- Email: [email protected]
FASN axis and ERK phosphorylation
Journal Pre-proof Osthole delays hepatocarcinogenesis in mice by suppressing AKT/FASN axis and ERK phosphorylation Yasi Mo, Yong Wu, Xin Li, Hui Rao, Xianxiang Tian, Danni Wu, Zhenpeng Qiu, Guohua Zheng, Junjie Hu PII:
S0014-2999(19)30740-X
DOI:
https://doi.org/10.1016/j.ejphar.2019.172788
Reference:
EJP 172788
To appear in:
European Journal of Pharmacology
Received Date: 6 May 2019 Revised Date:
2 November 2019
Accepted Date: 7 November 2019
Please cite this article as: Mo, Y., Wu, Y., Li, X., Rao, H., Tian, X., Wu, D., Qiu, Z., Zheng, G., Hu, J., Osthole delays hepatocarcinogenesis in mice by suppressing AKT/FASN axis and ERK phosphorylation, European Journal of Pharmacology (2019), doi: https://doi.org/10.1016/j.ejphar.2019.172788. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V.
Osthole delays hepatocarcinogenesis in mice by suppressing AKT/FASN axis and ERK phosphorylation Yasi Moa#, Yong Wua#, Xin Lia, Hui Raoa, Xianxiang Tiana, Danni Wua, Zhenpeng Qiua, Guohua Zhengb* and Junjie Hua* a
College of Pharmacy, Hubei University of Chinese Medicine, Wuhan, People’s
Republic of China b
Key Laboratory of Chinese Medicine Resource and Compound Prescription,
Ministry of Education, Hubei University of Chinese Medicine, Wuhan, People’s Republic of China # Yasi Mo and Yong Wu contributed equally to this work. * Correspondence to: Dr Junjie Hu, College of Pharmacy, Hubei University of Chinese Medicine, No. 1, West Huangjiahu Road, Wuhan 430065, P.R. China, E-mail: [email protected]; Professor Guohua Zheng, Key Laboratory of Chinese Medicine Resource and Compound Prescription, Ministry of Education, Hubei University of Chinese Medicine, No. 1, West Huangjiahu Road, Wuhan 430065, P.R. China, E-mail: [email protected]. Financial support: This study was supported by National Natural Science Foundation of China (No. 81602424) for Dr. Junjie Hu.
Abstract Hepatocellular carcinoma (HCC) is one of the most common fatal malignancies worldwide. Inhibition of the lipogenic enzymes involved in hepatic de novo lipogenesis can both effectively restrain proliferation of HCC cells in vitro and reduce the risk of hepatocarcinogenesis in vivo. Although a natural coumarin derivative osthole shows efficacy in suppressing cell proliferation and inducing apoptosis in cultured hepatoma cells and HCC xenograft tumors, the molecular mechanism by which osthole delays hepatocellular malignant transformation during lipogenesis-driven hepatocarcinogenesis remains unknown. Here, we evaluate the efficacy of osthole in a rapid HCC mouse model featuring excessive levels of hepatic steatosis established via hydrodynamic transfection of activated forms of AKT and c-Met proto-oncogenes. Moreover, human hepatoma cell lines were employed for in vitro assessment. Hematoxylin and eosin staining, immunoblotting and immunohistochemistry were applied for mechanistic investigations. The results revealed that if osthole was administered in the early stage of AKT/c-Met-driven HCC, it led to disease stabilization. Moreover, osthole alleviated hepatic steatosis in the AKT/c-Met mice. Further evidence at the molecular level suggested that osthole reduced the expression of phosphor-extracellular signal-regulated kinase 1/2 (ERK1/2), proliferating cell nuclear antigen (PCNA) and Ki67 in livers of the AKT/c-Met mice. Mechanically, osthole efficiently repressed the phospho-AKT (Thr308) / ribosomal protein S6 (RPS6) / fatty acid synthase (FASN) signaling both in mice and in vitro. Altogether, this study suggests that osthole exerts its antilipogenic
and antiproliferative efficacy by suppressing the AKT/FASN axis and ERK phosphorylation, which contributes to its capacity to delay hepatocarcinogenesis. Key words: osthole; hepatocellular carcinoma; hepatocarcinogenesis; v-akt murine thymoma viral oncogene homolog; fatty acid synthase; extracellular signal-regulated kinase.
1. Introduction HCC is one of the most common malignant tumors worldwide and accounts for approximately 90 % of primary hepatic carcinoma, which has a poor prognosis and frequent relapse characteristics (Huaman et al., 2018; Huang et al., 2016). Due to the lack of effective therapeutic strategies for advanced HCC, patients initially diagnosed with the fatal disease in advanced stages typically die in 3-6 months (Bruix et al., 2016). Moreover, patients with HCC are commonly diagnosed at advanced stages, therefore excluding them from curative resection (Bruix et al., 2011). Clinical data also indicate that FDA-approved, first-line drugs for advanced HCC (e.g., sorafenib, regorafenib) can only prolong the survival of patients with this liver lethal burden by approximately 3 months (Bruix et al., 2017; Llovet and Virginia, 2014). Thus, the discovery of new small molecule drugs for the management of HCC is extremely urgent. Mounting evidence suggests that the activation of the v-akt murine thymoma viral oncogene homolog (AKT) and mitogen-activated protein kinase (MAPK) pathways indicates a poor prognosis of human hepatocellular carcinoma (HCC) (Calvisi et al., 2011; Ladu et al., 2008; Qian et al., 2011). In the AKT/mTOR pathway, activated AKT phosphorylates its major downstream effector mTOR complex 1 (mTORC1) (Hales et al., 2014) and subsequently activates 4-EBP1/eIF4E and p70S6K/ribosomal protein S6 (RPS6) signaling, which stimulates cap-dependent translation, aberrant cell metabolism and excessive proliferation (Matter et al., 2014; Zhou et al., 2011). Fatty acid synthase (FASN) is a multifunctional protein that modulates hepatic fatty acid
bio-synthesis and plays a central role in de novo lipogenesis in mammals. As such, the elevated FASN expression and concomitantly enhanced FASN activity correlate with increasing tumor burden and poor prognosis of a variety of human malignancies (Flavin et al., 2010). Moreover, the ligand hepatocyte growth factor binding to c-Met results in homodimerization and autophosphorylation of the c-Met receptor at its tyrosine residues and sequentially stimulates multiple oncogenic growth signaling pathways, including extracellular signal-regulated kinase (ERK) signaling (Giordano and Columbano, 2014). Hence, strategies targeting FASN activity and these pro-oncogenic pathways may be effective for delaying the development and progression of HCC. Osthole is a bioactive coumarin derivative isolated from the fruit of Cnidium monnieri (L.) (Jelodarian et al., 2017). Of note, osthole possesses efficacy against tumor cell growth and survival in various types of malignancies by modulating PTEN expression and suppressing PI3K/AKT, MAPK and NF-κB signaling pathways (Ding et al., 2013; Feng et al., 2017; Wang et al., 2016; Xu et al., 2018; Xu et al., 2011; Zhu et al., 2017). Although previous studies reported that osthole arrests cell-cycle progression and induces apoptosis in HCC cells (Chao et al., 2014; Lin et al., 2017; Zhang et al., 2012; Zhang et al., 2015), precise mechanisms by which the suppression of enhanced lipogenesis contributes to its efficacy in liver tumorigenesis remain unclear. This study provides evidence that osthole is effective in preventing lipogenesis-driven hepatocellular malignant transformation by suppressing the AKT/FASN axis and ERK phosphorylation.
2. Materials and methods 2.1. Constructs and reagents Osthole was purchased from Aladdin Chemistry Co., Ltd. (D1612130, purity, ≥ 99 %) and dissolved in corn oil and DMSO for administration to mice and in vitro experiments, respectively. The constructs used for mouse injection, including pT3-EF1α-HA-myr-AKT, pT3-EF1α-V5-c-Met and pCMV-sleeping beauty transposase (pCMV-SB), were gifts from Dr. Xin Chen of the University of California, San Francisco. All plasmids were purified utilizing the Endotoxin Free Maxi kit (Omega Biotek, Inc.; Doraville, GA, USA) before transfection. 2.2. Hydrodynamic transfection and osthole treatment Wild-type (WT) FVB/N mice were purchased from Charles River (Beijing, China). All the animal studies were conducted with female mice at 5-7 weeks old. Mice were group-housed in standard mouse cages and maintained under a 12 h light/dark cycle with free access to water and standard mouse chow. For establishing a rapid HCC model, hydrodynamic transfection was performed as previously described (Hu et al., 2016). Briefly, 20 µg of pT3-EF1a-HA-myr-AKT and 20 µg of pT3-EF1α-V5-c-Met along with 1.6 µg of pCMV-SB were diluted in 2 mL saline (0.9 % NaCl) solution and injected into the lateral tail vein of the FVB/N mice within 7 seconds (n = 6, each group). Before osthole treatment in the HCC mice, the WT mice was administered with osthole for 6 weeks. There was no definite pathological alteration in the two dosage groups after 6 weeks of osthole administration (Supplementary Fig. 1).
Osthole (low dose, 122 mg/kg/day; high dose, 244 mg/kg/day) or vehicle was intraperitoneally injected daily as previously described (Zhang et al., 2012; Zhang et al., 2015) for three weeks starting 3 weeks after hydrodynamic injection. The Animal Ethics Committees of the Hubei University of Chinese Medicine approved all of the experimental protocols (Approval No: HUCMS2018003) in accordance with the Principles of Laboratory Animal Care and Use in Research (Ministry of Health, Beijing, China). At six weeks post hydrodynamic injection, after pentobarbital anesthesia, blood samples were taken from the tail vein and centrifuged at 1000 g for 10 min at 4 °C; the supernatant was preserved at -80 °C for ELISA. All the animals were killed by cervical dislocation and dissected. The experiments were designed in compliance with the Guidelines laid down by the NIH in the US regarding the care and use of animals for experimental procedures. 2.3. Hematoxylin and eosin (H&E) staining, immunohistochemistry (IHC), and ELISA Liver specimens were fixed in 4 % paraformaldehyde and embedded in paraffin. For H&E staining, liver tissue sections were dewaxed in xylene and rehydrated using ethanol with decreasing concentrations. The sections were then stained with hematoxylin and eosin to visualize the histological features of the liver samples. For immunohistochemistry, deparaffinized sections were incubated in 3 % H2O2 dissolved in 1x phosphate-buffered saline (PBS) for 30 min to quench the endogenous peroxidase. For antigen retrieval, slides were microwaved in 10 mM citrate buffer (pH
6.0) for 15 min. Subsequently, slides were incubated with the anti-PCNA, anti-Ki67 and anti-FASN antibodies (CST, Danvers, MA, USA) overnight at 4 °C. After incubation with the appropriate biotin-conjugated secondary antibody and subsequently with streptavidin solution, color development was performed using Vector Nova RED™ (Vector Laboratories) as a chromogen. Sections were counterstained using Gill-2 hematoxylin (Thermo-Shandon, Pittsburgh, PA, USA). Serum α-fetoprotein (AFP) was assessed using Mouse α-Fetoprotein/AFP Quantikine ELISA Kit (MAFP00, R&D Systems, USA) according to the manufacturer's instructions. 2.4. Western blotting Frozen mouse liver specimens were homogenized in mammalian protein extraction reagent (Thermo Scientific, Waltham, MA, USA) containing Cocktail Protease Inhibitors (Roche, Indianapolis, IN, USA). Protein concentrations were determined with a BCA protein determination assay. The lysates were denatured 5 min at 95 °C in Tris-glycine SDS loading buffer, separated by SDS-PAGE, and then blotted to polyvinylidene fluoride membranes. Membranes were blocked in 5 % nonfat dry milk in Tris-buffered saline containing 0.1 % Tween 20 for 1 h and probed with specific antibodies. The following primary antibodies (CST, Danvers, MA, USA) were used: total AKT (t-AKT), phosphor-AKT (Thr308), phosphor-AKT (Ser473), total ERK (t-ERK), phospho-p44/42MAPK (ERK1/2) (Thr202/Tyr204), ribosomal protein S6 (RPS6), phosphor-RPS6 (Ser240/244), and FASN. Each protein linked with primary
antibody was further incubated with horseradish peroxidase-secondary antibody for 1 h at 25 °C. The HRP-conjugated β-actin antibody (Proteintech, Wuhan, China) served as an internal standard for normalization. 2.5. Quantitative polymerase chain reaction (qPCR) The total cellular RNA in the liver samples was extracted and isolated using TRIzol® Reagent (Invitrogen, USA). PCRs were performed with 1 µg of cDNA of the collected samples using Rever Tra Ace (TOYOBO, Japan) with Oligo (dT) 18 at 37 °C for 60 min. The thermal cycling condition for PCR was denaturation at 95 °C for 2 min, 40 cycles at 95 °C for 5 s and 55 °C for 25 s. Quantitative values were expressed as N target (NT). NT = 2-∆Ct, where in the ∆Ct value of each sample was calculated by subtracting the average Ct value of the target gene from the average Ct value of the 18s rRNA gene. The previously validated primers (Qiao et al., 2018) for PCR were as follows: AFP forward, 5'-TCTGCTGGCACGCAAGAAG-3' and reverse, 5'-TCGGCAGGTTCTGGAAACTG-3'; GPC-3 forward, 5'-CAGCCCGGACTCAAATGGG-3' and reverse, 5'-CAGCCGTGCTGTTAGTTGGTA-3'; 18s rRNA forward, 5'- CGGCTACCACATCCAAGGAA -3' and reverse, 5'- GCTGGAATTACCGCGGCT -3'. 2.6. Cell culture and treatment HepG2 and SMMC-7721 human hepatoma cell lines were maintained as monolayer cultures in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10 %
fetal bovine serum and 1% penicillin/streptomycin at 37 °C in a humidified 5 % CO2 atmosphere. For cell viability assay, cells were plated at a density of 5000 cells per well. After 48 h of osthole treatment (0-200 µM), cell viability was determined using a CCK-8 cell viability assay kit (Dojindo Laboratories, Kumamoto, Japan). For transient transfection studies, cells were cultured in 6-well plates and co-transfected with pT3-EF1α-HA-myr-AKT and pT3-EF1α-V5-c-Met constructs using Lipofectamine™ 2000 according to the manufacturer's protocol (Invitrogen, Carlsbad, CA, USA) for 24 h. The hepatoma cells in the presence or absence of exogenous co-expression of AKT and c-Met were further administered with osthole for 48 h and harvested for further assessment. 2.7. Statistical analysis Data analysis was performed with Prism 6 (Graph Pad, USA). All data represent at least three independent experimental results and are shown as the mean ± S.D.. Statistical evaluations were performed by one-way analysis of variance. Comparisons between two groups were performed with two-tailed unpaired t-test. A significant difference was considered as P < 0.05. 3. Results 3.1. Osthole delays AKT/c-Met-triggered rapid hepatocarcinogenesis in mice Mice with hepatic co-activation of AKT and c-Met proto-oncogenes destined to develop hepatocellular carcinoma within 6 weeks (Hu et al., 2016). Using this rapid HCC mouse model, we investigated the efficacy of osthole in preventing
AKT/c-Met-induced HCC development (Fig. 1A). The results showed that liver tumor burden was significantly lower in the osthole-treated mice than that in the AKT/c-Met group, as exhibited by gross evidence (Fig. 1B). Moreover, liver weight (Fig. 1C) and liver/body ratio (Fig. 1D) in the AKT/c-Met mice were reversed by osthole treatment. Meanwhile, the osthole-treated cohorts displayed a significant reduction in body weight than AKT/c-Met controls (Fig. 1E), possibly due to the restrain of hepatomegaly in the osthole-treated mice. Furthermore, in the AKT/c-Met-L group, osthole (122 mg/kg) had a limited influence on neoplastic lesions as indicated by H&E staining. Of note, osthole (244 mg/kg) ameliorated hepatic steatosis and nearly eliminated hepatocellular tumors in the AKT/c-Met mice (Fig. 2). In addition, the mRNA levels of AFP and Glypican-3 (GPC-3), the most common diagnostic and prognostic markers for HCC (Wang et al., 2011), was reduced in livers of the osthole-administered AKT/c-Met mice (Fig. 3A and B). Consistently, the serum level of AFP was suppressed after osthole treatment in the AKT/c-Met HCC mice (Fig. 3C). Thus, these results suggest that osthole results in a stable disease state in the AKT/c-Met HCC mice when administered in the early stage (3 weeks post-AKT/c-Met injection) of liver tumorigenesis. 3.2. Osthole suppresses cell proliferation in livers of AKT/c-Met mice by restraining ERK activation To further investigate whether the suppression of aberrant cell proliferation contributes to the efficacy of osthole in the AKT/c-Met HCC mice, immunohistochemical and Western blot assays were performed to assess its effect on
PCNA protein expression. As expected, the AKT/c-Met mice treated with osthole displayed a significant decrease in the hepatic protein expression of PCNA (Fig. 4A, C and D). Consistently, highly proliferative tumor cells were nearly eliminated upon osthole treatment, as shown by Ki-67 staining (Fig. 4A), with a significant decrease of proliferation index from vehicle-administered tumor tissues (Fig. 4B). Furthermore, the phosphorylation of ERK1/2 in livers of the AKT/c-Met mice was also suppressed by osthole treatment (Fig. 4C and D), suggesting that the deactivation of the ERK/MAPK pathway emerges during osthole-induced impairment of the proliferative capacity. Together, our data indicate that osthole may inhibit hepatocellular proliferation that contributes to the development of AKT/c-Met-driven HCC by suppressing ERK phosphorylation. 3.3. Osthole represses the AKT/FASN axis in livers of AKT/c-Met mice Next, we evaluated the protein expression of major factors facilitating lipogenesis and malignant transformation in the AKT/c-Met HCC mice. We found that osthole restrained AKT phosphorylation at regulatory residues Thr-308 (T308) and Ser-473 (S473) (Fig. 5A and B). Moreover, downregulation of activated/phosphorylated ribosomal protein S6 (RPS6), a key component of lipogenesis and carcinogenesis improving the efficiency of global protein synthesis, was observed in osthole-treated AKT/c-Met mice (Fig. 5A and B). Consistent with levels of steatosis and degrees of tumorigenesis observed during H&E staining, Western blot and immunohistochemical (IHC) assays revealed that osthole significantly weakened the protein expression of FASN relative to the AKT/c-Met group (Fig. 5A, B and C). Therefore, these data
suggest that osthole retards hepatocellular hyperproliferation in the AKT/c-Met mice probably by regulating the AKT/FASN signaling. 3.4. Osthole inhibits the AKT/RPS6/FASN pathway and phosphorylation of ERK1/2 in vitro Next, to confirm the effects of osthole on the AKT/FASN axis and ERK phosphorylation in the development of HCC, we investigated whether osthole could modulate the protein expression levels of phospho-AKT(Thr308), phospho-AKT(Ser473), phospho-RPS6, FASN and phospho-ERK1/2 in SMCC-7721 or AKT-transfected HepG2 cells due to the distinct expression levels of activated AKT in these two types of hepatoma cell lines (Qiu et al., 2019). To achieve this goal, the cytotoxic potential of osthole (0-200 µM) in hepatoma cells was first confirmed (Supplementary Fig. 2). Then, SMMC-7721 cells (activated AKT highly expressed) were incubated with osthole (60-180 µM) for 24 h. Of note, the protein expression of the above targets was downregulated by osthole treatment in a dose-dependent manner in SMMC-7721 cells (Fig. 6A and B). Moreover, the effect of osthole on these factors was further validated in AKT/c-Met-transfected hepatoma cells. To do so, HepG2 cells (relatively low phosphor-Akt protein expression) were transiently cotransfected with pT3-EF1α-HA-myr-AKT and pT3-EF1α-V5-c-Met overexpressing constructs and further incubated in the presence or absence of osthole for 24 h. In accordance with in vivo data and the findings in SMMC-7721 cells, osthole treatment suppressed the AKT/FASN axis and phosphorylation of RPS6 and ERK1/2 in AKT/c-Met-transfected hepatoma cells (Fig. 6C and D). Overall, our data suggest
that osthole obstructs hepatocarcinogenesis, mainly due to the inhibition of the signaling transduction manipulating de novo lipogenesis and cellular proliferation. 4. Discussion Mounting evidence suggests that osthole is capable of suppressing increased aggressiveness in various types of human cancer cells (Wang et al., 2016; Xu et al., 2018; Xu et al., 2011; Zhu et al., 2017), including HCC (Zhang et al., 2012; Zhang et al., 2015). However, to date, the effectiveness was only observed in cultured hepatoma cell lines or HCC tumor-bearing mice; therefore, no study has been conducted to investigate the efficacy of osthole on the malignant transformation of hepatocytes during hepatocarcinogenesis. Here, we investigated whether osthole could inhibit malignant transformation of hepatocytes using a novel preclinical HCC mouse model featuring increased lipogenesis. Of note, the present work indicates that osthole delays hepatocarcinogenesis by targeting the AKT/FASN axis and ERK phosphorylation. Hepatic metabolic reprogramming, including aerobic glycolysis, excessive lipogenesis and glutamine metabolism, is considered a liver cancer hallmark. In particular, elevated de novo lipogenesis is an essential feature of hepatocellular malignant transformation and HCC progression (Calvisi et al., 2011). Epidemiological studies have suggested that metabolic syndrome and non-alcoholic fatty liver disease (NAFLD) are key risk factors for HCC (Michelotti et al., 2013), thereby bridging dysfunctional fatty acid bio-synthesis to hepatocarcinogenesis. Dysregulation of the PI3K/AKT/mTOR signaling pathway is forcefully implicated in liver cancer
pathogenesis due to its functioning in cell proliferation, invasion, metastasis, and lipid metabolic reprogramming (Martini et al., 2014). Hence, targeting the key modulators of this oncogenic pathway might be a useful therapeutic approach for HCC. Notably, for the first time, the present evidence demonstrated that the elevated phosphorylation level of AKT at both Thr308 and Ser473 residues was suppressed by osthole treatment during hepatocarcinogenesis in mice. Moreover, osthole alleviated the excessive hepatic steatosis, which results from AKT-induced strengthened expression of lipogenic enzymes (e.g., acetyl-CoA carboxylase (ACAC), stearoyl-CoA desaturase 1 (SCD1) and FASN) in mice (Hu et al., 2016). FASN, the key metabolic enzyme responsible for the terminal catalytic step in de novo lipogenesis, is highly expressed in many cancers (Flavin et al., 2010). In partial accordance with the literature showing that osthole represses the activation of the AKT/mTOR signaling, which subsequently reduces the expression of FASN in HER2-overexpressing cancer cells (Lin et al., 2010), it was found that in addition to the attenuation of RPS6 phosphorylation, osthole downregulated the protein expression of FASN in livers of the AKT/c-Met mice. Indeed, the AKT/FASN axis is indispensable for AKT-driven hepatocarcinogenesis (Li et al., 2016). Furthermore, with the exception of the positive regulation between AKT activation and FASN expression in AKT-triggered hepatocarcinogenesis and cell survival in ovarian cancer cells (Wang et al., 2005), several previous studies indicate that FASN inhibition contributes to deactivation of the PI3K/AKT pathway (Flavin et al., 2010). Thus, it would be important to further investigate whether osthole influences the AKT/FASN feedback loop and other
lipogenic enzymes in hepatocarcinogenesis while some suitable HCC mice models are established. It is important to note that osthole-induced stable disease in HCC mice is involved in ERK signaling modulation, the key factor in promoting cell proliferation, differentiation and survival (Ding et al., 2013; Schmitz et al., 2008), which indicates aggressive tumor behavior and serves as an independent prognostic factor in liver cancer (Schmitz et al., 2008). Further, concomitant activation of Janus kinase/Signal transducers and activators of transcription, PI3K/AKT, and ERK signaling is involved in leptin-mediated promotion of aberrant proliferation of HCC cells (Saxena et al., 2007). Consistent with results obtained in rat glioma cells suggesting that osthole exhibits anti-tumor property by repressing MAPK signaling pathway (Ding et al., 2013), our data show that osthole efficiently inhibited ERK phosphorylation in AKT/c-Met-driven HCC initiation. Importantly, activation of ERK signaling is associated with limited efficacy of inhibitors of the PI3K/AKT/mTOR pathway. Conversely, chemical resistance of these inhibitors can be alleviated with the application of specific MEK- and pan-RSK inhibitors (Martini et al., 2014). Hence, combined with the findings in vitro, the current study suggests that the AKT/FASN axis and ERK might be potential therapeutic targets of osthole for eliminating liver tumor burden in the AKT/c-Met mice. In addition, both the AKT and MAPK signaling transduction pathways regulate FASN expression through the modulation of sterol regulatory element-binding protein (SREBP-1c) expression, which binds to regulatory elements in the FASN promoter (Flavin et al., 2010). Clearly, additional
experiments are required to elucidate whether osthole inhibits HCC initiation and development by affecting transcriptional activity of SREBP-1c and/or other biochemical crosstalk between the AKT/RPS6/FASN and MAPK/ERK cascades. Taken together, our data suggest that osthole could effectively delay hepatocarcinogenesis by inhibiting hepatocellular proliferation, which is involved in the suppression of the AKT/FASN axis and ERK1/2 phosphorylation. These data provide in vitro and in vivo evidence that osthole could be potentially considered as an efficient agent for managing HCC. Furthermore, combined therapy of osthole with other drugs (e.g., low-toxic pan-mTOR inhibitors, FASN inhibitors and chemotherapeutic sensitizers) should be assessed to establish the availability of osthole for human HCC therapy. Conflict of interests The authors declare that they have no competing interests. Acknowledgements This study was supported by National Natural Science Foundation of China (No. 81602424) for Dr. Junjie Hu. We thank Dr. Xin Chen of UCSF for providing the materials of hydrodynamic transfection used in this work.
References Bruix, J., Qin, S., Merle, P., Granito, A., Huang, Y.H., Bodoky, G., Pracht, M., Yokosuka, O., Rosmorduc, O., Breder, V., Gerolami, R., Masi, G., Ross, P.J., Song, T., Bronowicki, J.P., Ollivier-Hourmand, I., Kudo, M., Cheng, A.L., Llovet, J.M., Finn, R.S., LeBerre, M.A., Baumhauer, A., Meinhardt, G., Han, G., Investigators, R., 2017. Regorafenib for patients with hepatocellular
carcinoma who progressed on sorafenib treatment (RESORCE): a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet 389, 56-66. Bruix, J., Reig, M., Sherman, M., 2016. Evidence-Based Diagnosis, Staging, and Treatment of Patients With Hepatocellular Carcinoma. Gastroenterology 150, 835-853. Bruix, J., Sherman, M., American Association for the Study of Liver, D., 2011. Management of hepatocellular carcinoma: an update. Hepatology 53, 1020-1022. Calvisi, D.F., Wang, C., Ho, C., Ladu, S., Lee, S.A., Mattu, S., Destefanis, G., Delogu, S., Zimmermann, A., Ericsson, J., Brozzetti, S., Staniscia, T., Chen, X., Dombrowski, F., Evert, M., 2011. Increased lipogenesis, induced by AKT-mTORC1-RPS6 signaling, promotes development of human hepatocellular carcinoma. Gastroenterology 140, 1071-1083. Chao, X., Zhou, X., Zheng, G., Dong, C., Zhang, W., Song, X., Jin, T., 2014. Osthole induces G2/M cell cycle arrest and apoptosis in human hepatocellular carcinoma HepG2 cells. Pharmaceutical biology 52, 544-550. Ding, D., Wei, S., Song, Y., Li, L., Du, G., Zhan, H., Cao, Y., 2013. Osthole exhibits anti-cancer property in rat glioma cells through inhibiting PI3K/Akt and MAPK signaling pathways. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 32, 1751-1760. Feng, H., Lu, J.J., Wang, Y., Pei, L., Chen, X., 2017. Osthole inhibited TGF beta-induced epithelial-mesenchymal transition (EMT) by suppressing NF-kappaB mediated Snail activation in lung cancer A549 cells. Cell adhesion & migration 11, 464-475. Flavin, R., Peluso, S., Nguyen, P.L., Loda, M., 2010. Fatty acid synthase as a potential therapeutic target in cancer. Future oncology 6, 551-562. Giordano, S., Columbano, A., 2014. Met as a therapeutic target in HCC: Facts and hopes. Journal of hepatology 60, 442-452. Hales, E.C., Taub, J.W., Matherly, L.H., 2014. New insights into Notch1 regulation of the PI3K–AKT–mTOR1 signaling axis: Targeted therapy of γ-secretase inhibitor resistant T-cell acute lymphoblastic leukemia. Cellular Signalling 26, 149-161. Hu, J., Che, L., Li, L., Pilo, M.G., Cigliano, A., Ribback, S., Li, X., Latte, G., Mela, M., Evert, M., Dombrowski, F., Zheng, G., Chen, X., Calvisi, D.F., 2016. Co-activation of AKT and c-Met triggers rapid hepatocellular carcinoma development via the mTORC1/FASN pathway in mice. Scientific reports 6, 20484. Huaman, J., Bach, C., Ilboudo, A., Ogunwobi, O.O., 2018. Epithelial-to-Mesenchymal Transition in Hepatocellular Carcinoma. Future Oncology 5, 1169. Huang, J., Deng, Q., Wang, Q., Li, K.Y., Dai, J.H., Li, N., Zhu, Z.D., Zhou, B., Liu, X.Y., Liu, R.F., 2016. Exome sequencing of hepatitis B virus–associated hepatocellular carcinoma. Nature Genetics 44, 1117-1121. Jelodarian, Z., Shokoohinia, Y., Rashidi, M., Ghiasvand, N., Hosseinzadeh, L., Iranshahi, M., 2017. New polyacetylenes from Echinophora cinerea (Boiss.) Hedge et Lamond. Natural product research 31, 2256-2263. Ladu, S., Calvisi, D.F., Conner, E.A., Farina, M., Factor, V.M., Thorgeirsson, S.S., 2008. E2F1 inhibits c-Myc-driven apoptosis via PIK3CA/Akt/mTOR and COX-2 in a mouse model of human liver cancer. Gastroenterology 135, 1322-1332. Li, L., Pilo, G.M., Li, X., Cigliano, A., Latte, G., Che, L., Joseph, C., Mela, M., Wang, C., Jiang, L., Ribback, S., Simile, M.M., Pascale, R.M., Dombrowski, F., Evert, M., Semenkovich, C.F., Chen, X.,
Calvisi, D.F., 2016. Inactivation of fatty acid synthase impairs hepatocarcinogenesis driven by AKT in mice and humans. Journal of hepatology 64, 333-341. Lin, V.C., Chou, C.H., Lin, Y.C., Lin, J.N., Yu, C.C., Tang, C.H., Lin, H.Y., Way, T.D., 2010. Osthole suppresses fatty acid synthase expression in HER2-overexpressing breast cancer cells through modulating Akt/mTOR pathway. Journal of agricultural and food chemistry 58, 4786-4793. Lin, Z.K., Liu, J., Jiang, G.Q., Tan, G., Gong, P., Luo, H.F., Li, H.M., Du, J., Ning, Z., Xin, Y., Wang, Z.Y., 2017. Osthole inhibits the tumorigenesis of hepatocellular carcinoma cells. Oncology reports 37, 1611-1618. Llovet, J.M., Virginia, H.G., 2014. Hepatocellular carcinoma: reasons for phase III failure and novel perspectives on trial design. Clinical Cancer Research An Official Journal of the American Association for Cancer Research 20, 2072. Martini, M., De Santis, M.C., Braccini, L., Gulluni, F., Hirsch, E., 2014. PI3K/AKT signaling pathway and cancer: an updated review. Annals of medicine 46, 372-383. Matter, M.S., Decaens, T., Andersen, J.B., Thorgeirsson, S.S., 2014. Targeting the mTOR pathway in hepatocellular carcinoma: current state and future trends. Journal of hepatology 60, 855-865. Michelotti, G.A., Machado, M.V., Diehl, A.M., 2013. NAFLD, NASH and liver cancer. Nature reviews. Gastroenterology & hepatology 10, 656-665. Qian, Z., Lui, V.W.Y., Winnie, Y., 2011. Targeting the PI3K/Akt/mTOR pathway in hepatocellular carcinoma. Future Oncology 7, 1149-1167. Qiao, Y., Xu, M., Tao, J., Che, L., Cigliano, A., Monga, S.P., Calvisi, D.F., Chen, X., 2018. Oncogenic potential of N-terminal deletion and S45Y mutant beta-catenin in promoting hepatocellular carcinoma development in mice. BMC cancer 18, 1093. Qiu, Z., Zhang, C., Zhou, J., Hu, J., Sheng, L., Li, X., Chen, L., Li, X., Deng, X., Zheng, G., 2019. Celecoxib alleviates AKT/c-Met-triggered rapid hepatocarcinogenesis by suppressing a novel COX-2/AKT/FASN cascade. Molecular carcinogenesis 58, 31-41. Saxena, N.K., Sharma, D., Ding, X., Lin, S., Marra, F., Merlin, D., Anania, F.A., 2007. Concomitant activation of the JAK/STAT, PI3K/AKT, and ERK signaling is involved in leptin-mediated promotion of invasion and migration of hepatocellular carcinoma cells. Cancer research 67, 2497-2507. Schmitz, K.J., Wohlschlaeger, J., Lang, H., Sotiropoulos, G.C., Malago, M., Steveling, K., Reis, H., Cicinnati, V.R., Schmid, K.W., Baba, H.A., 2008. Activation of the ERK and AKT signalling pathway predicts poor prognosis in hepatocellular carcinoma and ERK activation in cancer tissue is associated with hepatitis C virus infection. Journal of hepatology 48, 83-90. Wang, H.Q., Altomare, D.A., Skele, K.L., Poulikakos, P.I., Kuhajda, F.P., Di Cristofano, A., Testa, J.R., 2005. Positive feedback regulation between AKT activation and fatty acid synthase expression in ovarian carcinoma cells. Oncogene 24, 3574-3582. Wang, L., Yang, L., Lu, Y., Chen, Y., Liu, T., Peng, Y., Zhou, Y., Cao, Y., Bi, Z., Liu, T., Liu, Z., Shan, H., 2016. Osthole Induces Cell Cycle Arrest and Inhibits Migration and Invasion via PTEN/Akt Pathways in Osteosarcoma. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 38, 2173-2182. Wang, Y., Shen, Z., Zhu, Z., Han, R., Huai, M., 2011. Clinical values of AFP, GPC3 mRNA in peripheral blood for prediction of hepatocellular carcinoma recurrence following OLT: AFP, GPC3 mRNA for prediction of HCC. Hepatitis monthly 11, 195-199. Xu, X., Liu, X., Zhang, Y., 2018. Osthole inhibits gastric cancer cell proliferation through regulation of PI3K/AKT. PloS one 13, e0193449.
Xu, X., Zhang, Y., Qu, D., Jiang, T., Li, S., 2011. Osthole induces G2/M arrest and apoptosis in lung cancer A549 cells by modulating PI3K/Akt pathway. Journal of experimental & clinical cancer research : CR 30, 33. Zhang, L., Jiang, G., Yao, F., He, Y., Liang, G., Zhang, Y., Hu, B., Wu, Y., Li, Y., Liu, H., 2012. Growth inhibition and apoptosis induced by osthole, a natural coumarin, in hepatocellular carcinoma. PloS one 7, e37865. Zhang, L., Jiang, G., Yao, F., Liang, G., Wang, F., Xu, H., Wu, Y., Yu, X., Liu, H., 2015. Osthole promotes anti-tumor immune responses in tumor-bearing mice with hepatocellular carcinoma. Immunopharmacology and immunotoxicology 37, 301-307. Zhou, Q., Lui, V.W., Yeo, W., 2011. Targeting the PI3K/Akt/mTOR pathway in hepatocellular carcinoma. Future oncology 7, 1149-1167. Zhu, X., Song, X., Xie, K., Zhang, X., He, W., Liu, F., 2017. Osthole induces apoptosis and suppresses proliferation via the PI3K/Akt pathway in intrahepatic cholangiocarcinoma. International journal of molecular medicine 40, 1143-1151.
Figure legends Fig. 1. Osthole delays AKT/c-Met-triggered rapid hepatocarcinogenesis in mice. (A) Study design. (B) Gross images of AKT/c-Met mouse livers with osthole treatment (122 or 244 mg/kg) daily for three weeks. Liver weight (C), liver/body ratio (D) and body weight curve (E) of AKT/c-Met mice with osthole treatment. Data are expressed as the mean ± S.D.; n = 5/group. ##P < 0.01, ###P < 0.001 versus the WT group; *P < 0.05, **P < 0.01 versus the AKT/c-Met group. AKT/c-Met-Ost-L and AKT/c-Met-Ost-H represent intragastric administration of osthole at low (122 mg/kg) and high (244 mg/kg) doses, respectively. Fig. 2. H&E staining of AKT/c-Met mouse livers with osthole treatment daily for three weeks. Magnification: 100x; scale bar: 100 µm. AKT/c-Met-Ost-L and AKT/c-Met-Ost-H represent intragastric administration of osthole at low (122 mg/kg) and high (244 mg/kg) doses, respectively. Fig. 3. Osthole represses the mRNA expression of AFP and GPC3 in livers and reduces AFP levels in serum of AKT/c-Met mice. Histograms show AFP (A) and GPC3 (B) mRNA expression quantified by the qPCR assay. (C) AFP concentrations in serum of mice were quantitated using an ELISA assay. Data are expressed as the mean ± S.D.; n = 3. *P < 0.05, **P < 0.01, ***P < 0.001. AKT/c-Met-Ost-L and AKT/c-Met-Ost-H represent intragastric administration of osthole at low (122 mg/kg) and high (244 mg/kg) doses, respectively. Fig. 4. Osthole impairs the proliferative capacity and suppresses ERK1/2
phosphorylation in livers of AKT/c-Met mice. (A) Immunohistochemical pattern of PCNA and Ki-67 in the liver of the wild-type (WT) mice or AKT/c-Met HCC mice treated with osthole. Original magnification: 200x; scale bar: 50 µm. (B) Ki-67 positive cells from indicated liver tissues in (A) were counted and quantified as proliferation index. (C) Western blot analysis. The protein expression of PCNA and p-ERK1/2 was reduced in livers of osthole-treated AKT/c-Met mice. (D) Histograms indicate the relative expression levels of PCNA and p-ERK1/2 quantified using Western blot optical analysis. The housekeeping gene β-actin was used as an internal reference. Data are expressed as the mean ± S.D.; n = 3. #P < 0.05, ##P < 0.01 versus the WT group; *P < 0.05, **P < 0.01, ***P < 0.001 versus the AKT/c-Met group. AKT/c-Met-Ost-L and AKT/c-Met-Ost-H represent intragastric administration of osthole at low (122 mg/kg) and high (244 mg/kg) doses, respectively. t, total; p, phosphorylated. Fig. 5. Osthole suppresses the AKT/FASN axis and RPS6 phosphorylation in livers of AKT/c-Met mice. Three samples from each group were employed for a Western blot assay, and representative bands of the targeting proteins are shown in (A). (B) Histograms show the protein expression of p-AKT Thr308 (T308), p-AKT Ser473 (S473), t-AKT, p-RPS6 and FASN levels quantified by the Western blot optical analysis shown in (A). The housekeeping gene β-actin was applied as an internal reference. Quantitative data are the mean ± S.D. of the density values from the Western blot assay, n = 3. ###P < 0.001 versus the WT group; *P < 0.05, **P < 0.01, ***P < 0.001 versus the AKT/c-Met group. (C) FASN staining in livers from the
wild-type (WT) cohort and AKT/c-Met mice with either vehicle or osthole treatment. AKT/c-Met-Ost-L and AKT/c-Met-Ost-H represent intragastric administration of osthole at low (122 mg/kg) and high (244 mg/kg) doses, respectively. t, total; p, phosphorylated. Fig. 6. Osthole inhibits the AKT/FASN axis and the phosphorylation of RPS6 and ERK1/2 in human hepatoma cells in vitro. (A) SMMC-7721 were treated with osthole (60,120 and 180 µM) for 24 h. (C) For AKT/c-Met transient transfection, HepG2 cells were seeded in plates and cotransfected with AKT and c-Met constructs for 24 h as described in Methods. HepG2 cells were further treated by osthole (60, 120, 180 µM) for 24 h. The protein expression of p-AKT Thr308 (T308), p-AKT Ser473 (S473), t-AKT, p-RPS6 and FASN and p-ERK1/2 were evaluated using a Western blot assay. Histograms in (B) and (D) represent the intensity of the bands of immunoblotting in (A) and (C) quantitated by densitometry, respectively. The housekeeping gene β-actin was used as an internal reference. Quantitative data are the mean ± S.D. of the density values from the Western blot assay. n = 3.
#
P < 0.05, ##P < 0.01, ###P < 0.001 versus
the MOCK group; *P < 0.05, **P < 0.01, ***P < 0.001 versus the AKT/c-Met-transfected group in (D). t, total; p, phosphorylated.
S0014-2999(19)30740-X
DOI:
https://doi.org/10.1016/j.ejphar.2019.172788
Reference:
EJP 172788
To appear in:
European Journal of Pharmacology
Received Date: 6 May 2019 Revised Date:
2 November 2019
Accepted Date: 7 November 2019
Please cite this article as: Mo, Y., Wu, Y., Li, X., Rao, H., Tian, X., Wu, D., Qiu, Z., Zheng, G., Hu, J., Osthole delays hepatocarcinogenesis in mice by suppressing AKT/FASN axis and ERK phosphorylation, European Journal of Pharmacology (2019), doi: https://doi.org/10.1016/j.ejphar.2019.172788. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier B.V.
Osthole delays hepatocarcinogenesis in mice by suppressing AKT/FASN axis and ERK phosphorylation Yasi Moa#, Yong Wua#, Xin Lia, Hui Raoa, Xianxiang Tiana, Danni Wua, Zhenpeng Qiua, Guohua Zhengb* and Junjie Hua* a
College of Pharmacy, Hubei University of Chinese Medicine, Wuhan, People’s
Republic of China b
Key Laboratory of Chinese Medicine Resource and Compound Prescription,
Ministry of Education, Hubei University of Chinese Medicine, Wuhan, People’s Republic of China # Yasi Mo and Yong Wu contributed equally to this work. * Correspondence to: Dr Junjie Hu, College of Pharmacy, Hubei University of Chinese Medicine, No. 1, West Huangjiahu Road, Wuhan 430065, P.R. China, E-mail: [email protected]; Professor Guohua Zheng, Key Laboratory of Chinese Medicine Resource and Compound Prescription, Ministry of Education, Hubei University of Chinese Medicine, No. 1, West Huangjiahu Road, Wuhan 430065, P.R. China, E-mail: [email protected]. Financial support: This study was supported by National Natural Science Foundation of China (No. 81602424) for Dr. Junjie Hu.
Abstract Hepatocellular carcinoma (HCC) is one of the most common fatal malignancies worldwide. Inhibition of the lipogenic enzymes involved in hepatic de novo lipogenesis can both effectively restrain proliferation of HCC cells in vitro and reduce the risk of hepatocarcinogenesis in vivo. Although a natural coumarin derivative osthole shows efficacy in suppressing cell proliferation and inducing apoptosis in cultured hepatoma cells and HCC xenograft tumors, the molecular mechanism by which osthole delays hepatocellular malignant transformation during lipogenesis-driven hepatocarcinogenesis remains unknown. Here, we evaluate the efficacy of osthole in a rapid HCC mouse model featuring excessive levels of hepatic steatosis established via hydrodynamic transfection of activated forms of AKT and c-Met proto-oncogenes. Moreover, human hepatoma cell lines were employed for in vitro assessment. Hematoxylin and eosin staining, immunoblotting and immunohistochemistry were applied for mechanistic investigations. The results revealed that if osthole was administered in the early stage of AKT/c-Met-driven HCC, it led to disease stabilization. Moreover, osthole alleviated hepatic steatosis in the AKT/c-Met mice. Further evidence at the molecular level suggested that osthole reduced the expression of phosphor-extracellular signal-regulated kinase 1/2 (ERK1/2), proliferating cell nuclear antigen (PCNA) and Ki67 in livers of the AKT/c-Met mice. Mechanically, osthole efficiently repressed the phospho-AKT (Thr308) / ribosomal protein S6 (RPS6) / fatty acid synthase (FASN) signaling both in mice and in vitro. Altogether, this study suggests that osthole exerts its antilipogenic
and antiproliferative efficacy by suppressing the AKT/FASN axis and ERK phosphorylation, which contributes to its capacity to delay hepatocarcinogenesis. Key words: osthole; hepatocellular carcinoma; hepatocarcinogenesis; v-akt murine thymoma viral oncogene homolog; fatty acid synthase; extracellular signal-regulated kinase.
1. Introduction HCC is one of the most common malignant tumors worldwide and accounts for approximately 90 % of primary hepatic carcinoma, which has a poor prognosis and frequent relapse characteristics (Huaman et al., 2018; Huang et al., 2016). Due to the lack of effective therapeutic strategies for advanced HCC, patients initially diagnosed with the fatal disease in advanced stages typically die in 3-6 months (Bruix et al., 2016). Moreover, patients with HCC are commonly diagnosed at advanced stages, therefore excluding them from curative resection (Bruix et al., 2011). Clinical data also indicate that FDA-approved, first-line drugs for advanced HCC (e.g., sorafenib, regorafenib) can only prolong the survival of patients with this liver lethal burden by approximately 3 months (Bruix et al., 2017; Llovet and Virginia, 2014). Thus, the discovery of new small molecule drugs for the management of HCC is extremely urgent. Mounting evidence suggests that the activation of the v-akt murine thymoma viral oncogene homolog (AKT) and mitogen-activated protein kinase (MAPK) pathways indicates a poor prognosis of human hepatocellular carcinoma (HCC) (Calvisi et al., 2011; Ladu et al., 2008; Qian et al., 2011). In the AKT/mTOR pathway, activated AKT phosphorylates its major downstream effector mTOR complex 1 (mTORC1) (Hales et al., 2014) and subsequently activates 4-EBP1/eIF4E and p70S6K/ribosomal protein S6 (RPS6) signaling, which stimulates cap-dependent translation, aberrant cell metabolism and excessive proliferation (Matter et al., 2014; Zhou et al., 2011). Fatty acid synthase (FASN) is a multifunctional protein that modulates hepatic fatty acid
bio-synthesis and plays a central role in de novo lipogenesis in mammals. As such, the elevated FASN expression and concomitantly enhanced FASN activity correlate with increasing tumor burden and poor prognosis of a variety of human malignancies (Flavin et al., 2010). Moreover, the ligand hepatocyte growth factor binding to c-Met results in homodimerization and autophosphorylation of the c-Met receptor at its tyrosine residues and sequentially stimulates multiple oncogenic growth signaling pathways, including extracellular signal-regulated kinase (ERK) signaling (Giordano and Columbano, 2014). Hence, strategies targeting FASN activity and these pro-oncogenic pathways may be effective for delaying the development and progression of HCC. Osthole is a bioactive coumarin derivative isolated from the fruit of Cnidium monnieri (L.) (Jelodarian et al., 2017). Of note, osthole possesses efficacy against tumor cell growth and survival in various types of malignancies by modulating PTEN expression and suppressing PI3K/AKT, MAPK and NF-κB signaling pathways (Ding et al., 2013; Feng et al., 2017; Wang et al., 2016; Xu et al., 2018; Xu et al., 2011; Zhu et al., 2017). Although previous studies reported that osthole arrests cell-cycle progression and induces apoptosis in HCC cells (Chao et al., 2014; Lin et al., 2017; Zhang et al., 2012; Zhang et al., 2015), precise mechanisms by which the suppression of enhanced lipogenesis contributes to its efficacy in liver tumorigenesis remain unclear. This study provides evidence that osthole is effective in preventing lipogenesis-driven hepatocellular malignant transformation by suppressing the AKT/FASN axis and ERK phosphorylation.
2. Materials and methods 2.1. Constructs and reagents Osthole was purchased from Aladdin Chemistry Co., Ltd. (D1612130, purity, ≥ 99 %) and dissolved in corn oil and DMSO for administration to mice and in vitro experiments, respectively. The constructs used for mouse injection, including pT3-EF1α-HA-myr-AKT, pT3-EF1α-V5-c-Met and pCMV-sleeping beauty transposase (pCMV-SB), were gifts from Dr. Xin Chen of the University of California, San Francisco. All plasmids were purified utilizing the Endotoxin Free Maxi kit (Omega Biotek, Inc.; Doraville, GA, USA) before transfection. 2.2. Hydrodynamic transfection and osthole treatment Wild-type (WT) FVB/N mice were purchased from Charles River (Beijing, China). All the animal studies were conducted with female mice at 5-7 weeks old. Mice were group-housed in standard mouse cages and maintained under a 12 h light/dark cycle with free access to water and standard mouse chow. For establishing a rapid HCC model, hydrodynamic transfection was performed as previously described (Hu et al., 2016). Briefly, 20 µg of pT3-EF1a-HA-myr-AKT and 20 µg of pT3-EF1α-V5-c-Met along with 1.6 µg of pCMV-SB were diluted in 2 mL saline (0.9 % NaCl) solution and injected into the lateral tail vein of the FVB/N mice within 7 seconds (n = 6, each group). Before osthole treatment in the HCC mice, the WT mice was administered with osthole for 6 weeks. There was no definite pathological alteration in the two dosage groups after 6 weeks of osthole administration (Supplementary Fig. 1).
Osthole (low dose, 122 mg/kg/day; high dose, 244 mg/kg/day) or vehicle was intraperitoneally injected daily as previously described (Zhang et al., 2012; Zhang et al., 2015) for three weeks starting 3 weeks after hydrodynamic injection. The Animal Ethics Committees of the Hubei University of Chinese Medicine approved all of the experimental protocols (Approval No: HUCMS2018003) in accordance with the Principles of Laboratory Animal Care and Use in Research (Ministry of Health, Beijing, China). At six weeks post hydrodynamic injection, after pentobarbital anesthesia, blood samples were taken from the tail vein and centrifuged at 1000 g for 10 min at 4 °C; the supernatant was preserved at -80 °C for ELISA. All the animals were killed by cervical dislocation and dissected. The experiments were designed in compliance with the Guidelines laid down by the NIH in the US regarding the care and use of animals for experimental procedures. 2.3. Hematoxylin and eosin (H&E) staining, immunohistochemistry (IHC), and ELISA Liver specimens were fixed in 4 % paraformaldehyde and embedded in paraffin. For H&E staining, liver tissue sections were dewaxed in xylene and rehydrated using ethanol with decreasing concentrations. The sections were then stained with hematoxylin and eosin to visualize the histological features of the liver samples. For immunohistochemistry, deparaffinized sections were incubated in 3 % H2O2 dissolved in 1x phosphate-buffered saline (PBS) for 30 min to quench the endogenous peroxidase. For antigen retrieval, slides were microwaved in 10 mM citrate buffer (pH
6.0) for 15 min. Subsequently, slides were incubated with the anti-PCNA, anti-Ki67 and anti-FASN antibodies (CST, Danvers, MA, USA) overnight at 4 °C. After incubation with the appropriate biotin-conjugated secondary antibody and subsequently with streptavidin solution, color development was performed using Vector Nova RED™ (Vector Laboratories) as a chromogen. Sections were counterstained using Gill-2 hematoxylin (Thermo-Shandon, Pittsburgh, PA, USA). Serum α-fetoprotein (AFP) was assessed using Mouse α-Fetoprotein/AFP Quantikine ELISA Kit (MAFP00, R&D Systems, USA) according to the manufacturer's instructions. 2.4. Western blotting Frozen mouse liver specimens were homogenized in mammalian protein extraction reagent (Thermo Scientific, Waltham, MA, USA) containing Cocktail Protease Inhibitors (Roche, Indianapolis, IN, USA). Protein concentrations were determined with a BCA protein determination assay. The lysates were denatured 5 min at 95 °C in Tris-glycine SDS loading buffer, separated by SDS-PAGE, and then blotted to polyvinylidene fluoride membranes. Membranes were blocked in 5 % nonfat dry milk in Tris-buffered saline containing 0.1 % Tween 20 for 1 h and probed with specific antibodies. The following primary antibodies (CST, Danvers, MA, USA) were used: total AKT (t-AKT), phosphor-AKT (Thr308), phosphor-AKT (Ser473), total ERK (t-ERK), phospho-p44/42MAPK (ERK1/2) (Thr202/Tyr204), ribosomal protein S6 (RPS6), phosphor-RPS6 (Ser240/244), and FASN. Each protein linked with primary
antibody was further incubated with horseradish peroxidase-secondary antibody for 1 h at 25 °C. The HRP-conjugated β-actin antibody (Proteintech, Wuhan, China) served as an internal standard for normalization. 2.5. Quantitative polymerase chain reaction (qPCR) The total cellular RNA in the liver samples was extracted and isolated using TRIzol® Reagent (Invitrogen, USA). PCRs were performed with 1 µg of cDNA of the collected samples using Rever Tra Ace (TOYOBO, Japan) with Oligo (dT) 18 at 37 °C for 60 min. The thermal cycling condition for PCR was denaturation at 95 °C for 2 min, 40 cycles at 95 °C for 5 s and 55 °C for 25 s. Quantitative values were expressed as N target (NT). NT = 2-∆Ct, where in the ∆Ct value of each sample was calculated by subtracting the average Ct value of the target gene from the average Ct value of the 18s rRNA gene. The previously validated primers (Qiao et al., 2018) for PCR were as follows: AFP forward, 5'-TCTGCTGGCACGCAAGAAG-3' and reverse, 5'-TCGGCAGGTTCTGGAAACTG-3'; GPC-3 forward, 5'-CAGCCCGGACTCAAATGGG-3' and reverse, 5'-CAGCCGTGCTGTTAGTTGGTA-3'; 18s rRNA forward, 5'- CGGCTACCACATCCAAGGAA -3' and reverse, 5'- GCTGGAATTACCGCGGCT -3'. 2.6. Cell culture and treatment HepG2 and SMMC-7721 human hepatoma cell lines were maintained as monolayer cultures in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10 %
fetal bovine serum and 1% penicillin/streptomycin at 37 °C in a humidified 5 % CO2 atmosphere. For cell viability assay, cells were plated at a density of 5000 cells per well. After 48 h of osthole treatment (0-200 µM), cell viability was determined using a CCK-8 cell viability assay kit (Dojindo Laboratories, Kumamoto, Japan). For transient transfection studies, cells were cultured in 6-well plates and co-transfected with pT3-EF1α-HA-myr-AKT and pT3-EF1α-V5-c-Met constructs using Lipofectamine™ 2000 according to the manufacturer's protocol (Invitrogen, Carlsbad, CA, USA) for 24 h. The hepatoma cells in the presence or absence of exogenous co-expression of AKT and c-Met were further administered with osthole for 48 h and harvested for further assessment. 2.7. Statistical analysis Data analysis was performed with Prism 6 (Graph Pad, USA). All data represent at least three independent experimental results and are shown as the mean ± S.D.. Statistical evaluations were performed by one-way analysis of variance. Comparisons between two groups were performed with two-tailed unpaired t-test. A significant difference was considered as P < 0.05. 3. Results 3.1. Osthole delays AKT/c-Met-triggered rapid hepatocarcinogenesis in mice Mice with hepatic co-activation of AKT and c-Met proto-oncogenes destined to develop hepatocellular carcinoma within 6 weeks (Hu et al., 2016). Using this rapid HCC mouse model, we investigated the efficacy of osthole in preventing
AKT/c-Met-induced HCC development (Fig. 1A). The results showed that liver tumor burden was significantly lower in the osthole-treated mice than that in the AKT/c-Met group, as exhibited by gross evidence (Fig. 1B). Moreover, liver weight (Fig. 1C) and liver/body ratio (Fig. 1D) in the AKT/c-Met mice were reversed by osthole treatment. Meanwhile, the osthole-treated cohorts displayed a significant reduction in body weight than AKT/c-Met controls (Fig. 1E), possibly due to the restrain of hepatomegaly in the osthole-treated mice. Furthermore, in the AKT/c-Met-L group, osthole (122 mg/kg) had a limited influence on neoplastic lesions as indicated by H&E staining. Of note, osthole (244 mg/kg) ameliorated hepatic steatosis and nearly eliminated hepatocellular tumors in the AKT/c-Met mice (Fig. 2). In addition, the mRNA levels of AFP and Glypican-3 (GPC-3), the most common diagnostic and prognostic markers for HCC (Wang et al., 2011), was reduced in livers of the osthole-administered AKT/c-Met mice (Fig. 3A and B). Consistently, the serum level of AFP was suppressed after osthole treatment in the AKT/c-Met HCC mice (Fig. 3C). Thus, these results suggest that osthole results in a stable disease state in the AKT/c-Met HCC mice when administered in the early stage (3 weeks post-AKT/c-Met injection) of liver tumorigenesis. 3.2. Osthole suppresses cell proliferation in livers of AKT/c-Met mice by restraining ERK activation To further investigate whether the suppression of aberrant cell proliferation contributes to the efficacy of osthole in the AKT/c-Met HCC mice, immunohistochemical and Western blot assays were performed to assess its effect on
PCNA protein expression. As expected, the AKT/c-Met mice treated with osthole displayed a significant decrease in the hepatic protein expression of PCNA (Fig. 4A, C and D). Consistently, highly proliferative tumor cells were nearly eliminated upon osthole treatment, as shown by Ki-67 staining (Fig. 4A), with a significant decrease of proliferation index from vehicle-administered tumor tissues (Fig. 4B). Furthermore, the phosphorylation of ERK1/2 in livers of the AKT/c-Met mice was also suppressed by osthole treatment (Fig. 4C and D), suggesting that the deactivation of the ERK/MAPK pathway emerges during osthole-induced impairment of the proliferative capacity. Together, our data indicate that osthole may inhibit hepatocellular proliferation that contributes to the development of AKT/c-Met-driven HCC by suppressing ERK phosphorylation. 3.3. Osthole represses the AKT/FASN axis in livers of AKT/c-Met mice Next, we evaluated the protein expression of major factors facilitating lipogenesis and malignant transformation in the AKT/c-Met HCC mice. We found that osthole restrained AKT phosphorylation at regulatory residues Thr-308 (T308) and Ser-473 (S473) (Fig. 5A and B). Moreover, downregulation of activated/phosphorylated ribosomal protein S6 (RPS6), a key component of lipogenesis and carcinogenesis improving the efficiency of global protein synthesis, was observed in osthole-treated AKT/c-Met mice (Fig. 5A and B). Consistent with levels of steatosis and degrees of tumorigenesis observed during H&E staining, Western blot and immunohistochemical (IHC) assays revealed that osthole significantly weakened the protein expression of FASN relative to the AKT/c-Met group (Fig. 5A, B and C). Therefore, these data
suggest that osthole retards hepatocellular hyperproliferation in the AKT/c-Met mice probably by regulating the AKT/FASN signaling. 3.4. Osthole inhibits the AKT/RPS6/FASN pathway and phosphorylation of ERK1/2 in vitro Next, to confirm the effects of osthole on the AKT/FASN axis and ERK phosphorylation in the development of HCC, we investigated whether osthole could modulate the protein expression levels of phospho-AKT(Thr308), phospho-AKT(Ser473), phospho-RPS6, FASN and phospho-ERK1/2 in SMCC-7721 or AKT-transfected HepG2 cells due to the distinct expression levels of activated AKT in these two types of hepatoma cell lines (Qiu et al., 2019). To achieve this goal, the cytotoxic potential of osthole (0-200 µM) in hepatoma cells was first confirmed (Supplementary Fig. 2). Then, SMMC-7721 cells (activated AKT highly expressed) were incubated with osthole (60-180 µM) for 24 h. Of note, the protein expression of the above targets was downregulated by osthole treatment in a dose-dependent manner in SMMC-7721 cells (Fig. 6A and B). Moreover, the effect of osthole on these factors was further validated in AKT/c-Met-transfected hepatoma cells. To do so, HepG2 cells (relatively low phosphor-Akt protein expression) were transiently cotransfected with pT3-EF1α-HA-myr-AKT and pT3-EF1α-V5-c-Met overexpressing constructs and further incubated in the presence or absence of osthole for 24 h. In accordance with in vivo data and the findings in SMMC-7721 cells, osthole treatment suppressed the AKT/FASN axis and phosphorylation of RPS6 and ERK1/2 in AKT/c-Met-transfected hepatoma cells (Fig. 6C and D). Overall, our data suggest
that osthole obstructs hepatocarcinogenesis, mainly due to the inhibition of the signaling transduction manipulating de novo lipogenesis and cellular proliferation. 4. Discussion Mounting evidence suggests that osthole is capable of suppressing increased aggressiveness in various types of human cancer cells (Wang et al., 2016; Xu et al., 2018; Xu et al., 2011; Zhu et al., 2017), including HCC (Zhang et al., 2012; Zhang et al., 2015). However, to date, the effectiveness was only observed in cultured hepatoma cell lines or HCC tumor-bearing mice; therefore, no study has been conducted to investigate the efficacy of osthole on the malignant transformation of hepatocytes during hepatocarcinogenesis. Here, we investigated whether osthole could inhibit malignant transformation of hepatocytes using a novel preclinical HCC mouse model featuring increased lipogenesis. Of note, the present work indicates that osthole delays hepatocarcinogenesis by targeting the AKT/FASN axis and ERK phosphorylation. Hepatic metabolic reprogramming, including aerobic glycolysis, excessive lipogenesis and glutamine metabolism, is considered a liver cancer hallmark. In particular, elevated de novo lipogenesis is an essential feature of hepatocellular malignant transformation and HCC progression (Calvisi et al., 2011). Epidemiological studies have suggested that metabolic syndrome and non-alcoholic fatty liver disease (NAFLD) are key risk factors for HCC (Michelotti et al., 2013), thereby bridging dysfunctional fatty acid bio-synthesis to hepatocarcinogenesis. Dysregulation of the PI3K/AKT/mTOR signaling pathway is forcefully implicated in liver cancer
pathogenesis due to its functioning in cell proliferation, invasion, metastasis, and lipid metabolic reprogramming (Martini et al., 2014). Hence, targeting the key modulators of this oncogenic pathway might be a useful therapeutic approach for HCC. Notably, for the first time, the present evidence demonstrated that the elevated phosphorylation level of AKT at both Thr308 and Ser473 residues was suppressed by osthole treatment during hepatocarcinogenesis in mice. Moreover, osthole alleviated the excessive hepatic steatosis, which results from AKT-induced strengthened expression of lipogenic enzymes (e.g., acetyl-CoA carboxylase (ACAC), stearoyl-CoA desaturase 1 (SCD1) and FASN) in mice (Hu et al., 2016). FASN, the key metabolic enzyme responsible for the terminal catalytic step in de novo lipogenesis, is highly expressed in many cancers (Flavin et al., 2010). In partial accordance with the literature showing that osthole represses the activation of the AKT/mTOR signaling, which subsequently reduces the expression of FASN in HER2-overexpressing cancer cells (Lin et al., 2010), it was found that in addition to the attenuation of RPS6 phosphorylation, osthole downregulated the protein expression of FASN in livers of the AKT/c-Met mice. Indeed, the AKT/FASN axis is indispensable for AKT-driven hepatocarcinogenesis (Li et al., 2016). Furthermore, with the exception of the positive regulation between AKT activation and FASN expression in AKT-triggered hepatocarcinogenesis and cell survival in ovarian cancer cells (Wang et al., 2005), several previous studies indicate that FASN inhibition contributes to deactivation of the PI3K/AKT pathway (Flavin et al., 2010). Thus, it would be important to further investigate whether osthole influences the AKT/FASN feedback loop and other
lipogenic enzymes in hepatocarcinogenesis while some suitable HCC mice models are established. It is important to note that osthole-induced stable disease in HCC mice is involved in ERK signaling modulation, the key factor in promoting cell proliferation, differentiation and survival (Ding et al., 2013; Schmitz et al., 2008), which indicates aggressive tumor behavior and serves as an independent prognostic factor in liver cancer (Schmitz et al., 2008). Further, concomitant activation of Janus kinase/Signal transducers and activators of transcription, PI3K/AKT, and ERK signaling is involved in leptin-mediated promotion of aberrant proliferation of HCC cells (Saxena et al., 2007). Consistent with results obtained in rat glioma cells suggesting that osthole exhibits anti-tumor property by repressing MAPK signaling pathway (Ding et al., 2013), our data show that osthole efficiently inhibited ERK phosphorylation in AKT/c-Met-driven HCC initiation. Importantly, activation of ERK signaling is associated with limited efficacy of inhibitors of the PI3K/AKT/mTOR pathway. Conversely, chemical resistance of these inhibitors can be alleviated with the application of specific MEK- and pan-RSK inhibitors (Martini et al., 2014). Hence, combined with the findings in vitro, the current study suggests that the AKT/FASN axis and ERK might be potential therapeutic targets of osthole for eliminating liver tumor burden in the AKT/c-Met mice. In addition, both the AKT and MAPK signaling transduction pathways regulate FASN expression through the modulation of sterol regulatory element-binding protein (SREBP-1c) expression, which binds to regulatory elements in the FASN promoter (Flavin et al., 2010). Clearly, additional
experiments are required to elucidate whether osthole inhibits HCC initiation and development by affecting transcriptional activity of SREBP-1c and/or other biochemical crosstalk between the AKT/RPS6/FASN and MAPK/ERK cascades. Taken together, our data suggest that osthole could effectively delay hepatocarcinogenesis by inhibiting hepatocellular proliferation, which is involved in the suppression of the AKT/FASN axis and ERK1/2 phosphorylation. These data provide in vitro and in vivo evidence that osthole could be potentially considered as an efficient agent for managing HCC. Furthermore, combined therapy of osthole with other drugs (e.g., low-toxic pan-mTOR inhibitors, FASN inhibitors and chemotherapeutic sensitizers) should be assessed to establish the availability of osthole for human HCC therapy. Conflict of interests The authors declare that they have no competing interests. Acknowledgements This study was supported by National Natural Science Foundation of China (No. 81602424) for Dr. Junjie Hu. We thank Dr. Xin Chen of UCSF for providing the materials of hydrodynamic transfection used in this work.
References Bruix, J., Qin, S., Merle, P., Granito, A., Huang, Y.H., Bodoky, G., Pracht, M., Yokosuka, O., Rosmorduc, O., Breder, V., Gerolami, R., Masi, G., Ross, P.J., Song, T., Bronowicki, J.P., Ollivier-Hourmand, I., Kudo, M., Cheng, A.L., Llovet, J.M., Finn, R.S., LeBerre, M.A., Baumhauer, A., Meinhardt, G., Han, G., Investigators, R., 2017. Regorafenib for patients with hepatocellular
carcinoma who progressed on sorafenib treatment (RESORCE): a randomised, double-blind, placebo-controlled, phase 3 trial. Lancet 389, 56-66. Bruix, J., Reig, M., Sherman, M., 2016. Evidence-Based Diagnosis, Staging, and Treatment of Patients With Hepatocellular Carcinoma. Gastroenterology 150, 835-853. Bruix, J., Sherman, M., American Association for the Study of Liver, D., 2011. Management of hepatocellular carcinoma: an update. Hepatology 53, 1020-1022. Calvisi, D.F., Wang, C., Ho, C., Ladu, S., Lee, S.A., Mattu, S., Destefanis, G., Delogu, S., Zimmermann, A., Ericsson, J., Brozzetti, S., Staniscia, T., Chen, X., Dombrowski, F., Evert, M., 2011. Increased lipogenesis, induced by AKT-mTORC1-RPS6 signaling, promotes development of human hepatocellular carcinoma. Gastroenterology 140, 1071-1083. Chao, X., Zhou, X., Zheng, G., Dong, C., Zhang, W., Song, X., Jin, T., 2014. Osthole induces G2/M cell cycle arrest and apoptosis in human hepatocellular carcinoma HepG2 cells. Pharmaceutical biology 52, 544-550. Ding, D., Wei, S., Song, Y., Li, L., Du, G., Zhan, H., Cao, Y., 2013. Osthole exhibits anti-cancer property in rat glioma cells through inhibiting PI3K/Akt and MAPK signaling pathways. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 32, 1751-1760. Feng, H., Lu, J.J., Wang, Y., Pei, L., Chen, X., 2017. Osthole inhibited TGF beta-induced epithelial-mesenchymal transition (EMT) by suppressing NF-kappaB mediated Snail activation in lung cancer A549 cells. Cell adhesion & migration 11, 464-475. Flavin, R., Peluso, S., Nguyen, P.L., Loda, M., 2010. Fatty acid synthase as a potential therapeutic target in cancer. Future oncology 6, 551-562. Giordano, S., Columbano, A., 2014. Met as a therapeutic target in HCC: Facts and hopes. Journal of hepatology 60, 442-452. Hales, E.C., Taub, J.W., Matherly, L.H., 2014. New insights into Notch1 regulation of the PI3K–AKT–mTOR1 signaling axis: Targeted therapy of γ-secretase inhibitor resistant T-cell acute lymphoblastic leukemia. Cellular Signalling 26, 149-161. Hu, J., Che, L., Li, L., Pilo, M.G., Cigliano, A., Ribback, S., Li, X., Latte, G., Mela, M., Evert, M., Dombrowski, F., Zheng, G., Chen, X., Calvisi, D.F., 2016. Co-activation of AKT and c-Met triggers rapid hepatocellular carcinoma development via the mTORC1/FASN pathway in mice. Scientific reports 6, 20484. Huaman, J., Bach, C., Ilboudo, A., Ogunwobi, O.O., 2018. Epithelial-to-Mesenchymal Transition in Hepatocellular Carcinoma. Future Oncology 5, 1169. Huang, J., Deng, Q., Wang, Q., Li, K.Y., Dai, J.H., Li, N., Zhu, Z.D., Zhou, B., Liu, X.Y., Liu, R.F., 2016. Exome sequencing of hepatitis B virus–associated hepatocellular carcinoma. Nature Genetics 44, 1117-1121. Jelodarian, Z., Shokoohinia, Y., Rashidi, M., Ghiasvand, N., Hosseinzadeh, L., Iranshahi, M., 2017. New polyacetylenes from Echinophora cinerea (Boiss.) Hedge et Lamond. Natural product research 31, 2256-2263. Ladu, S., Calvisi, D.F., Conner, E.A., Farina, M., Factor, V.M., Thorgeirsson, S.S., 2008. E2F1 inhibits c-Myc-driven apoptosis via PIK3CA/Akt/mTOR and COX-2 in a mouse model of human liver cancer. Gastroenterology 135, 1322-1332. Li, L., Pilo, G.M., Li, X., Cigliano, A., Latte, G., Che, L., Joseph, C., Mela, M., Wang, C., Jiang, L., Ribback, S., Simile, M.M., Pascale, R.M., Dombrowski, F., Evert, M., Semenkovich, C.F., Chen, X.,
Calvisi, D.F., 2016. Inactivation of fatty acid synthase impairs hepatocarcinogenesis driven by AKT in mice and humans. Journal of hepatology 64, 333-341. Lin, V.C., Chou, C.H., Lin, Y.C., Lin, J.N., Yu, C.C., Tang, C.H., Lin, H.Y., Way, T.D., 2010. Osthole suppresses fatty acid synthase expression in HER2-overexpressing breast cancer cells through modulating Akt/mTOR pathway. Journal of agricultural and food chemistry 58, 4786-4793. Lin, Z.K., Liu, J., Jiang, G.Q., Tan, G., Gong, P., Luo, H.F., Li, H.M., Du, J., Ning, Z., Xin, Y., Wang, Z.Y., 2017. Osthole inhibits the tumorigenesis of hepatocellular carcinoma cells. Oncology reports 37, 1611-1618. Llovet, J.M., Virginia, H.G., 2014. Hepatocellular carcinoma: reasons for phase III failure and novel perspectives on trial design. Clinical Cancer Research An Official Journal of the American Association for Cancer Research 20, 2072. Martini, M., De Santis, M.C., Braccini, L., Gulluni, F., Hirsch, E., 2014. PI3K/AKT signaling pathway and cancer: an updated review. Annals of medicine 46, 372-383. Matter, M.S., Decaens, T., Andersen, J.B., Thorgeirsson, S.S., 2014. Targeting the mTOR pathway in hepatocellular carcinoma: current state and future trends. Journal of hepatology 60, 855-865. Michelotti, G.A., Machado, M.V., Diehl, A.M., 2013. NAFLD, NASH and liver cancer. Nature reviews. Gastroenterology & hepatology 10, 656-665. Qian, Z., Lui, V.W.Y., Winnie, Y., 2011. Targeting the PI3K/Akt/mTOR pathway in hepatocellular carcinoma. Future Oncology 7, 1149-1167. Qiao, Y., Xu, M., Tao, J., Che, L., Cigliano, A., Monga, S.P., Calvisi, D.F., Chen, X., 2018. Oncogenic potential of N-terminal deletion and S45Y mutant beta-catenin in promoting hepatocellular carcinoma development in mice. BMC cancer 18, 1093. Qiu, Z., Zhang, C., Zhou, J., Hu, J., Sheng, L., Li, X., Chen, L., Li, X., Deng, X., Zheng, G., 2019. Celecoxib alleviates AKT/c-Met-triggered rapid hepatocarcinogenesis by suppressing a novel COX-2/AKT/FASN cascade. Molecular carcinogenesis 58, 31-41. Saxena, N.K., Sharma, D., Ding, X., Lin, S., Marra, F., Merlin, D., Anania, F.A., 2007. Concomitant activation of the JAK/STAT, PI3K/AKT, and ERK signaling is involved in leptin-mediated promotion of invasion and migration of hepatocellular carcinoma cells. Cancer research 67, 2497-2507. Schmitz, K.J., Wohlschlaeger, J., Lang, H., Sotiropoulos, G.C., Malago, M., Steveling, K., Reis, H., Cicinnati, V.R., Schmid, K.W., Baba, H.A., 2008. Activation of the ERK and AKT signalling pathway predicts poor prognosis in hepatocellular carcinoma and ERK activation in cancer tissue is associated with hepatitis C virus infection. Journal of hepatology 48, 83-90. Wang, H.Q., Altomare, D.A., Skele, K.L., Poulikakos, P.I., Kuhajda, F.P., Di Cristofano, A., Testa, J.R., 2005. Positive feedback regulation between AKT activation and fatty acid synthase expression in ovarian carcinoma cells. Oncogene 24, 3574-3582. Wang, L., Yang, L., Lu, Y., Chen, Y., Liu, T., Peng, Y., Zhou, Y., Cao, Y., Bi, Z., Liu, T., Liu, Z., Shan, H., 2016. Osthole Induces Cell Cycle Arrest and Inhibits Migration and Invasion via PTEN/Akt Pathways in Osteosarcoma. Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology 38, 2173-2182. Wang, Y., Shen, Z., Zhu, Z., Han, R., Huai, M., 2011. Clinical values of AFP, GPC3 mRNA in peripheral blood for prediction of hepatocellular carcinoma recurrence following OLT: AFP, GPC3 mRNA for prediction of HCC. Hepatitis monthly 11, 195-199. Xu, X., Liu, X., Zhang, Y., 2018. Osthole inhibits gastric cancer cell proliferation through regulation of PI3K/AKT. PloS one 13, e0193449.
Xu, X., Zhang, Y., Qu, D., Jiang, T., Li, S., 2011. Osthole induces G2/M arrest and apoptosis in lung cancer A549 cells by modulating PI3K/Akt pathway. Journal of experimental & clinical cancer research : CR 30, 33. Zhang, L., Jiang, G., Yao, F., He, Y., Liang, G., Zhang, Y., Hu, B., Wu, Y., Li, Y., Liu, H., 2012. Growth inhibition and apoptosis induced by osthole, a natural coumarin, in hepatocellular carcinoma. PloS one 7, e37865. Zhang, L., Jiang, G., Yao, F., Liang, G., Wang, F., Xu, H., Wu, Y., Yu, X., Liu, H., 2015. Osthole promotes anti-tumor immune responses in tumor-bearing mice with hepatocellular carcinoma. Immunopharmacology and immunotoxicology 37, 301-307. Zhou, Q., Lui, V.W., Yeo, W., 2011. Targeting the PI3K/Akt/mTOR pathway in hepatocellular carcinoma. Future oncology 7, 1149-1167. Zhu, X., Song, X., Xie, K., Zhang, X., He, W., Liu, F., 2017. Osthole induces apoptosis and suppresses proliferation via the PI3K/Akt pathway in intrahepatic cholangiocarcinoma. International journal of molecular medicine 40, 1143-1151.
Figure legends Fig. 1. Osthole delays AKT/c-Met-triggered rapid hepatocarcinogenesis in mice. (A) Study design. (B) Gross images of AKT/c-Met mouse livers with osthole treatment (122 or 244 mg/kg) daily for three weeks. Liver weight (C), liver/body ratio (D) and body weight curve (E) of AKT/c-Met mice with osthole treatment. Data are expressed as the mean ± S.D.; n = 5/group. ##P < 0.01, ###P < 0.001 versus the WT group; *P < 0.05, **P < 0.01 versus the AKT/c-Met group. AKT/c-Met-Ost-L and AKT/c-Met-Ost-H represent intragastric administration of osthole at low (122 mg/kg) and high (244 mg/kg) doses, respectively. Fig. 2. H&E staining of AKT/c-Met mouse livers with osthole treatment daily for three weeks. Magnification: 100x; scale bar: 100 µm. AKT/c-Met-Ost-L and AKT/c-Met-Ost-H represent intragastric administration of osthole at low (122 mg/kg) and high (244 mg/kg) doses, respectively. Fig. 3. Osthole represses the mRNA expression of AFP and GPC3 in livers and reduces AFP levels in serum of AKT/c-Met mice. Histograms show AFP (A) and GPC3 (B) mRNA expression quantified by the qPCR assay. (C) AFP concentrations in serum of mice were quantitated using an ELISA assay. Data are expressed as the mean ± S.D.; n = 3. *P < 0.05, **P < 0.01, ***P < 0.001. AKT/c-Met-Ost-L and AKT/c-Met-Ost-H represent intragastric administration of osthole at low (122 mg/kg) and high (244 mg/kg) doses, respectively. Fig. 4. Osthole impairs the proliferative capacity and suppresses ERK1/2
phosphorylation in livers of AKT/c-Met mice. (A) Immunohistochemical pattern of PCNA and Ki-67 in the liver of the wild-type (WT) mice or AKT/c-Met HCC mice treated with osthole. Original magnification: 200x; scale bar: 50 µm. (B) Ki-67 positive cells from indicated liver tissues in (A) were counted and quantified as proliferation index. (C) Western blot analysis. The protein expression of PCNA and p-ERK1/2 was reduced in livers of osthole-treated AKT/c-Met mice. (D) Histograms indicate the relative expression levels of PCNA and p-ERK1/2 quantified using Western blot optical analysis. The housekeeping gene β-actin was used as an internal reference. Data are expressed as the mean ± S.D.; n = 3. #P < 0.05, ##P < 0.01 versus the WT group; *P < 0.05, **P < 0.01, ***P < 0.001 versus the AKT/c-Met group. AKT/c-Met-Ost-L and AKT/c-Met-Ost-H represent intragastric administration of osthole at low (122 mg/kg) and high (244 mg/kg) doses, respectively. t, total; p, phosphorylated. Fig. 5. Osthole suppresses the AKT/FASN axis and RPS6 phosphorylation in livers of AKT/c-Met mice. Three samples from each group were employed for a Western blot assay, and representative bands of the targeting proteins are shown in (A). (B) Histograms show the protein expression of p-AKT Thr308 (T308), p-AKT Ser473 (S473), t-AKT, p-RPS6 and FASN levels quantified by the Western blot optical analysis shown in (A). The housekeeping gene β-actin was applied as an internal reference. Quantitative data are the mean ± S.D. of the density values from the Western blot assay, n = 3. ###P < 0.001 versus the WT group; *P < 0.05, **P < 0.01, ***P < 0.001 versus the AKT/c-Met group. (C) FASN staining in livers from the
wild-type (WT) cohort and AKT/c-Met mice with either vehicle or osthole treatment. AKT/c-Met-Ost-L and AKT/c-Met-Ost-H represent intragastric administration of osthole at low (122 mg/kg) and high (244 mg/kg) doses, respectively. t, total; p, phosphorylated. Fig. 6. Osthole inhibits the AKT/FASN axis and the phosphorylation of RPS6 and ERK1/2 in human hepatoma cells in vitro. (A) SMMC-7721 were treated with osthole (60,120 and 180 µM) for 24 h. (C) For AKT/c-Met transient transfection, HepG2 cells were seeded in plates and cotransfected with AKT and c-Met constructs for 24 h as described in Methods. HepG2 cells were further treated by osthole (60, 120, 180 µM) for 24 h. The protein expression of p-AKT Thr308 (T308), p-AKT Ser473 (S473), t-AKT, p-RPS6 and FASN and p-ERK1/2 were evaluated using a Western blot assay. Histograms in (B) and (D) represent the intensity of the bands of immunoblotting in (A) and (C) quantitated by densitometry, respectively. The housekeeping gene β-actin was used as an internal reference. Quantitative data are the mean ± S.D. of the density values from the Western blot assay. n = 3.
#
P < 0.05, ##P < 0.01, ###P < 0.001 versus
the MOCK group; *P < 0.05, **P < 0.01, ***P < 0.001 versus the AKT/c-Met-transfected group in (D). t, total; p, phosphorylated.