- Email: [email protected]
Osthol regulates hepatic PPARα-mediated lipogenic gene expression in alcoholic fatty liver murine
ARTICLE IN PRESS Phytomedicine 17 (2010) 669–673
Contents lists available at ScienceDirect
Phytomedicine journal homepage: www.elsevier.de/phymed
Osthol regulates hepatic PPARa-mediated lipogenic gene expression in alcoholic fatty liver murine Fan Sun a, Mei-lin Xie a,n, Jie Xue a, Heng-bin Wang b a b
Department of Pharmacology, Medical College of Soochow University, Suzhou 215123, Jiangsu Province, China Changshu Leiyunshang Pharmaceutical Co. Ltd., Changshu 215500, Jiangsu Province, China
a r t i c l e in fo
Keywords: Cnidium monnieri (L.) Cusson Osthol Alcoholic fatty liver Peroxisome proliferator-activated receptor
a MK886
abstract Our previous studies found that osthol, an active constituent isolated from Cnidium monnieri (L.) Cusson (Apiaceae), could ameliorate the accumulation of lipids and decrease the lipid levels in serum and hepatic tissue in alcohol-induced fatty liver mice and rats. The objective of this study was to investigate its possible mechanism of the lipid-lowering effect. A mouse model with alcoholic fatty liver was induced by orally feeding 52% erguotou wine by gavage when they were simultaneously treated with osthol 10, 20, 40 mg/kg for 4 weeks. The BRL cells (rat hepatocyte line) were cultured and treated with osthol at 25, 50, 100, 200 mg/ml for 24 h. The mRNA expressions of peroxisome proliferatoractivated receptor (PPAR) a, diacylglycerol acyltransferase (DGAT), 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase and cholesterol 7a-hydroxylase (CYP7A) in mouse hepatic tissue or cultured hepatocytes were determined by reverse transcription polymerase chain reaction (RT-PCR). After treatment with osthol, the PPARa mRNA expression in mouse liver and cultured hepatocytes was increased in dose dependent manner, while its related target genes for mRNA expression, e.g., DGAT and HMG-CoA reductase, were decreased, the CYP7A was inversely increased. And osthol-regulated mRNA expressions of DGAT, HMG-CoA reductase and CYP7A in the cultured hepatocytes were abrogated after pretreatment with specific inhibitor of PPARa, MK886. It was concluded that osthol might regulate the gene expressions of DGAT, HMG-CoA reductase and CYP7A via increasing the PPARa mRNA expression. & 2009 Elsevier GmbH. All rights reserved.
Introduction Alcohol remains one of the most common causes of chronic liver diseases in the world (Diehl 2002). Fatty liver, characterized by an accumulation of triglycerides (TG) and cholesterol in the liver, is the most common and earliest response of the liver to alcohol in heavy alcohol users. Although the pathogenesis of fatty liver by ethanol is complex and multifactorial, the lipogenesis has long been proposed as an important biochemical mechanism underlying the development of alcoholic fatty liver. It has been reported that impaired mitochondrial oxidation of long-chain fatty acids might result in the ‘‘fatty acid overload’’ and these accumulated fatty acids are diverted into esterification (TG synthesis) (Kaikaus et al. 1993; Ockner et al. 1993). In a study with human subjects, it was shown that the hepatic lipogenesis was activated after an ethanol consumption of 24 g per day (Siler et al. 1999). So, it is now accepted that long-term ethanol consumption can increase the rate of lipid synthesis in the liver of
n
Corresponding author. Tel.: + 86 512 65880320; fax: +86 512 65880103. E-mail address: [email protected] (M.-l. Xie).
0944-7113/$ - see front matter & 2009 Elsevier GmbH. All rights reserved. doi:10.1016/j.phymed.2009.10.021
human being and animals by inducing the key lipogenic gene expression. Peroxisome proliferator-activated receptor (PPAR) a, one of the PPAR receptors, is predominantly expressed in the liver (Braissant et al. 1996) and involved in the clearance of circulating and cellular lipids by controlling the expression of lipogenic genes including diacylglycerol acyltransferase (DGAT), 3-hydroxy3-methylglutaryl-CoA (HMG-CoA) reductase and cholesterol 7a-hydroxylase (CYP7A) (Berger and Moller 2002; Waterman and Zammit 2002; Konig et al. 2007). DGAT is a microsomal enzyme expressed in the liver and ratelimited enzyme in the process of TG synthesis, catalyzes the final step in TG synthesis by converting diacylglycerol and fatty acylcoenzyme A into TG (Farese et al. 2000). Some research data have shown that DGAT mRNA expression was close to PPARa (Waterman and Zammit 2002; Duval et al. 2007). And it is now accepted that PPARa activation may increase the uptake and boxidation of hepatic fatty acids, which decrease the availability of fatty acids for TG synthesis (Schoonjans et al. 1996). HMG-CoA reductase is the rate-limiting enzyme of cholesterol synthesis. In wild-type mice, an antiparallel relationship exists between the gene expression of PPARa and that of HMG-CoA reductase. It was also reported that PPARa activation could inhibit the expression
ARTICLE IN PRESS 670
F. Sun et al. / Phytomedicine 17 (2010) 669–673
of HMG-CoA reductase by reduction of nuclear sterol regulatory element binding protein-2 (Konig et al. 2007). Thus, these data strongly suggested that PPARa activation might reduce cholesterol synthesis by diminishing expression of its target gene HMGCoA reductase. CYP7A is a liver-specific enzyme that catalyzes the transformation of cholesterol into bile acids. Deletion of the CYP7A gene in mice had a dramatic effect on bile acid development, while over-expression of the gene in hamsters could greatly reduce plasma cholesterol level. Since secretion of cholesterol and bile acids in the bile is the major route for the removal of cholesterol from the body, CYP7A plays an important role in cholesterol homoeostasis (Noshiro et al. 2007). It had been shown that PPARa was apt to induce the hepatic expression of liver X receptor, which subsequently up-regulates the gene expression of CYP7A (Chiang 2002). Osthol (7-methoxy-8-isopentenoxycoumarin) (Fig. 1) is an active constituent isolated from the fruit of Cnidium monnieri (L.) Cusson, a Chinese herbal medicine. In the clinic, the fruit has been used in the treatment of skin disease and gynecopathy for many years (Lian 2003). Modern pharmacological studies have shown that osthol has anti-inflammation (Liu et al. 2005), anti-oxidation (Wang et al. 2005), anti-osteoporosis (Zhang et al. 2007), antiapoptosis (Okamoto et al. 2003), anti-tumor (Zhou et al. 2002) and estrogen-like effects (Kuo et al. 2005). Our previous studies found that osthol could ameliorate the accumulation of lipids and decrease the lipid levels in serum and hepatic tissue in alcoholinduced fatty liver mice and rats, (Song et al. 2006; Sun et al. 2009), but its mechanism was not completely understood. In this study, the effects of osthol on PPARa and PPARa-mediated genes such as DGAT, HMG-CoA reductase, and CYP7A were investigated in vivo and in vitro.
Mouse model of alcoholic fatty liver (Zhao et al. 2005; Guo et al. 2006) Kunming mice (male, 7 weeks of age), weighing 23-27 g, were obtained from Animal Breeding Center of Soochow University (Suzhou, China), and were housed in regular cages in a room controlled temperature and humidity, and allowed free access to food and water. The animals were allowed to acclimatize to the laboratory environment for 7 days prior to the study. All animal studies were approved by the University Ethic Committee and conducted according to the regulations for the use and care of experimental animals at Soochow University (number of Ethic Commitee: 2008-84). These mice were randomly divided into 5 groups (n = 6): control group, fatty liver model group, osthol 10, 20 and 40 mg/kg groups. The treated groups were orally given osthol 0.1 ml/10 g body weight per day by gavage based on different dose in the morning for 4 weeks, and control and model animals were orally given an equivalent volume of 0.5% sodium carboxymethyl cellulose solution. In order to induce the development of alcoholic fatty liver, all mice except the control group were simultaneously given 52% erguotou wine by gavage, which was administered in the afternoon for 4 weeks. The amount of the wine administered to the animals was gradually increased from 0.1 ml/10 g to 0.4 ml/10 g (full dose) body weight per day within one week according to animal tolerance. The mice were then killed by stunning and cervical dislocation after oral administration for 4 weeks, partial hepatic tissues were quickly taken and frozen in liquid nitrogen and stored at -80 1C for RT-PCR.
RT-PCR Materials and methods Reagents Osthol was prepared and provided by Dr. Jia Zhou of Green Spring Natural Product Co., Ltd. (Xi’an, China), the purity was 498% as determined by HPLC. Erguotou wine was a product of Bejing Red Star Co., Ltd. (Bejing, China), the composition of the wine is alcohol and water (52:48, v-v). Trizol was a product of Invitrogen (Carlsbad, CA, USA). Taq DNA polymerase and reverse transcriptase were products of Sangon Gene Company (Shanghai, China) and Fermentas (Vilnius, Lithuania), respectively. The primers used for amplification by reverse transcription polymerase chain reaction (RT-PCR) were synthesized by Sangon Gene Company (Shanghai, China). MK886 (purity 499%), an inhibitor of PPARa, was obtained from Cayman Chemical Company. All other reagents used in this study were of analytical grade.
O
H3CO
H 3C
CH3
Fig. 1. Structure of osthol.
O
RT-PCR was used to measure the mRNA expressions of PPARa, DGAT, HMG-CoA reductase, CYP-7A and GAPDH in mouse hepatic tissue. Hepatic tissue samples were immediately placed into Trizol reagent, total RNA was extracted according to the manufacturer’s instructions. The final RNA pellet was resolved by 0.1% diethyl pyrocarbonate-treated water, the concentration and purity of the RNA were determined spectrophotometrically by the absorbance ratio 260:280 nm. Total RNA (2 mg) was used as the RT reaction following the manufacturer’s introduction. After RT, 22 ml of a PCR master mix, including all PCR components and the primers (Table 1), was added to tubes containing 3 ml of cDNA. After the samples were overlaid with mineral oil, the tubes were placed in the DNA thermal cycler. The PCR conditions were as follows: 33 cycles of denaturation at 94 1C for 30 s, annealing (the temperature was seen in Table 1) for 45 s, and extension at 72 1C for 45 s after an initial step of 94 1C for 5 min. A final extension was 72 1C for 10 min. PCR products were conducted with 1.5% agarose gel electrophoresis and ethidium bromide staining, and quantitated by densitometry using the Image Master VDS system and associated software (Pharmacia, USA). Data were expressed as a ratio of the signals of interest band to that of GAPDH band, the latter acted as the internal control in the experiment.
BRL cell culture The rat hepatocyte line (BRL cells) under passage 30 (Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, Shanghai, China) was cultured in RPMI 1640 supplemented with L-glutamine and 10% calf serum, and was maintained at 37 1C in a humidified atmosphere with 5% CO2.
ARTICLE IN PRESS F. Sun et al. / Phytomedicine 17 (2010) 669–673
671
Table 1 The primers used for RT-PCR amplification to determine the gene expression in mouse liver tissue. Gene
Forward and reverse primers
bp
Annealing temperature
PPARa (Kehrer et al. 2001)
50 50 50 50 50 50 50 50 50 50
312
60 1C
216
55 1C
882
57 1C
515
56 1C
728
56 1C
DGAT (Qin et al. 2007) HMG-CoA reductase (Diehl 2001) CYP-7A (Kwon et al. 2005) GAPDH
AGGCAGATGACCTGGAAAGTC 30 ATGCGTGAACTCCGTAGTGG 30 GGCCTTCTTCCACGAGTACC 30 GGCCTCATAGTTGAGCACG 30 GGGACGGTGACACTTACCATCTGTATGATG 30 ATC ATCTTGGAGAGATAAAACTGCCA 30 CCTTGGGACGTTTTCCTGCT 30 GCGCTCTTTGATTTAGGAAG 30 GTATGACGTGGAGTCTACTG 30 TACTCCTTGGAGGCCATGTA 30
Table 2 The primers used for RT-PCR amplification to determine the gene expression in rat hepatic cells. Gene
Forward and reverse primers
bp
Annealing temperature
PPARa (Ringseis et al. 2007)
50 50 50 50 50 50 50 50 50 50
509
56 1C
492
60 1C
406
57 1C
306
60 1C
702
56 1C
DGAT (Okamoto et al. 2005) HMG-CoA reductase (Farese et al. 2000) CYP-7A (Schoonjans et al. 1996) GAPDH (Schoonjans et al. 1996)
AAGCCATCTTCACGATGCTG 30 TCAGAGGTCCCTGAACGGTG 30 TGGTCCCTACTATCCAGAACTCCA 30 CCAATGATGAGTGTCACCCACAC 30 AAGGGGCGTGCAAAGACAATC 30 ATACGGCACGGAAAGAACCATAGT 30 GCCGTCCAAGAAATCAAGCAGT 30 TGTGGGCAGCGAGAACAAAGT 30 GCCATCAACGACCCCTTCATT 30 CGCCTGCTTCACCACCTTCTT 30
Effects of osthol on mRNA expressions of PPARa, DGAT, HMG-CoA reductase and CYP7A in cultured cells
Results Effect on PPARa mRNA expression
BRL cells were seeded at a density of 1 106/ml in 6-well plates and divided into five groups as follows: RPMI 1640 (control), RPMI 1640 with osthol 25, 50, 100 and 200 mg/ml, respectively. After treatment with osthol for 24 h, the cells were detached with a cell scraper and collected, and total RNA was extracted. The samples were then stored at -80 1C until RT-PCR analysis. RT-PCR analysis was the same as above procedure, the specific primers for RT-PCR amplification were seen in Table 2.
The expression of PPARa mRNA in mouse liver tissue was significantly decreased in model group as compared with the control group (po0.01). After administration of osthol plus erguotou wine for 4 weeks, the gene expression was dosedependently increased (p o0.01) (Fig. 2). The same result was also found after BRL cells were incubated with osthol 25-200 mg/ml for 24 h in vitro, the increased percentage was 2.7%-65.8% (Fig. 3). Effect on DGAT mRNA expression
Effects of PPARa inhibitor on osthol-regulated mRNA expressions of DGAT, HMG-CoA reductase and CYP7A in cultured cells To investigate whether regulation of DGAT, HMG-CoA reductase and CYP7A mRNA expressions by osthol was associated with PPARa, MK886, a specific inhibitor of PPARa, was used in the experiment (Kehrer et al. 2001). BRL cells were divided into 4 groups: RPMI 1640 (control), RPMI 1640 with 200 mg/ml osthol, RPMI 1640 with 1 mmol/l MK886, and RPMI 1640 with 1 mmol/l MK886 plus 200 mg/ml osthol. After BRL cells were pretreated with MK886 (1 mmol/l) for 2 h, osthol was then added and incubated with cells for 24 h (Qin et al. 2007). Total RNA was isolated and used for DGAT, HMG-CoA reductase and CYP7A mRNA expressions by RT-PCR analysis. Data analysis The data are expressed as mean 7 SD. The significance of difference between experimental groups was determined by using one-way ANOVA, po0.05 was considered statistically significant.
The expression of DGAT mRNA in mouse liver tissue was significantly increased in model group (po0.05) and decreased in dose dependent manner after treatment with osthol plus erguotou wine for 4 weeks (po0.05 or po0.01) (Fig. 2). Osthol at 25-200 mg/ ml also decreased the mRNA expression of DGAT in cultured BRL cells, the decreased percentage was 3.9%-38.2% (Fig. 3). Effect on HMG-CoA reductase mRNA expression The expression of HMG-CoA reductase mRNA in mouse liver tissue was increased in model group as compared with the control group (p o0.05). After treatment with osthol plus erguotou wine for 4 weeks, the gene expression was dose-dependently decreased (p o0.01) (Fig. 2). The same result was also found in treatment BRL cells with osthol 25-200 mg/ml for 24 h in vitro, the inhibitory percentage was 3.6%-75.3% (Fig. 3). Effect on CYP7A mRNA expression The expression of CYP7A mRNA in mouse liver tissue was decreased in model group as compared with the control group
ARTICLE IN PRESS 672
F. Sun et al. / Phytomedicine 17 (2010) 669–673
Fig. 2. Effects of osthol on mRNA expressions of PPARa, DGAT, HMG-CoA reductase, and CYP7A in hepatic tissue after administration for 4 weeks in mice fed with erguotou wine. Data are presented as x 7 SD, n= 6. ap o0.05, bp o0.01 vs. control group; cp o0.05, dp o0.01 vs. model group. Lanes M: marker; 1: control; 2: model; 3: osthol 10 mg/kg; 4: osthol 20 mg/kg; 5: osthol 40 mg/kg.
Fig. 4. Effects of PPARa inhibitor MK886 on osthol-regulated mRNA expressions of DGAT, HMG-CoA reductase, and CYP7A in cultured hepatocytes. Data are presented as x 7 SD, n= 3. ap o0.05, bpo 0.01 vs. control group; dp o 0.01 vs. osthol group. Lanes M: marker; 1: control; 2: osthol 200 mg/ml; 3: MK886 1 mmol/l; 4: MK886 1 mmol/l + osthol 200 mg/ml.
mRNA expressions by osthol was completely cancelled, but effects of MK886 itself on DGAT and HMG-CoA reductase mRNA expressions were not found. Likewise, the CYP7A mRNA expression induced by osthol was also reduced and below the control level (po0.01), and compared with control group, MK886 itself could also inhibit the CYP7A mRNA expression (po0.01). Discussion and conclusion
Fig. 3. The mRNA expressions of PPARa, DGAT, HMG-CoA reductase, and CYP7A in cultured hepatocytes after treatment with different concentrations of osthol for 24 h. Data are presented as x7 SD, n= 3. ap o0.05, bpo 0.01 vs. control group. Lanes M: marker; 1: control; 2: osthol 25 mg/ml; 3: osthol 50 mg/ml; 4: osthol 100 mg/ml; 5: osthol 200 mg/ml.
(po0.05), but was dose-dependently increased after treatment with osthol plus erguotou wine for 4 weeks (p o0.05 or p o0.01) (Fig. 2). After BRL cells were treated with oshtole 25-200 mg/ml for 24 h in vitro, the mRNA expression of CYP7A was also increased by 10.9%-69.6% (Fig. 3).
Effects of PPARa inhibitor MK886 on mRNA expressions of DGAT, HMG-CoA redcutase and CYP7A in cultured BRL cells Using MK886 (a specific inhibitor of PPARa), we examined whether osthol-regulated mRNA expressions of DGAT, HMG-CoA reductase and CYP7A were mediated by activation of PPARa pathway. As shown in Fig. 4, after pretreatment of BRL cells with MK886 for 2 h, the inhibition of DGAT and HMG-CoA reductase
Alcoholic fatty liver was thought to be relatively benign in the past, but more recent studies have shown that the disease is apt to develop inflammation, necrosis, fibrosis and final cirrhosis, and the lipid accumulation renders the liver more susceptible to injury by some agents such as drugs and toxins (Diehl 2001). Therefore, alcoholic fatty liver should be treated as an important liver disorder. As steatosis, steatohepatitis, and possible fibrosis are reversible, early treatment is important. However, no ideal treatment has been scientifically proven to ameliorate lesions of alcoholic fatty liver or to avoid its progression. In previous experiments, we found that osthol could dramatically decrease lipid levels of serum and hepatic tissue and improve the alcoholinduced fatty liver in mice and rats (Song et al. 2006; Sun et al. 2009), but the mechanism of its lipid-lowering effect was not completely understood. Both animal data and human studies have shown that PPARa is involved in regulation of lipid metabolism (Kwon et al. 2005; Ringseis et al. 2007), and we find that the chemical structure of osthol is similar to the agonists of PPARa, clofibrate analogs (Okamoto et al. 2005). So we examined the effect of osthol on PPARa gene expression in mouse liver tissue and cultured rat hepatocytes. The results showed that PPARa mRNA expression in liver tissue in osthol-treated mice was dose-dependently increased, and the same result was also found in cultured hepatocytes after treatment with osthol for 24 h in vitro. These results suggested that osthol might be a novel PPARa agonist, and its mechanism of the lipid-lowering effect was related to increasing or decreasing PPARa-mediated lipogenic gene expression.
ARTICLE IN PRESS F. Sun et al. / Phytomedicine 17 (2010) 669–673
Next, we further examined the effects of osthol on PPARamediated target genes involved in synthesis of cholesterol and TG and transformation of cholesterol into bile acid. In mouse liver tissue and cultured hepatocytes, the mRNA expressions of DGAT and HMG-CoA reductase were decreased, while the mRNA expression of CYP7A was increased after treatment with osthol. The same results were found in vivo and in vitro, the effective dose started from 20 mg/kg in mice, and the effective concentration was at 100 mg/ml in cell culture experiments. The oral bioavailability of osthol in rats is about 26.8% (Zhou et al. 2008) and is poor due to rapid metabolism (Yuan et al. 2009), but we speculated that the concentration of 100 mg/ml tested in present cell study could be reached in the animal model. From our present results, we assumed that osthol could regulate the gene expressions of DGAT, HMG-CoA reductase and CYP7A via increasing the PPARa mRNA expression. In order to determine whether osthol regulated the gene expressions of DGAT, HMG-CoA reductase and CYP7A via PPARa pathway, the MK886, a specific PPARa inhibitor was used. The results showed that the inhibitory effects of osthol on DGAT and HMG-CoA reductase gene expressions were completely cancelled, and osthol-induced gene expression of CYP7A was also decreased after preincubation with MK886 for 2 h. This finding demonstrated our hypothesis, i.e., osthol-regulated gene expressions of hepatic DGAT, HMG-CoA reductase and CYP7A were mediated by PPARa pathway. In conclusion, our present study demonstrated that osthol might be beneficial in preventing and improving murine fatty liver induced by alcohol, its mechanism of the lipid-lowering effect might be related with modulation of hepatic PPARamediated lipogenic gene expression.
Acknowledgements This work is supported by the Science and Technology Funds of Suzhou City (no. SWG0903 ) and Jiangsu Province (no. BE2008642), China.
References Berger, J., Moller, D.E., 2002. The mechanisms of action of PPARs. Rev. Med. 53, 409–435. Braissant, O., Foufelle, F., Scotto, C., et al., 1996. Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-alpha, -beta, and -gamma in the adult rat. Endocrinology 137, 354–366. Chiang, J.L., 2002. Bile acid regulation of gene expression: roles of nuclear hormone receptors. Endocrine 23, 443–463. Diehl, A.M., 2001. Nonalcoholic fatty liver disease: implications for alcoholic liver disease pathogenesis. Alcohol Clin. Exp. Res. 25, 8S–14S. Diehl, A.M., 2002. Liver disease in alcohol abusers: clinical perspective. Alcohol 27, 7–11. Duval, C., Muller, M., Kersten, S., 2007. PPARa and dyslipidemia. Biochim. Biophys. Acta 1771, 961–971. Farese Jr, R.V, Cases, S., Smith, S.J., 2000. Triglyceride synthesis: insights from the cloning of diacylglycerol acyltransferase. Curr. Opin. Lipidol. 11, 229–234.
673
Guo, J.Y., Wang, Q.J., Wu, J.H., 2006. Studies on the protective effect of saponins from polygala aureocauda on animal models of liver injury. Chin. J. Nat. Med. 4, 303–307. Kaikaus, R.M., Chan, W.K., Ortiz, de, et al., 1993. Mechanisms of regulation of liver fatty acid-binding protein. Mol. Cell Biochem. 123, 93–100. Kehrer, J.P., Biswal, S.S., La, E., et al., 2001. Inhibition of peroxisome-proliferatoractivated receptor (PPAR) a by MK886. Biochem. J. 356, 899–906. Konig, B., Koch, A., Spielmann, J., et al., 2007. Activation of PPARa lowers synthesis and concentration of cholesterol by reduction of nuclear SREBP-2. Biochem. Pharmacol. 73, 574–585. Kuo, P.L., Hsu, Y.L., Chang, C.H., Chang, J.K., 2005. Osthol-mediated cell differentiation through bone morphogenetic protein-2/p38 and extracellular signal-regulated kinase 1/2 pathway in human osteoblast cells. J. Pharmacol. Exp. Ther. 314, 1290–1299. Kwon, H.J., Hyun, S.H., Choung, S.Y., 2005. Traditional Chinese medicine improves dysfunction of peroxisome proliferator-activated receptor alpha and microsomal triglyceride transfer protein on abnormalities in lipid metabolism in ethanol-fed rats. Biofactors 23, 163–176. Lian, Q.S., 2003. Progress in study of chemical constituents and pharmacological effects of the fruit of Cnidium monnieri. Chin. Med. Mater. 26, 141–144. Liu, J.X., Zhang, W.P., Zhou, L., et al., 2005. Anti-inflammatory effect and mechanism of osthol in rats. J. Chin. Med. Mater. 28, 1002–1006. Noshiro, M., Usui, E., Kawamoto, T., et al., 2007. Multiple mechanisms regulate circadian expression of the gene for cholesterol 7a-hydroxylase(Cyp7a), a key enzyme in hepatic bile acid biosynthesis. J. Biol. Rhythm 22, 299–311. Ockner, R.K., Kaikaus, R.M., Bass, N.M., 1993. Fatty-acid metabolism and the pathogenesis of hepatocellular carcinoma: review and hypothesis. Hepatology 18, 669–676. Okamoto, T., Kawasaki, T., Hino, O., 2003. Osthol prevents anti-fas antibodyinduced hepatitis in mice by affecting the caspase-3-mediated apoptotic pathway. Biochem. Pharmacol. 65, 677–681. Okamoto, T., Kobavashi, T., Yoshida, S., 2005. Chemical aspects of coumarin compounds for the prevention of hepatocellular carcinomas. Curr. Med. Chem. Anticancer Agents 5, 47–51. Qin, S., Liu, T.J., Kamanna, V.S., Kashyap, M.L., 2007. Pioglitazone stimulates apolipoprotein A-I production without affecting HDL removal in HepG2 cells involvement of PPAR-a. Arterioscler. Thromb. Vasc. Biol. 27, 2428–2434. Ringseis, R., Muschick, A., Eder, K., 2007. Dietary oxidized fat prevents ethanolinduced triacylglycerol accumulation and increases expression of PPARa target genes in rat liver. J. Nutr. 137, 77–83. Schoonjans, K., Staels, B., Auwerx, J., 1996. Role of the peroxisome proliferatoractivated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression. J. Lipid Res. 37, 907–925. Siler, S.Q., Neese, R.A., Hellerstein, M.K., 1999. De novo lipogenesis, lipid kinetics, and whole-body lipid balances in humans after acute alcohol consumption. Am. J. Clin. Nutr. 70, 928–936. Song, F., Xie, M.L., Zhu, L.J., et al., 2006. Experimental study of osthol on treatment of hyperlipidemic and alcoholic fatty liver in animals. World J. Gastroenterol. 12, 4359–4363. Sun, F., Xie, M.L., Zhu, L.J., Gu, Z.L., 2009. Inhibitory effect of osthol on alcoholinduced fatty liver in mice. Digest. Liver Dis. 41, 127–133. Wang, S.H., An, F., Zhang, D.S., Zhang, L., 2005. Experiment study on anti-oxidation effect of osthol. Chin. Tradit. Patent Med. 27, 488–489. Waterman, I.J., Zammit, V.A., 2002. Differential effects of fenofibrate or simvastatin treatment of rats on hepatic microsomal overt and latent diacylglycerol acyltransferase activities. Diabetes 51, 1708–1713. Yuan, Z., Xu, H., Wang, K., et al., 2009. Determination of osthol and its metabolites in a phase I reaction system and the Caco-2 cell model by HPLC-UV and LC-MS/MS. J. Pharm. Biomed. Anal. 49, 1226–1232. Zhang, Q., Qin, L., He, W., et al., 2007. Coumarins from Cnidium monnieri and their antiosteoporotic activity. Planta Med. 73, 13–19. Zhao, M., Yang, X.F., Huang, J.M., 2005. Study on liver injury model induced by alcohol. Chin. J. Public Health 21, 1101–1102. Zhou, J., Cheng, W.X., Xu, Y.H., 2002. Experimental study on anti-tumour effect of osthol extracted from the fruits of Cnidium monnieri (L.) Cusson. Zhejiang J. Integr. Tradit. West Med. 12, 76–78. Zhou, J., Wang, S.W., Sun, X.L., 2008. Determination of osthol in rat plasma by highperformance liquid chromatograph using cloud-point extraction. Anal. Chim. Acta 608, 158–164.
Contents lists available at ScienceDirect
Phytomedicine journal homepage: www.elsevier.de/phymed
Osthol regulates hepatic PPARa-mediated lipogenic gene expression in alcoholic fatty liver murine Fan Sun a, Mei-lin Xie a,n, Jie Xue a, Heng-bin Wang b a b
Department of Pharmacology, Medical College of Soochow University, Suzhou 215123, Jiangsu Province, China Changshu Leiyunshang Pharmaceutical Co. Ltd., Changshu 215500, Jiangsu Province, China
a r t i c l e in fo
Keywords: Cnidium monnieri (L.) Cusson Osthol Alcoholic fatty liver Peroxisome proliferator-activated receptor
a MK886
abstract Our previous studies found that osthol, an active constituent isolated from Cnidium monnieri (L.) Cusson (Apiaceae), could ameliorate the accumulation of lipids and decrease the lipid levels in serum and hepatic tissue in alcohol-induced fatty liver mice and rats. The objective of this study was to investigate its possible mechanism of the lipid-lowering effect. A mouse model with alcoholic fatty liver was induced by orally feeding 52% erguotou wine by gavage when they were simultaneously treated with osthol 10, 20, 40 mg/kg for 4 weeks. The BRL cells (rat hepatocyte line) were cultured and treated with osthol at 25, 50, 100, 200 mg/ml for 24 h. The mRNA expressions of peroxisome proliferatoractivated receptor (PPAR) a, diacylglycerol acyltransferase (DGAT), 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase and cholesterol 7a-hydroxylase (CYP7A) in mouse hepatic tissue or cultured hepatocytes were determined by reverse transcription polymerase chain reaction (RT-PCR). After treatment with osthol, the PPARa mRNA expression in mouse liver and cultured hepatocytes was increased in dose dependent manner, while its related target genes for mRNA expression, e.g., DGAT and HMG-CoA reductase, were decreased, the CYP7A was inversely increased. And osthol-regulated mRNA expressions of DGAT, HMG-CoA reductase and CYP7A in the cultured hepatocytes were abrogated after pretreatment with specific inhibitor of PPARa, MK886. It was concluded that osthol might regulate the gene expressions of DGAT, HMG-CoA reductase and CYP7A via increasing the PPARa mRNA expression. & 2009 Elsevier GmbH. All rights reserved.
Introduction Alcohol remains one of the most common causes of chronic liver diseases in the world (Diehl 2002). Fatty liver, characterized by an accumulation of triglycerides (TG) and cholesterol in the liver, is the most common and earliest response of the liver to alcohol in heavy alcohol users. Although the pathogenesis of fatty liver by ethanol is complex and multifactorial, the lipogenesis has long been proposed as an important biochemical mechanism underlying the development of alcoholic fatty liver. It has been reported that impaired mitochondrial oxidation of long-chain fatty acids might result in the ‘‘fatty acid overload’’ and these accumulated fatty acids are diverted into esterification (TG synthesis) (Kaikaus et al. 1993; Ockner et al. 1993). In a study with human subjects, it was shown that the hepatic lipogenesis was activated after an ethanol consumption of 24 g per day (Siler et al. 1999). So, it is now accepted that long-term ethanol consumption can increase the rate of lipid synthesis in the liver of
n
Corresponding author. Tel.: + 86 512 65880320; fax: +86 512 65880103. E-mail address: [email protected] (M.-l. Xie).
0944-7113/$ - see front matter & 2009 Elsevier GmbH. All rights reserved. doi:10.1016/j.phymed.2009.10.021
human being and animals by inducing the key lipogenic gene expression. Peroxisome proliferator-activated receptor (PPAR) a, one of the PPAR receptors, is predominantly expressed in the liver (Braissant et al. 1996) and involved in the clearance of circulating and cellular lipids by controlling the expression of lipogenic genes including diacylglycerol acyltransferase (DGAT), 3-hydroxy3-methylglutaryl-CoA (HMG-CoA) reductase and cholesterol 7a-hydroxylase (CYP7A) (Berger and Moller 2002; Waterman and Zammit 2002; Konig et al. 2007). DGAT is a microsomal enzyme expressed in the liver and ratelimited enzyme in the process of TG synthesis, catalyzes the final step in TG synthesis by converting diacylglycerol and fatty acylcoenzyme A into TG (Farese et al. 2000). Some research data have shown that DGAT mRNA expression was close to PPARa (Waterman and Zammit 2002; Duval et al. 2007). And it is now accepted that PPARa activation may increase the uptake and boxidation of hepatic fatty acids, which decrease the availability of fatty acids for TG synthesis (Schoonjans et al. 1996). HMG-CoA reductase is the rate-limiting enzyme of cholesterol synthesis. In wild-type mice, an antiparallel relationship exists between the gene expression of PPARa and that of HMG-CoA reductase. It was also reported that PPARa activation could inhibit the expression
ARTICLE IN PRESS 670
F. Sun et al. / Phytomedicine 17 (2010) 669–673
of HMG-CoA reductase by reduction of nuclear sterol regulatory element binding protein-2 (Konig et al. 2007). Thus, these data strongly suggested that PPARa activation might reduce cholesterol synthesis by diminishing expression of its target gene HMGCoA reductase. CYP7A is a liver-specific enzyme that catalyzes the transformation of cholesterol into bile acids. Deletion of the CYP7A gene in mice had a dramatic effect on bile acid development, while over-expression of the gene in hamsters could greatly reduce plasma cholesterol level. Since secretion of cholesterol and bile acids in the bile is the major route for the removal of cholesterol from the body, CYP7A plays an important role in cholesterol homoeostasis (Noshiro et al. 2007). It had been shown that PPARa was apt to induce the hepatic expression of liver X receptor, which subsequently up-regulates the gene expression of CYP7A (Chiang 2002). Osthol (7-methoxy-8-isopentenoxycoumarin) (Fig. 1) is an active constituent isolated from the fruit of Cnidium monnieri (L.) Cusson, a Chinese herbal medicine. In the clinic, the fruit has been used in the treatment of skin disease and gynecopathy for many years (Lian 2003). Modern pharmacological studies have shown that osthol has anti-inflammation (Liu et al. 2005), anti-oxidation (Wang et al. 2005), anti-osteoporosis (Zhang et al. 2007), antiapoptosis (Okamoto et al. 2003), anti-tumor (Zhou et al. 2002) and estrogen-like effects (Kuo et al. 2005). Our previous studies found that osthol could ameliorate the accumulation of lipids and decrease the lipid levels in serum and hepatic tissue in alcoholinduced fatty liver mice and rats, (Song et al. 2006; Sun et al. 2009), but its mechanism was not completely understood. In this study, the effects of osthol on PPARa and PPARa-mediated genes such as DGAT, HMG-CoA reductase, and CYP7A were investigated in vivo and in vitro.
Mouse model of alcoholic fatty liver (Zhao et al. 2005; Guo et al. 2006) Kunming mice (male, 7 weeks of age), weighing 23-27 g, were obtained from Animal Breeding Center of Soochow University (Suzhou, China), and were housed in regular cages in a room controlled temperature and humidity, and allowed free access to food and water. The animals were allowed to acclimatize to the laboratory environment for 7 days prior to the study. All animal studies were approved by the University Ethic Committee and conducted according to the regulations for the use and care of experimental animals at Soochow University (number of Ethic Commitee: 2008-84). These mice were randomly divided into 5 groups (n = 6): control group, fatty liver model group, osthol 10, 20 and 40 mg/kg groups. The treated groups were orally given osthol 0.1 ml/10 g body weight per day by gavage based on different dose in the morning for 4 weeks, and control and model animals were orally given an equivalent volume of 0.5% sodium carboxymethyl cellulose solution. In order to induce the development of alcoholic fatty liver, all mice except the control group were simultaneously given 52% erguotou wine by gavage, which was administered in the afternoon for 4 weeks. The amount of the wine administered to the animals was gradually increased from 0.1 ml/10 g to 0.4 ml/10 g (full dose) body weight per day within one week according to animal tolerance. The mice were then killed by stunning and cervical dislocation after oral administration for 4 weeks, partial hepatic tissues were quickly taken and frozen in liquid nitrogen and stored at -80 1C for RT-PCR.
RT-PCR Materials and methods Reagents Osthol was prepared and provided by Dr. Jia Zhou of Green Spring Natural Product Co., Ltd. (Xi’an, China), the purity was 498% as determined by HPLC. Erguotou wine was a product of Bejing Red Star Co., Ltd. (Bejing, China), the composition of the wine is alcohol and water (52:48, v-v). Trizol was a product of Invitrogen (Carlsbad, CA, USA). Taq DNA polymerase and reverse transcriptase were products of Sangon Gene Company (Shanghai, China) and Fermentas (Vilnius, Lithuania), respectively. The primers used for amplification by reverse transcription polymerase chain reaction (RT-PCR) were synthesized by Sangon Gene Company (Shanghai, China). MK886 (purity 499%), an inhibitor of PPARa, was obtained from Cayman Chemical Company. All other reagents used in this study were of analytical grade.
O
H3CO
H 3C
CH3
Fig. 1. Structure of osthol.
O
RT-PCR was used to measure the mRNA expressions of PPARa, DGAT, HMG-CoA reductase, CYP-7A and GAPDH in mouse hepatic tissue. Hepatic tissue samples were immediately placed into Trizol reagent, total RNA was extracted according to the manufacturer’s instructions. The final RNA pellet was resolved by 0.1% diethyl pyrocarbonate-treated water, the concentration and purity of the RNA were determined spectrophotometrically by the absorbance ratio 260:280 nm. Total RNA (2 mg) was used as the RT reaction following the manufacturer’s introduction. After RT, 22 ml of a PCR master mix, including all PCR components and the primers (Table 1), was added to tubes containing 3 ml of cDNA. After the samples were overlaid with mineral oil, the tubes were placed in the DNA thermal cycler. The PCR conditions were as follows: 33 cycles of denaturation at 94 1C for 30 s, annealing (the temperature was seen in Table 1) for 45 s, and extension at 72 1C for 45 s after an initial step of 94 1C for 5 min. A final extension was 72 1C for 10 min. PCR products were conducted with 1.5% agarose gel electrophoresis and ethidium bromide staining, and quantitated by densitometry using the Image Master VDS system and associated software (Pharmacia, USA). Data were expressed as a ratio of the signals of interest band to that of GAPDH band, the latter acted as the internal control in the experiment.
BRL cell culture The rat hepatocyte line (BRL cells) under passage 30 (Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, Shanghai, China) was cultured in RPMI 1640 supplemented with L-glutamine and 10% calf serum, and was maintained at 37 1C in a humidified atmosphere with 5% CO2.
ARTICLE IN PRESS F. Sun et al. / Phytomedicine 17 (2010) 669–673
671
Table 1 The primers used for RT-PCR amplification to determine the gene expression in mouse liver tissue. Gene
Forward and reverse primers
bp
Annealing temperature
PPARa (Kehrer et al. 2001)
50 50 50 50 50 50 50 50 50 50
312
60 1C
216
55 1C
882
57 1C
515
56 1C
728
56 1C
DGAT (Qin et al. 2007) HMG-CoA reductase (Diehl 2001) CYP-7A (Kwon et al. 2005) GAPDH
AGGCAGATGACCTGGAAAGTC 30 ATGCGTGAACTCCGTAGTGG 30 GGCCTTCTTCCACGAGTACC 30 GGCCTCATAGTTGAGCACG 30 GGGACGGTGACACTTACCATCTGTATGATG 30 ATC ATCTTGGAGAGATAAAACTGCCA 30 CCTTGGGACGTTTTCCTGCT 30 GCGCTCTTTGATTTAGGAAG 30 GTATGACGTGGAGTCTACTG 30 TACTCCTTGGAGGCCATGTA 30
Table 2 The primers used for RT-PCR amplification to determine the gene expression in rat hepatic cells. Gene
Forward and reverse primers
bp
Annealing temperature
PPARa (Ringseis et al. 2007)
50 50 50 50 50 50 50 50 50 50
509
56 1C
492
60 1C
406
57 1C
306
60 1C
702
56 1C
DGAT (Okamoto et al. 2005) HMG-CoA reductase (Farese et al. 2000) CYP-7A (Schoonjans et al. 1996) GAPDH (Schoonjans et al. 1996)
AAGCCATCTTCACGATGCTG 30 TCAGAGGTCCCTGAACGGTG 30 TGGTCCCTACTATCCAGAACTCCA 30 CCAATGATGAGTGTCACCCACAC 30 AAGGGGCGTGCAAAGACAATC 30 ATACGGCACGGAAAGAACCATAGT 30 GCCGTCCAAGAAATCAAGCAGT 30 TGTGGGCAGCGAGAACAAAGT 30 GCCATCAACGACCCCTTCATT 30 CGCCTGCTTCACCACCTTCTT 30
Effects of osthol on mRNA expressions of PPARa, DGAT, HMG-CoA reductase and CYP7A in cultured cells
Results Effect on PPARa mRNA expression
BRL cells were seeded at a density of 1 106/ml in 6-well plates and divided into five groups as follows: RPMI 1640 (control), RPMI 1640 with osthol 25, 50, 100 and 200 mg/ml, respectively. After treatment with osthol for 24 h, the cells were detached with a cell scraper and collected, and total RNA was extracted. The samples were then stored at -80 1C until RT-PCR analysis. RT-PCR analysis was the same as above procedure, the specific primers for RT-PCR amplification were seen in Table 2.
The expression of PPARa mRNA in mouse liver tissue was significantly decreased in model group as compared with the control group (po0.01). After administration of osthol plus erguotou wine for 4 weeks, the gene expression was dosedependently increased (p o0.01) (Fig. 2). The same result was also found after BRL cells were incubated with osthol 25-200 mg/ml for 24 h in vitro, the increased percentage was 2.7%-65.8% (Fig. 3). Effect on DGAT mRNA expression
Effects of PPARa inhibitor on osthol-regulated mRNA expressions of DGAT, HMG-CoA reductase and CYP7A in cultured cells To investigate whether regulation of DGAT, HMG-CoA reductase and CYP7A mRNA expressions by osthol was associated with PPARa, MK886, a specific inhibitor of PPARa, was used in the experiment (Kehrer et al. 2001). BRL cells were divided into 4 groups: RPMI 1640 (control), RPMI 1640 with 200 mg/ml osthol, RPMI 1640 with 1 mmol/l MK886, and RPMI 1640 with 1 mmol/l MK886 plus 200 mg/ml osthol. After BRL cells were pretreated with MK886 (1 mmol/l) for 2 h, osthol was then added and incubated with cells for 24 h (Qin et al. 2007). Total RNA was isolated and used for DGAT, HMG-CoA reductase and CYP7A mRNA expressions by RT-PCR analysis. Data analysis The data are expressed as mean 7 SD. The significance of difference between experimental groups was determined by using one-way ANOVA, po0.05 was considered statistically significant.
The expression of DGAT mRNA in mouse liver tissue was significantly increased in model group (po0.05) and decreased in dose dependent manner after treatment with osthol plus erguotou wine for 4 weeks (po0.05 or po0.01) (Fig. 2). Osthol at 25-200 mg/ ml also decreased the mRNA expression of DGAT in cultured BRL cells, the decreased percentage was 3.9%-38.2% (Fig. 3). Effect on HMG-CoA reductase mRNA expression The expression of HMG-CoA reductase mRNA in mouse liver tissue was increased in model group as compared with the control group (p o0.05). After treatment with osthol plus erguotou wine for 4 weeks, the gene expression was dose-dependently decreased (p o0.01) (Fig. 2). The same result was also found in treatment BRL cells with osthol 25-200 mg/ml for 24 h in vitro, the inhibitory percentage was 3.6%-75.3% (Fig. 3). Effect on CYP7A mRNA expression The expression of CYP7A mRNA in mouse liver tissue was decreased in model group as compared with the control group
ARTICLE IN PRESS 672
F. Sun et al. / Phytomedicine 17 (2010) 669–673
Fig. 2. Effects of osthol on mRNA expressions of PPARa, DGAT, HMG-CoA reductase, and CYP7A in hepatic tissue after administration for 4 weeks in mice fed with erguotou wine. Data are presented as x 7 SD, n= 6. ap o0.05, bp o0.01 vs. control group; cp o0.05, dp o0.01 vs. model group. Lanes M: marker; 1: control; 2: model; 3: osthol 10 mg/kg; 4: osthol 20 mg/kg; 5: osthol 40 mg/kg.
Fig. 4. Effects of PPARa inhibitor MK886 on osthol-regulated mRNA expressions of DGAT, HMG-CoA reductase, and CYP7A in cultured hepatocytes. Data are presented as x 7 SD, n= 3. ap o0.05, bpo 0.01 vs. control group; dp o 0.01 vs. osthol group. Lanes M: marker; 1: control; 2: osthol 200 mg/ml; 3: MK886 1 mmol/l; 4: MK886 1 mmol/l + osthol 200 mg/ml.
mRNA expressions by osthol was completely cancelled, but effects of MK886 itself on DGAT and HMG-CoA reductase mRNA expressions were not found. Likewise, the CYP7A mRNA expression induced by osthol was also reduced and below the control level (po0.01), and compared with control group, MK886 itself could also inhibit the CYP7A mRNA expression (po0.01). Discussion and conclusion
Fig. 3. The mRNA expressions of PPARa, DGAT, HMG-CoA reductase, and CYP7A in cultured hepatocytes after treatment with different concentrations of osthol for 24 h. Data are presented as x7 SD, n= 3. ap o0.05, bpo 0.01 vs. control group. Lanes M: marker; 1: control; 2: osthol 25 mg/ml; 3: osthol 50 mg/ml; 4: osthol 100 mg/ml; 5: osthol 200 mg/ml.
(po0.05), but was dose-dependently increased after treatment with osthol plus erguotou wine for 4 weeks (p o0.05 or p o0.01) (Fig. 2). After BRL cells were treated with oshtole 25-200 mg/ml for 24 h in vitro, the mRNA expression of CYP7A was also increased by 10.9%-69.6% (Fig. 3).
Effects of PPARa inhibitor MK886 on mRNA expressions of DGAT, HMG-CoA redcutase and CYP7A in cultured BRL cells Using MK886 (a specific inhibitor of PPARa), we examined whether osthol-regulated mRNA expressions of DGAT, HMG-CoA reductase and CYP7A were mediated by activation of PPARa pathway. As shown in Fig. 4, after pretreatment of BRL cells with MK886 for 2 h, the inhibition of DGAT and HMG-CoA reductase
Alcoholic fatty liver was thought to be relatively benign in the past, but more recent studies have shown that the disease is apt to develop inflammation, necrosis, fibrosis and final cirrhosis, and the lipid accumulation renders the liver more susceptible to injury by some agents such as drugs and toxins (Diehl 2001). Therefore, alcoholic fatty liver should be treated as an important liver disorder. As steatosis, steatohepatitis, and possible fibrosis are reversible, early treatment is important. However, no ideal treatment has been scientifically proven to ameliorate lesions of alcoholic fatty liver or to avoid its progression. In previous experiments, we found that osthol could dramatically decrease lipid levels of serum and hepatic tissue and improve the alcoholinduced fatty liver in mice and rats (Song et al. 2006; Sun et al. 2009), but the mechanism of its lipid-lowering effect was not completely understood. Both animal data and human studies have shown that PPARa is involved in regulation of lipid metabolism (Kwon et al. 2005; Ringseis et al. 2007), and we find that the chemical structure of osthol is similar to the agonists of PPARa, clofibrate analogs (Okamoto et al. 2005). So we examined the effect of osthol on PPARa gene expression in mouse liver tissue and cultured rat hepatocytes. The results showed that PPARa mRNA expression in liver tissue in osthol-treated mice was dose-dependently increased, and the same result was also found in cultured hepatocytes after treatment with osthol for 24 h in vitro. These results suggested that osthol might be a novel PPARa agonist, and its mechanism of the lipid-lowering effect was related to increasing or decreasing PPARa-mediated lipogenic gene expression.
ARTICLE IN PRESS F. Sun et al. / Phytomedicine 17 (2010) 669–673
Next, we further examined the effects of osthol on PPARamediated target genes involved in synthesis of cholesterol and TG and transformation of cholesterol into bile acid. In mouse liver tissue and cultured hepatocytes, the mRNA expressions of DGAT and HMG-CoA reductase were decreased, while the mRNA expression of CYP7A was increased after treatment with osthol. The same results were found in vivo and in vitro, the effective dose started from 20 mg/kg in mice, and the effective concentration was at 100 mg/ml in cell culture experiments. The oral bioavailability of osthol in rats is about 26.8% (Zhou et al. 2008) and is poor due to rapid metabolism (Yuan et al. 2009), but we speculated that the concentration of 100 mg/ml tested in present cell study could be reached in the animal model. From our present results, we assumed that osthol could regulate the gene expressions of DGAT, HMG-CoA reductase and CYP7A via increasing the PPARa mRNA expression. In order to determine whether osthol regulated the gene expressions of DGAT, HMG-CoA reductase and CYP7A via PPARa pathway, the MK886, a specific PPARa inhibitor was used. The results showed that the inhibitory effects of osthol on DGAT and HMG-CoA reductase gene expressions were completely cancelled, and osthol-induced gene expression of CYP7A was also decreased after preincubation with MK886 for 2 h. This finding demonstrated our hypothesis, i.e., osthol-regulated gene expressions of hepatic DGAT, HMG-CoA reductase and CYP7A were mediated by PPARa pathway. In conclusion, our present study demonstrated that osthol might be beneficial in preventing and improving murine fatty liver induced by alcohol, its mechanism of the lipid-lowering effect might be related with modulation of hepatic PPARamediated lipogenic gene expression.
Acknowledgements This work is supported by the Science and Technology Funds of Suzhou City (no. SWG0903 ) and Jiangsu Province (no. BE2008642), China.
References Berger, J., Moller, D.E., 2002. The mechanisms of action of PPARs. Rev. Med. 53, 409–435. Braissant, O., Foufelle, F., Scotto, C., et al., 1996. Differential expression of peroxisome proliferator-activated receptors (PPARs): tissue distribution of PPAR-alpha, -beta, and -gamma in the adult rat. Endocrinology 137, 354–366. Chiang, J.L., 2002. Bile acid regulation of gene expression: roles of nuclear hormone receptors. Endocrine 23, 443–463. Diehl, A.M., 2001. Nonalcoholic fatty liver disease: implications for alcoholic liver disease pathogenesis. Alcohol Clin. Exp. Res. 25, 8S–14S. Diehl, A.M., 2002. Liver disease in alcohol abusers: clinical perspective. Alcohol 27, 7–11. Duval, C., Muller, M., Kersten, S., 2007. PPARa and dyslipidemia. Biochim. Biophys. Acta 1771, 961–971. Farese Jr, R.V, Cases, S., Smith, S.J., 2000. Triglyceride synthesis: insights from the cloning of diacylglycerol acyltransferase. Curr. Opin. Lipidol. 11, 229–234.
673
Guo, J.Y., Wang, Q.J., Wu, J.H., 2006. Studies on the protective effect of saponins from polygala aureocauda on animal models of liver injury. Chin. J. Nat. Med. 4, 303–307. Kaikaus, R.M., Chan, W.K., Ortiz, de, et al., 1993. Mechanisms of regulation of liver fatty acid-binding protein. Mol. Cell Biochem. 123, 93–100. Kehrer, J.P., Biswal, S.S., La, E., et al., 2001. Inhibition of peroxisome-proliferatoractivated receptor (PPAR) a by MK886. Biochem. J. 356, 899–906. Konig, B., Koch, A., Spielmann, J., et al., 2007. Activation of PPARa lowers synthesis and concentration of cholesterol by reduction of nuclear SREBP-2. Biochem. Pharmacol. 73, 574–585. Kuo, P.L., Hsu, Y.L., Chang, C.H., Chang, J.K., 2005. Osthol-mediated cell differentiation through bone morphogenetic protein-2/p38 and extracellular signal-regulated kinase 1/2 pathway in human osteoblast cells. J. Pharmacol. Exp. Ther. 314, 1290–1299. Kwon, H.J., Hyun, S.H., Choung, S.Y., 2005. Traditional Chinese medicine improves dysfunction of peroxisome proliferator-activated receptor alpha and microsomal triglyceride transfer protein on abnormalities in lipid metabolism in ethanol-fed rats. Biofactors 23, 163–176. Lian, Q.S., 2003. Progress in study of chemical constituents and pharmacological effects of the fruit of Cnidium monnieri. Chin. Med. Mater. 26, 141–144. Liu, J.X., Zhang, W.P., Zhou, L., et al., 2005. Anti-inflammatory effect and mechanism of osthol in rats. J. Chin. Med. Mater. 28, 1002–1006. Noshiro, M., Usui, E., Kawamoto, T., et al., 2007. Multiple mechanisms regulate circadian expression of the gene for cholesterol 7a-hydroxylase(Cyp7a), a key enzyme in hepatic bile acid biosynthesis. J. Biol. Rhythm 22, 299–311. Ockner, R.K., Kaikaus, R.M., Bass, N.M., 1993. Fatty-acid metabolism and the pathogenesis of hepatocellular carcinoma: review and hypothesis. Hepatology 18, 669–676. Okamoto, T., Kawasaki, T., Hino, O., 2003. Osthol prevents anti-fas antibodyinduced hepatitis in mice by affecting the caspase-3-mediated apoptotic pathway. Biochem. Pharmacol. 65, 677–681. Okamoto, T., Kobavashi, T., Yoshida, S., 2005. Chemical aspects of coumarin compounds for the prevention of hepatocellular carcinomas. Curr. Med. Chem. Anticancer Agents 5, 47–51. Qin, S., Liu, T.J., Kamanna, V.S., Kashyap, M.L., 2007. Pioglitazone stimulates apolipoprotein A-I production without affecting HDL removal in HepG2 cells involvement of PPAR-a. Arterioscler. Thromb. Vasc. Biol. 27, 2428–2434. Ringseis, R., Muschick, A., Eder, K., 2007. Dietary oxidized fat prevents ethanolinduced triacylglycerol accumulation and increases expression of PPARa target genes in rat liver. J. Nutr. 137, 77–83. Schoonjans, K., Staels, B., Auwerx, J., 1996. Role of the peroxisome proliferatoractivated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression. J. Lipid Res. 37, 907–925. Siler, S.Q., Neese, R.A., Hellerstein, M.K., 1999. De novo lipogenesis, lipid kinetics, and whole-body lipid balances in humans after acute alcohol consumption. Am. J. Clin. Nutr. 70, 928–936. Song, F., Xie, M.L., Zhu, L.J., et al., 2006. Experimental study of osthol on treatment of hyperlipidemic and alcoholic fatty liver in animals. World J. Gastroenterol. 12, 4359–4363. Sun, F., Xie, M.L., Zhu, L.J., Gu, Z.L., 2009. Inhibitory effect of osthol on alcoholinduced fatty liver in mice. Digest. Liver Dis. 41, 127–133. Wang, S.H., An, F., Zhang, D.S., Zhang, L., 2005. Experiment study on anti-oxidation effect of osthol. Chin. Tradit. Patent Med. 27, 488–489. Waterman, I.J., Zammit, V.A., 2002. Differential effects of fenofibrate or simvastatin treatment of rats on hepatic microsomal overt and latent diacylglycerol acyltransferase activities. Diabetes 51, 1708–1713. Yuan, Z., Xu, H., Wang, K., et al., 2009. Determination of osthol and its metabolites in a phase I reaction system and the Caco-2 cell model by HPLC-UV and LC-MS/MS. J. Pharm. Biomed. Anal. 49, 1226–1232. Zhang, Q., Qin, L., He, W., et al., 2007. Coumarins from Cnidium monnieri and their antiosteoporotic activity. Planta Med. 73, 13–19. Zhao, M., Yang, X.F., Huang, J.M., 2005. Study on liver injury model induced by alcohol. Chin. J. Public Health 21, 1101–1102. Zhou, J., Cheng, W.X., Xu, Y.H., 2002. Experimental study on anti-tumour effect of osthol extracted from the fruits of Cnidium monnieri (L.) Cusson. Zhejiang J. Integr. Tradit. West Med. 12, 76–78. Zhou, J., Wang, S.W., Sun, X.L., 2008. Determination of osthol in rat plasma by highperformance liquid chromatograph using cloud-point extraction. Anal. Chim. Acta 608, 158–164.