signal transmission function of AK141205/ CXCL13 on osteogenic differentiation, which was further demonstrated by analysis of calcium salt nodules (Fig. 3C) and ALP activity (Fig. 3D). In addition, only AK141205 overexpression or CXCL13 overexpression also promoted SMCs osteogenic differentiation being showed by increased calcium salt nodules formation (Fig. 3E) and ALP activity (Fig. 3F). The data showed that overexpressed AK141205 induced increased numbers of calcium salt nodules and activity of ALP were partly suppressed by CXCL13 silencing. 3.4. AK141205/CXCL13 mediates OGC-induced SMCs differentiation To explore whether AK141205/CXCL13 axis is involved in OGCinduced SMCs differentiation, SMCs were treated with pcDNA-
AK141205 and si-CXCL13 before exposed to 10 nM OGP and osteogenic differentiation-related parameters was analysis. Results showed that combination of AK141205 overexpression and CXCL13 silencing effectively reversed decreased number of calcium salt nodules (Fig. 4A), activity of ALP (Fig. 4B) and expression of Runx2, OCN and OPN (Fig. 4C) induced by OGP. 4. Discussion Recently, Hindorff and his colleague performed a study of genome-wide association loci for human diseases and traits, and point out that only 7% of disease-associated single nucleotide polymorphisms (SNPs) are located in protein-coding regions, whereas the other 93% are in noncoding regions [16]. This evidence makes both non-coding miRNA and lncRNA ideal therapeutic target. More recently, lncRNA have been suggested to have abundant roles in developmental and adult tissue regulation. In our present study, the upregulation of AK141205 was proved to be involved in osteogenic growth peptide (OGP)-triggered osteogenic differentiation of mesenchymal stem cells (MSCs). Furthermore, by
Fig. 4. AK141205/CXCL13 mediates OGC-induced SMCs differentiation. After SMCs co-treated with pcDNA-AK141205 and si-CXCL13, cells were exposed to 10 nM OGC. (A) Calcium salt nodules, (B) ALP activity and (C) CXCL13, Runx2, OCN and OPN expression were determined. Data were presented as mean ± SD. *p < 0.05 compared with no OGD treatment. # p < 0.05 compared with 10 nM þ pcDNA. $p < 0.05 compared with 0 nM þ pcDNA-AK141205þsi-control.
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112
H. Li et al. / Biochemical and Biophysical Research Communications xxx (2015) 1e7
managing cellular AK141205 of SMCs, we identified the regulatory role of lncRNA AK141205 in osteogenic differentiation of MSCs, which mediated by enhancement of CXCL13 expression. Osteoblast-directed differentiation of MSCs is a controlled physiological process, in particular promoted by bioactive molecule. Previous evidence pointed out a promotion effect of OGP on osteogenic differentiation, nevertheless, no clear evidence for a molecular mechanism supporting this process. We focus the 10 nM OGP, an applicable concentration osteoblasts [17], and explored the possible mechanism underlying. By assessment of bone formationrelated parameters in OGP-trigged SMCs, we confirmed the proosteogenesis differentiation characteristic of OGP using the judgment criteria of increased ALP activity [6], formation of calcium salt nodules [7] and expression of osteogenesis-related protein [7]. Also, we observed that OGP induced upregulation of AK141205 as well as enhanced CXCL13 expression. This led us to examine the function correlation of AK141205 and CXCL13 in OGP-triggered osteogenic differentiation of SMCs. CXCL13 is a member of the CXC homeostatic functional group of chemokines which was found to be essential for functional maintenance of osteoblast [18,19] as well as was suggested to promote SMCs migration and differentiation [20]. Exogenous administration of CXCL13 recombination protein significantly enhanced SMCs to differentiate into osteoblast [15]. Our finding of CXCL13 over-expression enhanced SMCs to differentiate into osteoblast also supported the potential role of CXCL13 in osteogenic differentiation (data not shown). Upon to observation of the abnormal expression CXCL13 in OGP-triggered SMCs, we speculated expression regulation of CXCL13 might be essential for OGP-induced osteogenic differentiation. The biological process of protein expression is a multilevel regulation mechanism, particularly in aspects of modifications of chromosome [21]. LncRNAs are such the controllers that were revealed to participate in expression of functional genes by DNA methylation, histone modification, and post-transcription regulation [22]. Therefor we treated MSCs with 50 -Aza-dC, a demethylating reagent (data not shown), and trichostatin A, a histone deacetylase inhibitor, and investigated their roles in expression of CXCL13. The result of this experiment shows that only trichostatin A enhances expression of CXCL13 suggesting important role of histone acetylation in CXCL13 expression regulation. Our present data in Fig. 2 confirms this phenomenon, which revealed that AK141205 regulated CXCL13 expression by acetylation modification H4 histone. Given to this, we will focus on the mechanism by which AK141205 regulates histone acetylation in the next study. The confirmation of regulatory relationships between AK141205 and CXCL13 caused us to investigate their involvement in osteogenic differentiation of SMCs. Cells were incubated with plasmid integrated with AK141205 or CXCL13 gene together with AK141205 or CXCL13 interference sequence before exposed to differential medium. By result of osteogenesis-related parameters analysis, we come to the conclusion that AK141205 promoted osteogenic differentiation of SMCs (Fig. 3) mediated by increased expression CXCL13. Our data also indicates the key role of endogenous CXCL13 in progress of SMCs differentiating into osteoblast, which is in accordance with previous study [15]. In addition, AK141205/ CXCL13 signal axis was observed in OGP-induced osteogenic differentiation of SMCs shown in Fig. 4. In summary, the current study suggests that, in differential medium-incubated MSCs, AK141205 induced by OGP may enhance expression of CXCL13 and osteogenic differentiation-related event occurrence including formation of calcium salt nodules, increased ALP activity and osteogenesis related gene expression. The mechanism involved may serve to explain the fact that the bioactive molecule-OGP effect on MSCs under the condition of osteogenic differentiation.
7
Declaration of interest The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported. Transparency document Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.bbrc.2015.08.112. References [1] F.O. Kurt, H.S. Vatansever, Potential clinical use of differentiated cells from embryonic or mesenchymal stem cells in orthopeadic problems, Curr. Stem Cell Res. Ther. (2015). [2] S. Huang, L. Xu, Y. Zhang, Y. Sun, G. Li, Systemic and local administration of allogeneic bone marrow derived mesenchymal stem cells promotes fracture healing in rats, Cell Transplant. (2015). [3] C.M. Kaneto, P.S. Lima, D.L. Zanette, K.L. Prata, J.M. Pina Neto, F.J. de Paula, W.A. Silva Jr., Col1a1 and mir-29b show lower expression levels during osteoblast differentiation of bone marrow stromal cells from osteogenesis imperfecta patients, BMC Med. Genet. 15 (2014) 45. [4] Y.K. Wang, C.S. Chen, Cell adhesion and mechanical stimulation in the regulation of mesenchymal stem cell differentiation, J. Cell. Mol. Med. 17 (2013) 823e832. [5] L. Polo-Corrales, M. Latorre-Esteves, J.E. Ramirez-Vick, Scaffold design for bone regeneration, J. Nanosci. Nanotechnol. 14 (2014) 15e56. [6] G. An, Z. Xue, B. Zhang, Q.K. Deng, Y.S. Wang, S.C. Lv, Expressing osteogenic growth peptide in the rabbit bone mesenchymal stem cells increased alkaline phosphatase activity and enhanced the collagen accumulation, Eur. Rev. Med. Pharmacol. Sci. 18 (2014) 1618e1624. [7] C. Chen, H. Li, X. Kong, S.M. Zhang, I.S. Lee, Immobilizing osteogenic growth peptide with and without fibronectin on a titanium surface: effects of loading methods on mesenchymal stem cell differentiation, Int. J. Nanomedicine 10 (2015) 283e295. [8] H.B. Zhu, Osteogenic actions of the osteogenic growth peptide on bovine marrow mesenchymal stromal cells in culture, Veterinarni Med. 53 (2008) 501e509. [9] C.E. Tye, J.A. Gordon, L.A. Martin-Buley, J.L. Stein, J.B. Lian, G.S. Stein, Could lncrnas be the missing links in control of mesenchymal stem cell differentiation? J. Cell. Physiol. 230 (2015) 526e534. [10] W. Yu, Y. Qiao, X. Tang, L. Ma, Y. Wang, X. Zhang, W. Weng, Q. Pan, Y. Yu, F. Sun, J. Wang, Tumor suppressor long non-coding rna, mt1dp is negatively regulated by yap and runx2 to inhibit foxa1 in liver cancer cells, Cell. Signal. 26 (2014) 2961e2968. [11] L. Zhu, P.C. Xu, Downregulated lncrna-ancr promotes osteoblast differentiation by targeting ezh2 and regulating runx2 expression, Biochem. Biophys. Res. Commun. 432 (2013) 612e617. [12] P. Han, C.P. Chang, Long non-coding rna and chromatin remodeling, RNA Biol. (2015), 0. [13] J. Sheik Mohamed, P.M. Gaughwin, B. Lim, P. Robson, L. Lipovich, Conserved long noncoding rnas transcriptionally regulated by oct4 and nanog modulate pluripotency in mouse embryonic stem cells, Rna 16 (2010) 324e337. [14] G. Lisignoli, S. Cristino, S. Toneguzzi, F. Grassi, A. Piacentini, C. Cavallo, A. Facchini, E. Mariani, Il1beta and tnfalpha differently modulate cxcl13 chemokine in stromal cells and osteoblasts isolated from osteoarthritis patients: evidence of changes associated to cell maturation, Exp. Gerontol. 39 (2004) 659e665. [15] F. Tian, X.L. Ji, W.A. Xiao, B. Wang, F. Wang, Cxcl13 promotes osteogenic differentiation of mesenchymal stem cells by inhibiting mir-23a expression, Stem Cells Int. 2015 (2015) 632305. [16] L.A. Hindorff, P. Sethupathy, H.A. Junkins, E.M. Ramos, J.P. Mehta, F.S. Collins, T.A. Manolio, Potential etiologic and functional implications of genome-wide association loci for human diseases and traits, Proc. Natl. Acad. Sci. U. S. A. 106 (2009) 9362e9367. [17] S.M. Miguel, M. Namdar-Attar, T. Noh, B. Frenkel, I. Bab, Erk1/2-activated de novo mapkapk2 synthesis is essential for osteogenic growth peptide mitogenic signaling in osteoblastic cells, J. Biol. Chem. 280 (2005) 37495e37502. [18] G. Lisignoli, A. Piacentini, S. Toneguzzi, F. Grassi, M. Tschon, S. Cristino, A. Facchini, E. Mariani, Age-associated changes in functional response to cxcr3 and cxcr5 chemokine receptors in human osteoblasts, Biogerontology 4 (2003) 309e317. [19] B. Tonnarelli, C. Manferdini, A. Piacentini, K. Codeluppi, N. Zini, S. Ghisu, A. Facchini, G. Lisignoli, Surface-dependent modulation of proliferation, bone matrix molecules, and inflammatory factors in human osteoblasts, J. Biomed. Mater. Res. Part A 89 (2009) 687e696. [20] Y. Zhang, C. Ma, Y. Yu, M. Liu, C. Yi, Are cxcl13/cxcr5/fak critical regulators of mscs migration and differentiation? Med. Hypotheses 84 (2015) 213e215. [21] X. Li, A. Ghezzi, H.R. Krishnan, J.B. Pohl, A.Y. Bohm, N.S. Atkinson, A histone modification identifies a DNA element controlling slo bk channel gene expression in muscle, J. Neurogenet. (2015) 1e11. [22] C. Kanduri, Long noncoding rnas: lessons from genomic imprinting, Biochimica Biophysica Acta (2015).
Please cite this article in press as: H. Li, et al., Osteogenic growth peptide promotes osteogenic differentiation of mesenchymal stem cells mediated by LncRNA AK141205-induced upregulation of CXCL13, Biochemical and Biophysical Research Communications (2015), http:// dx.doi.org/10.1016/j.bbrc.2015.08.112