- Email: [email protected]
Overexpressed human heme Oxygenase-1 decreases adipogenesis in pigs and porcine adipose-derived stem cells
Biochemical and Biophysical Research Communications 467 (2015) 935e940
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Overexpressed human heme Oxygenase-1 decreases adipogenesis in pigs and porcine adipose-derived stem cells Eun Jung Park a, 1, Ok Jae Koo b, 1, Byeong Chun Lee a, * a
Department of Theriogenology and Biotechnology, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul 08826, Republic of Korea b Samsung Biomedical Research Institute, SAIT, SEC, Suwon 16419, Republic of Korea
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 September 2015 Accepted 8 October 2015 Available online 19 October 2015
Adipose-derived mesenchymal stem cells (ADSC) are multipotent, which means they are able to differentiate into several lineages in vivo and in vitro under proper conditions. This indicates it is possible to determine the direction of differentiation of ADSC by controlling the microenvironment. Heme oxygenase 1 (HO-1), a type of antioxidant enzyme, attenuates adipogenicity and obesity. We produced transgenic pigs overexpressing human HO-1 (hHO-1-Tg), and found that these animals have little fatty tissue when autopsied. To determine whether overexpressed human HO-1 suppresses adipogenesis in pigs, we analyzed body weight increases of hHO-1-Tg pigs and wild type (WT) pigs of the same strain, and induced adipogenic differentiation of ADSC derived from WT and hHO-1-Tg pigs. The hHO-1-Tg pigs had lower body weights than WT pigs from 16 weeks of age until they died. In addition, hHO-1-Tg ADSC showed reduced adipogenic differentiation and expression of adipogenic molecular markers such as PPARg and C/EBPa compared to WT ADSC. These results suggest that HO-1 overexpression reduces adipogenesis both in vivo and in vitro, which could support identification of therapeutic targets of obesity and related metabolic diseases. © 2015 Elsevier Inc. All rights reserved.
Keywords: ADSC Adipogenic differentiation C/EBPa HO-1 PPARg
1. Introduction Mesenchymal stem cells (MSC) are a type of multipotent cells that is able to differentiate into several lineages including osteocytes, chondrocytes and adipocytes [1]. The commitment is driven by their microenvironment which precisely controls cell fates. Adipose-derived stem cells (ADSC), a type of stem cell originating in fat tissue, share similar cell surface antigen profiles with MSC, and are also multipotent [2]. Adipogenesis consists of two steps, mainly [3,4]: the first step is commitment or determination so that the multipotent ability of MSC becomes restricted to a particular lineage, e.g., preadipocytes in the case of adipogenesis. The second step is differentiation, in
Abbreviations: adipose-derived mesenchymal stem cells, ADSC; mesenchymal stem cells, MSC; human heme oxygenase 1, hHO-1; transgenic, Tg; wild type, WT. * Corresponding author. Department of Theriogenology and Biotechnology, College of Veterinary Medicine, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826, Republic of Korea. E-mail addresses: [email protected] (E.J. Park), [email protected] (O.J. Koo), [email protected] (B.C. Lee). 1 Both authors contributed equally. http://dx.doi.org/10.1016/j.bbrc.2015.10.040 0006-291X/© 2015 Elsevier Inc. All rights reserved.
which cell fate follows the lineage, resulting in mature adipocytes exhibiting cytoplasm filled with lipid. Adipogenic differentiation can be achieved by well-organized, sequential activation of a variety of transcription factors, mainly peroxisome proliferatoractivated receptor gamma (PPARg) and CCAAT/enhancer binding protein alpha (C/EBPa) [5,6]. These components function specifically in later stages of adipogenic differentiation [6,7], and it is possible to induce adipogenesis by controlling the microenvironment around ADSC [4,8]. Interestingly, increasing evidences indicate that reactive oxygen species (ROS) result in adipogenic differentiation and obesity [9,10]. Heme oxygenase (HO) is well known as one of the enzyme reducing ROS, which catalyzes heme degradation followed by production of biliverdin, ferrous iron and carbon monoxide (CO) that have antioxidant potential [11,12]. HO has two subtypes: HO-1 and HO-2. HO-1 is inducible, depending on oxidative stress, while HO-2 is constitutively expressed [13]. In addition to its antioxidant effects, the relationship between adipogenesis and HO-1 activity has been studied [14e16]. Recently, we successfully produced HO-1 overexpressing pigs and isolated ADSC from the one of the pigs [17]. The goal of this study was to determine whether constitutively
936
E.J. Park et al. / Biochemical and Biophysical Research Communications 467 (2015) 935e940
overexpressed human HO-1 (hHO-1) attenuates differentiation of porcine ADSC into the adipocyte lineage driven by adipogenic factors in vivo and in vitro.
added to the cells. After incubation at RT for 10 min, the Oil Red O solution was removed and the cells were washed four times in DW. 2.6. Total RNA extraction and reverse transcription
2. Materials and methods 2.1. Animals Three hHO-1 transgenic (hHO-1-Tg) pigs were produced by somatic cell nuclear transfer using fibroblasts that had been transfected with the hHO-1 gene by electroporation [17]. Gene expression of hHO-1 in the pigs was driven by the CMV promoter. The body weights of the three hHO-1-Tg pigs and three control pigs were measured every week for 23 weeks. The protocols for animal use in this study were approved by the Institutional Animal Care and Use Committee of Seoul National University (12-2009-008-5) in accordance with the Guide for the Care and Use of Laboratory Animals of Seoul National University. 2.2. Isolation and culture of adipose-derived stem cells from pigs ADSC were isolated from subcutaneous fat tissue in the inguinal region of one of the three hHO-1-Tg pigs and a wild type pig, as previously described [18]. Briefly, the fat tissues were digested with collagenase, filtered by a cell strainer and centrifuged to obtain cell pellets. The cells were cultured in RCME-P medium (K-Stem Cell medium for ADSC culture, K-Stem Cell Research Institute, Seoul, Korea) at 37 C, under 5% CO2 in air. Characterization of ADSC was performed. After the ADSC formed a monolayer, they were cryopreserved and stored in liquid nitrogen until used in this study. 2.3. Adipogenic differentiation Cryopreserved ADSC were thawed for clonal expansion and subcultured for adipogenic differentiation. In order to induce adipogenic differentiation of ADSC, cells in passages 2 to 3 were cultured at a density of 2 105/2 ml in 35-mm dishes until confluence for 2 days. The RCME-P medium was supplemented with 10 mg/ml insulin (12585-014, Gibco), 0.5 mM dexamethasone (D4902, Sigma) and 20 mM indomethacin to form differentiation medium, for 14 days of culture. The differentiation medium was changed every three to four days. 2.4. Oxidative level measurement WT and hHO-1-Tg ADSC were cultured until confluence and immediately subcultured for 1 day until the cell density was 70%. The ADSC were trypsinized to make a single cell suspension and half of the cells were treated with the CellROX Green Flow Cytometry Assay Kit (C10492, Life Technologies Korea, Seoul, Korea) according to the manufacturer's instructions. ROS expressed as green fluorescence were detected with a FACS Calibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) using CELL Quest software. 2.5. Oil red O staining Differentiated adipocytes were stained with Oil Red O in order to verify the existence of lipid droplets. Briefly, the medium was removed and the cells were washed two times in PBS. The cells were incubated in 2 ml of 10% formalin for more than 1 h at room temperature (RT) and washed with 2 ml of distilled water (DW) twice. Then, 60% isopropanol was used to wash the cells for 5 min and the cells were completely dried at RT. A solution of 0.5% Oil Red O (Sigma O1391) was mixed with DW in a 6:4 ratio, filtered and
For comparing transcript levels in WT and hHO-1-Tg ADSC and adipocytes at day 7, we extracted total RNA from cells using the Easy-spinTM (DNA-free) Total RNA Extraction Kit (iNtRON Biotechnology Inc., Kyunggi, Korea) according to the manufacturer's instructions, with slight modifications. Total RNA was eluted in nuclease-free water (NFW, AM9938, Life Technologies Korea, Seoul, Korea) and the concentration was measured by spectrophotometry. cDNA was synthesized from the total RNA using ReverTra Ace® qPCR RT Kit (FSQ-201, Toyobo, Osaka, Japan). 2.7. Quantitative PCR To compare transcription levels of several genes, quantitative PCR (real-time PCR) was performed using the StepOnePlus™ RealTime PCR System according to the instructions of the supplier (Applied Biosystems, Foster City, CA, USA). Primer sequences used are shown in Table 1. 2.8. Statistical analysis Real-time PCR results were analyzed by one-way ANOVA using SPSS (IBM Korea, Seoul, Korea). All data were derived from experiments repeated three times. 3. Results 3.1. Body weight of WT and hHO-1-Tg pigs Although the body weight of both WT and hHO-1-Tg pigs increased as they grew, the weight gain in WT pigs was higher than in hHO-1-Tg pigs (Fig. 1). After conducting autopsies, we observed little subcutaneous fat tissue in dead hHO-1-Tg pigs (data not shown). 3.2. Adipogenic differentiation ADSC from WT and hHO-1-Tg pigs prior to adipogenic differentiation showed fibroblast-like morphology (Fig. 2a and b, respectively). After 7 days of culture to induce adipogenic differentiation, however, the cellular morphology changed into a round shape and a portion of the cells included cytoplasmic droplets (Fig. 2c and d, respectively). After 14 days, WT ADSC had differentiated into adipocytes much more frequently than hHO-1-Tg ADSC (Fig. 2e and f, respectively) and oil red O stained more lipid droplets in the cytoplasm of WT (Fig. 2g) compared with hHO-1-Tg cells (Fig. 2h). 3.3. HO-1 expression level and ROS level Endogenous, inducible HO-1 was significantly more highly expressed in WT ADSC than in hHO-1-Tg ADSC, but the level was decreased after adipogenic differentiation and then there was no difference between WT and hHO-1-Tg adipocytes (Fig. 3a). However, exogenous, forcibly expressed hHO-1 was only detected in hHO-1-Tg cells regardless of adipogenic differentiation. In particular, exogenous HO-1 was expressed in hHO-1-Tg adipocytes after culture and adipogenic differentiation at extremely high levels compared to other groups (Fig. 3b). ROS level was significantly higher in WT (6.41%) compared to hHO-1-Tg ADSC (2.81%).
E.J. Park et al. / Biochemical and Biophysical Research Communications 467 (2015) 935e940
937
Table 1 Primer sequences for quantitative real-time PCR. Gene
Primer sequences (50 /30 )
PCR product size (bp)
GenBank no.
ACTB
F: GTGGACATCAGGAAGGACCT R: ATGATCTTGATCTTCATGGT F: AGAGCTGATCCAATGGTTGC R: GAGTTGGAAGGCTCTTCGTG F: TGGACAAGAACAGCAACGAG R: CCAGCACCTTCTGTTGAGTCT F: TCATGCGTTCTCCTCAGATG R: ATGGGAAAGATTGTGCAAGG F: ATCTGGAGTGACTGGGGTTG R: CGGTAGACATAGGCGCTTTC F: TACCGCTCCCGAATGAACAC R: GTCACGGGAGTGGAGTCTTG F: TTCAAGCAGCTCTACCGCTC R: GGGGGCAGAATCTTGCACTT
131
U07786.1
146
NM_214379.1
114
AF103944.1
107
NM_214367.1
90
NM_214370.1
PPARG C/EBPA CTNNB1 ADIPOQ Porcine HMOX1 Human HMOX1
Fig. 1. Body weight increase of wild type (WT, control) and human heme oxygenase transgenic (hHO-1-Tg, Clone #1e3) pigs from birth until 23 weeks of age. Body weight gain after 16 weeks old in WT pigs was higher than hHO-1-Tg pigs.
3.4. Effect of HO-1 on transcript expression related to adipogenic differentiation PPARg and C/EBPa expression was significantly increased in both groups at 1 week of adipogenic differentiation compared to before adipogenic induction. When comparing both cell types at the same time, WT cells showed higher transcript levels of PPARg and C/EBPa compared to hHO-1-Tg cells (Fig. 4a and b). Expression of b-catenin was significantly higher in hHO-1-Tg cells compared to WT cells before differentiation, but there was no difference in its expression level after adipogenic differentiation. In addition, expression of b-catenin decreased after differentiation in both WT and hHO-1-Tg groups (Fig. 4c). Adiponectin expression was significantly higher after adipogenic differentiation in both WT and hHO1-Tg groups, and WT cells showed more than 2.5 times the expression level of adiponectin than hHO-1-Tg cells after differentiation (Fig. 4d). 4. Discussion In this study, we verified that overexpressed human HO-1 reduces adipogenesis in pigs and in ADSC derived from them. Autopsy and weight analyses of dead WT and hHO-1-Tg pigs showed the effect of HO-1 to adipogenesis in vivo. The proportion of fat tissue in pigs is known to be 2% in neonates and rises to 15% within 28 days of birth [19]. As shown in this study, there was no significant difference in body weight between the two groups at birth, but the hHO-1-Tg pigs showed lower body weights than WT pigs of the same strain starting from 16 weeks of age, and their body weights
209
NM_001004027.1
216
NM_002133.2
were lower by at least 20% compared to WT pigs at 23 weeks. In addition, it has been demonstrated that HO-1 induction resulted in reduction of weight gain without a change in food intake and visceral/subcutaneous adipose tissue [20e22]. In agreement with these reports, little subcutaneous fat tissue was observed in dead hHO-1-Tg pigs at autopsy in the present study, which means poor adipogenesis contributes to the lower body weight in hHO-1-Tg pigs. During in vitro adipogenic differentiation, the fibroblast-like cell shape in ADSC changed to a round shape and lipid droplets accumulated in the cytoplasm regardless of HO-1 expression. Oil red O staining showed lipid in WT and hHO-1-Tg adipocytes. These results indicate that adipogenic differentiation proceeded properly and mature adipocytes were produced, as described previously [7]. In addition, hHO-1-Tg ADSC also differentiated into adipocytes, but the degree of differentiation was lower in hHO-1-Tg cells than in WT cells. The proportion of ROS-producing cells was significantly higher in WT ADSC compared to hHO-1-Tg ADSC, which is inversely related to the overexpressed hHO-1 level, meaning that overexpressed HO-1 reduced ROS levels in hHO-1-Tg ADSC. In order to investigate the relationship between HO-1 and adipogenic differentiation at the molecular level, expression levels of HO-1 and several genes related to adipogenesis were analyzed using cells before and after adipogenic differentiation. Results showed that endogenous HO-1 expression was diminished following differentiation. This agrees with a report that inducible HO-1 expression decreased after adipocyte differentiation [14,16]. Possibly, prolonged exposure to the high glucose level in the culture medium was enough to decrease HO-1 expression [14,23]. In contrast, exogenous hHO-1 was only detected in hHO-1-Tg ADSC and adipocytes, as expected. Even hHO-1-Tg adipocytes showed significantly higher hHO-1 expression compared to ADSC, and it is considered that this difference resulted from activity of the CMV promoter which is able to assure constitutive and strong expression of a transgene. Meanwhile, compared to the report that adipocytes produce more ROS than preadipocytes [13], it is reasonable to expect that adipocytes produce much more ROS than ADSC, but ROS could not induce endogenous HO-1 expression during adipogenic differentiation. It is known that b-catenin is involved in cell-to-cell adhesion as well as the Wnt signaling pathway [24]. PPARg and C/EBPa are key factors inducing adipocyte differentiation accompanied by lipid accumulation in the cytoplasm [4,25], and these factors control adipocyte differentiation [26]. It has been studied that HO-1 activates the Wnt/b-catenin signaling pathway [27], and b-catenin inhibits PPARg and C/EBPa activity [25]. In this study, PPARg and C/ EBPa increased after inducing adipocyte differentiation
938
E.J. Park et al. / Biochemical and Biophysical Research Communications 467 (2015) 935e940
Fig. 2. Adipogenic differentiation of adipose-derived stem cell (ADSC) into adipocytes in wild type (WT) and human heme oxygenase transgenic (hHO-1-Tg) pigs. a and b, ADSC of WT and hHO-1-Tg with fibroblast-like morphology before adipogenic differentiation; c and d, Adipocytes of WT and hHO-1-Tg with morphogy changed into round shape and cytoplasmic lipid droplets 7 days after adipogenic differentiation; e and f, Adipocytes of WT and hHO-1-Tg 14 days after adipogenic differentiation; g and h, Oil red O staining of lipid in WT and hHO-1-Tg adipocytes after 14 days, respectively.
Fig. 3. Expression of endogenous HO-1 and exogenous HO-1 (hHO-1). a, Porcine endogenous HO-1 expression levels; b, Exogenous (human) HO-1 expression levels in WT and hHO-1-Tg cells before and after differentiation. Different letters on bars mean significantly different results between the groups.
accompanied by a b-catenin decrease in both cell types, which is consistent with previous studies reporting that upregulation of HO1 decreased adipogenic differentiation of MSC, and downregulation of HO-1 expression resulted in increased adipocyte differentiation and PPARg expression [14,16]. However, whereas hHO-1-Tg cells before differentiation showed large increases in hHO-1 and consequently induces increase in b-catenin expression level although endogenous HO-1 decreased, after differentiation the much higher level of hHO-1 in hHO-1-Tg adipocytes could not increase b-catenin expression compared to that in WT adipocytes. In addition, although PPARg and C/EBPa expression was higher in WT
compared to hHO-1-Tg after adipogenic differentiation, b-catenin expression levels of both group were not different. Vanella et al. reported that HO-1 increases b-catenin activity, which consequently reduces adipogenesis [16], which showed discrepancy in our result in terms of the relationships between HO-1 and b-catenin. Further study is required to investigate the mechanism under the discrepancy, but the exogenous HO-1 seemed not to activate expression of b-catenin in this study. Adiponectin, the most abundant fat-derived cytokine, has antidiabetic and anti-atherogenic properties. It is related to insulinsensitivity and its levels in serum are known to be inversely
E.J. Park et al. / Biochemical and Biophysical Research Communications 467 (2015) 935e940
939
Fig. 4. Adipogenesis-related gene expression. a, PPARg; b, C/EBPa; c, b-catenin and d, adiponectin expression levels in WT and hHO-1-Tg cells before and after differentiation. Gene expression levels were normalized compared to b-actin expression of each group. Different letters on bars indicate significantly different results between the groups.
correlated with visceral fat content in adults, although it is made by adipocytes [28]. In this study, as adipogenic differentiation progressed, the adiponectin expression level increased. Possible explanations for this tendency are first that increase in PPARg might elevate adiponectin levels. It is in accordance with a report that PPARg agonists increase plasma adiponectin levels through transcriptional induction in adipose tissues, which is possible because PPARg response elements (PPREs) are located in the adiponectin promoter [28]. The increase in PPARg level augmented adiponectin promoter activity and it was followed by adiponectin expression. A second possibility is that excess TNF-a produced in fat tissue inhibits tyrosine kinase activity of the insulin receptor, resulting in insulin resistance. In addition, TNF-a decreases expression of adiponectin [29] and PPARg [30]. Adiponectin inhibits TNF-a signaling in endothelial cells and consequently alleviates insulin resistance resulting from TNF-a. Our results showed that adiponectin and PPARg significantly increased after adipogenic differentiation, especially in WT cells. There might be little expression of TNF-a in adipocytes, so insulin sensitivity was not affected. Although it is known that HO-1 increases the expression of adiponectin, adipogenesis increased adiponectin rather than by HO-1 overexpression in this study. In conclusion, overexpression of human HO-1 suppresses adipogenesis in pigs and in ADSC. This finding will support the development of new drug targets for curing obesity and related metabolic diseases using HO-1 overexpression. However, the pathway suppressing adipogenesis by human HO-1 in pig ADSC seems to be different from the classical Wnt/b-catenin signaling, so further study is needed to elucidate the mechanism by which exogenous HO-1 decreases adipogenesis.
Acknowledgments This study was supported by the Ministry of Trade, Industry and Energy of Korea (#10048948), Cooperative Research Program for Agriculture Science and Technology Development (#PJ009802), Rural Development Administration of Korea, the Research Institute for Veterinary Science, the BK21 PLUS Program, TS Corporation and Korea IPET (#311011-05-5-SB010). Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2015.10.040. References [1] M.F. Pittenger, A.M. Mackay, S.C. Beck, R.K. Jaiswal, R. Douglas, J.D. Mosca, M.A. Moorman, D.W. Simonetti, S. Craig, D.R. Marshak, Multilineage potential of adult human mesenchymal stem cells, Sci. (New York, N.Y.) 284 (1999) 143e147. [2] A.L. Strong, J.M. Gimble, B.A. Bunnell, Analysis of the Pro- and AntiInflammatory Cytokines Secreted by Adult Stem Cells during Differentiation, Stem Cells Int. 2015 (2015) 412467. ndez-Real, Adipocyte differentiation, in: [3] J.M. Moreno-Navarrete, J.M. Ferna Adipose Tissue Biology, Springer, 2012, pp. 17e38. [4] E. Hu, P. Tontonoz, B.M. Spiegelman, Transdifferentiation of myoblasts by the adipogenic transcription factors PPAR gamma and C/EBP alpha, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 9856e9860. [5] E.D. Rosen, O.A. MacDougald, Adipocyte differentiation from the inside out, Nature reviews, Mol. Cell Biol. 7 (2006) 885e896. [6] M.I. Lefterova, A.K. Haakonsson, M.A. Lazar, S. Mandrup, PPARgamma and the global map of adipogenesis and beyond, Trends Endocrinol. Metabolism TEM 25 (2014) 293e302. [7] F.M. Gregoire, C.M. Smas, H.S. Sul, Understanding adipocyte differentiation,
940
E.J. Park et al. / Biochemical and Biophysical Research Communications 467 (2015) 935e940
Physiol. Rev. 78 (1998) 783e809. [8] G. Donati, V. Proserpio, B.M. Lichtenberger, K. Natsuga, R. Sinclair, H. Fujiwara, F.M. Watt, Epidermal Wnt/beta-catenin signaling regulates adipocyte differentiation via secretion of adipogenic factors, Proc. Natl. Acad. Sci. U. S. A. 111 (2014) E1501eE1509. [9] F. Atashi, A. Modarressi, M.S. Pepper, The role of reactive oxygen species in mesenchymal stem cell adipogenic and osteogenic differentiation: a review, Stem Cells Dev. 24 (2015) 1150e1163. [10] X. Wang, C. Hai, Redox modulation of adipocyte differentiation: hypothesis of “Redox Chain” and novel insights into intervention of adipogenesis and obesity, Free Radic. Biol. Med. 89 (2015) 99e125. [11] N.G. Abraham, J. Cao, D. Sacerdoti, X. Li, G. Drummond, Heme oxygenase: the key to renal function regulation, American journal of physiology, Ren. Physiol. 297 (2009) F1137eF1152. [12] G. Kikuchi, T. Yoshida, M. Noguchi, Heme oxygenase and heme degradation, Biochem. Biophysical Res. Commun. 338 (2005) 558e567. [13] A. Burgess, L. Vanella, L. Bellner, M.L. Schwartzman, N.G. Abraham, Epoxyeicosatrienoic acids and heme oxygenase-1 interaction attenuates diabetes and metabolic syndrome complications, Prostagl. Other Lipid Mediat. 97 (2012) 1e16. [14] L. Vanella, D.H. Kim, D. Asprinio, S.J. Peterson, I. Barbagallo, A. Vanella, D. Goldstein, S. Ikehara, A. Kappas, N.G. Abraham, HO-1 expression increases mesenchymal stem cell-derived osteoblasts but decreases adipocyte lineage, Bone 46 (2010) 236e243. [15] A. Burgess, M. Li, L. Vanella, D.H. Kim, R. Rezzani, L. Rodella, K. Sodhi, M. Canestraro, P. Martasek, S.J. Peterson, A. Kappas, N.G. Abraham, Adipocyte heme oxygenase-1 induction attenuates metabolic syndrome in both male and female obese mice, Hypertension 56 (2010) 1124e1130. [16] L. Vanella, D.H. Kim, K. Sodhi, I. Barbagallo, A.P. Burgess, J.R. Falck, M.L. Schwartzman, N.G. Abraham, Crosstalk between EET and HO-1 downregulates Bach1 and adipogenic marker expression in mesenchymal stem cell derived adipocytes, Prostagl. Other lipid Mediat. 96 (2011) 54e62. [17] H.J. Yeom, O.J. Koo, J. Yang, B. Cho, J.I. Hwang, S.J. Park, S. Hurh, H. Kim, E.M. Lee, H. Ro, J.T. Kang, S.J. Kim, J.K. Won, P.J. O'Connell, H. Kim, C.D. Surh, B.C. Lee, C. Ahn, Generation and characterization of human heme oxygenase-1 transgenic pigs, PloS one 7 (2012) e46646. [18] H.J. Oh, E.J. Park, S.Y. Lee, J.W. Soh, I.S. Kong, S.W. Choi, J.C. Ra, S.K. Kang, B.C. Lee, Comparison of cell proliferation and epigenetic modification of gene expression patterns in canine foetal fibroblasts and adipose tissue-derived mesenchymal stem cells, Cell Prolif. 45 (2012) 438e444. [19] L. Giblin, C. Darimont, P. Leone, L.B. McNamara, F. Blancher, D. Berry, E. Castaneda-Gutierrez, P.G. Lawlor, Offspring subcutaneous adipose markers are sensitive to the timing of maternal gestational weight gain, Reproductive Biol. Endocrinol. RB&E 13 (2015) 16.
[20] M. Li, D.H. Kim, P.L. Tsenovoy, S.J. Peterson, R. Rezzani, L.F. Rodella, W.S. Aronow, S. Ikehara, N.G. Abraham, Treatment of obese diabetic mice with a heme oxygenase inducer reduces visceral and subcutaneous adiposity, increases adiponectin levels, and improves insulin sensitivity and glucose tolerance, Diabetes 57 (2008) 1526e1535. [21] A. Nicolai, M. Li, D.H. Kim, S.J. Peterson, L. Vanella, V. Positano, A. Gastaldelli, R. Rezzani, L.F. Rodella, G. Drummond, C. Kusmic, A. L'Abbate, A. Kappas, N.G. Abraham, Heme oxygenase-1 induction remodels adipose tissue and improves insulin sensitivity in obesity-induced diabetic rats, Hypertension 53 (2009) 508e515. [22] S.J. Peterson, D.H. Kim, M. Li, V. Positano, L. Vanella, L.F. Rodella, F. Piccolomini, N. Puri, A. Gastaldelli, C. Kusmic, A. L'Abbate, N.G. Abraham, The L-4F mimetic peptide prevents insulin resistance through increased levels of HO-1, pAMPK, and pAKT in obese mice, J. Lipid Res. 50 (2009) 1293e1304. [23] A.L. Kruger, S. Peterson, S. Turkseven, P.M. Kaminski, F.F. Zhang, S. Quan, M.S. Wolin, N.G. Abraham, D-4F induces heme oxygenase-1 and extracellular superoxide dismutase, decreases endothelial cell sloughing, and improves vascular reactivity in rat model of diabetes, Circulation 111 (2005) 3126e3134. [24] P.J. Morin, beta-catenin signaling and cancer, BioEssays news Rev. Mol. Cell. Dev. Biol. 21 (1999) 1021e1030. [25] S. Kang, C.N. Bennett, I. Gerin, L.A. Rapp, K.D. Hankenson, O.A. Macdougald, Wnt signaling stimulates osteoblastogenesis of mesenchymal precursors by suppressing CCAAT/enhancer-binding protein alpha and peroxisome proliferatoractivated receptor gamma, J. Biol. Chem. 282 (2007) 14515e14524. [26] M.I. Lefterova, Y. Zhang, D.J. Steger, M. Schupp, J. Schug, A. Cristancho, D. Feng, D. Zhuo, C.J. Stoeckert Jr., X.S. Liu, M.A. Lazar, PPARgamma and C/EBP factors orchestrate adipocyte biology via adjacent binding on a genome-wide scale, Genes & Dev. 22 (2008) 2941e2952. [27] L. Vanella, K. Sodhi, D.H. Kim, N. Puri, M. Maheshwari, T.D. Hinds, L. Bellner, D. Goldstein, S.J. Peterson, J.I. Shapiro, N.G. Abraham, Increased hemeoxygenase 1 expression in mesenchymal stem cell-derived adipocytes decreases differentiation and lipid accumulation via upregulation of the canonical Wnt signaling cascade, Stem Cell Res. Ther. 4 (2013) 28. [28] M. Iwaki, M. Matsuda, N. Maeda, T. Funahashi, Y. Matsuzawa, M. Makishima, I. Shimomura, Induction of adiponectin, a fat-derived antidiabetic and antiatherogenic factor, by nuclear receptors, Diabetes 52 (2003) 1655e1663. [29] S. Tateya, F. Kim, Y. Tamori, Recent advances in obesity-induced inflammation and insulin resistance, Front. Endocrinol. 4 (2013) 93. [30] M. Suzawa, I. Takada, J. Yanagisawa, F. Ohtake, S. Ogawa, T. Yamauchi, T. Kadowaki, Y. Takeuchi, H. Shibuya, Y. Gotoh, K. Matsumoto, S. Kato, Cytokines suppress adipogenesis and PPAR-gamma function through the TAK1/ TAB1/NIK cascade, Nat. Cell Biol. 5 (2003) 224e230.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Overexpressed human heme Oxygenase-1 decreases adipogenesis in pigs and porcine adipose-derived stem cells Eun Jung Park a, 1, Ok Jae Koo b, 1, Byeong Chun Lee a, * a
Department of Theriogenology and Biotechnology, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul 08826, Republic of Korea b Samsung Biomedical Research Institute, SAIT, SEC, Suwon 16419, Republic of Korea
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 September 2015 Accepted 8 October 2015 Available online 19 October 2015
Adipose-derived mesenchymal stem cells (ADSC) are multipotent, which means they are able to differentiate into several lineages in vivo and in vitro under proper conditions. This indicates it is possible to determine the direction of differentiation of ADSC by controlling the microenvironment. Heme oxygenase 1 (HO-1), a type of antioxidant enzyme, attenuates adipogenicity and obesity. We produced transgenic pigs overexpressing human HO-1 (hHO-1-Tg), and found that these animals have little fatty tissue when autopsied. To determine whether overexpressed human HO-1 suppresses adipogenesis in pigs, we analyzed body weight increases of hHO-1-Tg pigs and wild type (WT) pigs of the same strain, and induced adipogenic differentiation of ADSC derived from WT and hHO-1-Tg pigs. The hHO-1-Tg pigs had lower body weights than WT pigs from 16 weeks of age until they died. In addition, hHO-1-Tg ADSC showed reduced adipogenic differentiation and expression of adipogenic molecular markers such as PPARg and C/EBPa compared to WT ADSC. These results suggest that HO-1 overexpression reduces adipogenesis both in vivo and in vitro, which could support identification of therapeutic targets of obesity and related metabolic diseases. © 2015 Elsevier Inc. All rights reserved.
Keywords: ADSC Adipogenic differentiation C/EBPa HO-1 PPARg
1. Introduction Mesenchymal stem cells (MSC) are a type of multipotent cells that is able to differentiate into several lineages including osteocytes, chondrocytes and adipocytes [1]. The commitment is driven by their microenvironment which precisely controls cell fates. Adipose-derived stem cells (ADSC), a type of stem cell originating in fat tissue, share similar cell surface antigen profiles with MSC, and are also multipotent [2]. Adipogenesis consists of two steps, mainly [3,4]: the first step is commitment or determination so that the multipotent ability of MSC becomes restricted to a particular lineage, e.g., preadipocytes in the case of adipogenesis. The second step is differentiation, in
Abbreviations: adipose-derived mesenchymal stem cells, ADSC; mesenchymal stem cells, MSC; human heme oxygenase 1, hHO-1; transgenic, Tg; wild type, WT. * Corresponding author. Department of Theriogenology and Biotechnology, College of Veterinary Medicine, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826, Republic of Korea. E-mail addresses: [email protected] (E.J. Park), [email protected] (O.J. Koo), [email protected] (B.C. Lee). 1 Both authors contributed equally. http://dx.doi.org/10.1016/j.bbrc.2015.10.040 0006-291X/© 2015 Elsevier Inc. All rights reserved.
which cell fate follows the lineage, resulting in mature adipocytes exhibiting cytoplasm filled with lipid. Adipogenic differentiation can be achieved by well-organized, sequential activation of a variety of transcription factors, mainly peroxisome proliferatoractivated receptor gamma (PPARg) and CCAAT/enhancer binding protein alpha (C/EBPa) [5,6]. These components function specifically in later stages of adipogenic differentiation [6,7], and it is possible to induce adipogenesis by controlling the microenvironment around ADSC [4,8]. Interestingly, increasing evidences indicate that reactive oxygen species (ROS) result in adipogenic differentiation and obesity [9,10]. Heme oxygenase (HO) is well known as one of the enzyme reducing ROS, which catalyzes heme degradation followed by production of biliverdin, ferrous iron and carbon monoxide (CO) that have antioxidant potential [11,12]. HO has two subtypes: HO-1 and HO-2. HO-1 is inducible, depending on oxidative stress, while HO-2 is constitutively expressed [13]. In addition to its antioxidant effects, the relationship between adipogenesis and HO-1 activity has been studied [14e16]. Recently, we successfully produced HO-1 overexpressing pigs and isolated ADSC from the one of the pigs [17]. The goal of this study was to determine whether constitutively
936
E.J. Park et al. / Biochemical and Biophysical Research Communications 467 (2015) 935e940
overexpressed human HO-1 (hHO-1) attenuates differentiation of porcine ADSC into the adipocyte lineage driven by adipogenic factors in vivo and in vitro.
added to the cells. After incubation at RT for 10 min, the Oil Red O solution was removed and the cells were washed four times in DW. 2.6. Total RNA extraction and reverse transcription
2. Materials and methods 2.1. Animals Three hHO-1 transgenic (hHO-1-Tg) pigs were produced by somatic cell nuclear transfer using fibroblasts that had been transfected with the hHO-1 gene by electroporation [17]. Gene expression of hHO-1 in the pigs was driven by the CMV promoter. The body weights of the three hHO-1-Tg pigs and three control pigs were measured every week for 23 weeks. The protocols for animal use in this study were approved by the Institutional Animal Care and Use Committee of Seoul National University (12-2009-008-5) in accordance with the Guide for the Care and Use of Laboratory Animals of Seoul National University. 2.2. Isolation and culture of adipose-derived stem cells from pigs ADSC were isolated from subcutaneous fat tissue in the inguinal region of one of the three hHO-1-Tg pigs and a wild type pig, as previously described [18]. Briefly, the fat tissues were digested with collagenase, filtered by a cell strainer and centrifuged to obtain cell pellets. The cells were cultured in RCME-P medium (K-Stem Cell medium for ADSC culture, K-Stem Cell Research Institute, Seoul, Korea) at 37 C, under 5% CO2 in air. Characterization of ADSC was performed. After the ADSC formed a monolayer, they were cryopreserved and stored in liquid nitrogen until used in this study. 2.3. Adipogenic differentiation Cryopreserved ADSC were thawed for clonal expansion and subcultured for adipogenic differentiation. In order to induce adipogenic differentiation of ADSC, cells in passages 2 to 3 were cultured at a density of 2 105/2 ml in 35-mm dishes until confluence for 2 days. The RCME-P medium was supplemented with 10 mg/ml insulin (12585-014, Gibco), 0.5 mM dexamethasone (D4902, Sigma) and 20 mM indomethacin to form differentiation medium, for 14 days of culture. The differentiation medium was changed every three to four days. 2.4. Oxidative level measurement WT and hHO-1-Tg ADSC were cultured until confluence and immediately subcultured for 1 day until the cell density was 70%. The ADSC were trypsinized to make a single cell suspension and half of the cells were treated with the CellROX Green Flow Cytometry Assay Kit (C10492, Life Technologies Korea, Seoul, Korea) according to the manufacturer's instructions. ROS expressed as green fluorescence were detected with a FACS Calibur flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) using CELL Quest software. 2.5. Oil red O staining Differentiated adipocytes were stained with Oil Red O in order to verify the existence of lipid droplets. Briefly, the medium was removed and the cells were washed two times in PBS. The cells were incubated in 2 ml of 10% formalin for more than 1 h at room temperature (RT) and washed with 2 ml of distilled water (DW) twice. Then, 60% isopropanol was used to wash the cells for 5 min and the cells were completely dried at RT. A solution of 0.5% Oil Red O (Sigma O1391) was mixed with DW in a 6:4 ratio, filtered and
For comparing transcript levels in WT and hHO-1-Tg ADSC and adipocytes at day 7, we extracted total RNA from cells using the Easy-spinTM (DNA-free) Total RNA Extraction Kit (iNtRON Biotechnology Inc., Kyunggi, Korea) according to the manufacturer's instructions, with slight modifications. Total RNA was eluted in nuclease-free water (NFW, AM9938, Life Technologies Korea, Seoul, Korea) and the concentration was measured by spectrophotometry. cDNA was synthesized from the total RNA using ReverTra Ace® qPCR RT Kit (FSQ-201, Toyobo, Osaka, Japan). 2.7. Quantitative PCR To compare transcription levels of several genes, quantitative PCR (real-time PCR) was performed using the StepOnePlus™ RealTime PCR System according to the instructions of the supplier (Applied Biosystems, Foster City, CA, USA). Primer sequences used are shown in Table 1. 2.8. Statistical analysis Real-time PCR results were analyzed by one-way ANOVA using SPSS (IBM Korea, Seoul, Korea). All data were derived from experiments repeated three times. 3. Results 3.1. Body weight of WT and hHO-1-Tg pigs Although the body weight of both WT and hHO-1-Tg pigs increased as they grew, the weight gain in WT pigs was higher than in hHO-1-Tg pigs (Fig. 1). After conducting autopsies, we observed little subcutaneous fat tissue in dead hHO-1-Tg pigs (data not shown). 3.2. Adipogenic differentiation ADSC from WT and hHO-1-Tg pigs prior to adipogenic differentiation showed fibroblast-like morphology (Fig. 2a and b, respectively). After 7 days of culture to induce adipogenic differentiation, however, the cellular morphology changed into a round shape and a portion of the cells included cytoplasmic droplets (Fig. 2c and d, respectively). After 14 days, WT ADSC had differentiated into adipocytes much more frequently than hHO-1-Tg ADSC (Fig. 2e and f, respectively) and oil red O stained more lipid droplets in the cytoplasm of WT (Fig. 2g) compared with hHO-1-Tg cells (Fig. 2h). 3.3. HO-1 expression level and ROS level Endogenous, inducible HO-1 was significantly more highly expressed in WT ADSC than in hHO-1-Tg ADSC, but the level was decreased after adipogenic differentiation and then there was no difference between WT and hHO-1-Tg adipocytes (Fig. 3a). However, exogenous, forcibly expressed hHO-1 was only detected in hHO-1-Tg cells regardless of adipogenic differentiation. In particular, exogenous HO-1 was expressed in hHO-1-Tg adipocytes after culture and adipogenic differentiation at extremely high levels compared to other groups (Fig. 3b). ROS level was significantly higher in WT (6.41%) compared to hHO-1-Tg ADSC (2.81%).
E.J. Park et al. / Biochemical and Biophysical Research Communications 467 (2015) 935e940
937
Table 1 Primer sequences for quantitative real-time PCR. Gene
Primer sequences (50 /30 )
PCR product size (bp)
GenBank no.
ACTB
F: GTGGACATCAGGAAGGACCT R: ATGATCTTGATCTTCATGGT F: AGAGCTGATCCAATGGTTGC R: GAGTTGGAAGGCTCTTCGTG F: TGGACAAGAACAGCAACGAG R: CCAGCACCTTCTGTTGAGTCT F: TCATGCGTTCTCCTCAGATG R: ATGGGAAAGATTGTGCAAGG F: ATCTGGAGTGACTGGGGTTG R: CGGTAGACATAGGCGCTTTC F: TACCGCTCCCGAATGAACAC R: GTCACGGGAGTGGAGTCTTG F: TTCAAGCAGCTCTACCGCTC R: GGGGGCAGAATCTTGCACTT
131
U07786.1
146
NM_214379.1
114
AF103944.1
107
NM_214367.1
90
NM_214370.1
PPARG C/EBPA CTNNB1 ADIPOQ Porcine HMOX1 Human HMOX1
Fig. 1. Body weight increase of wild type (WT, control) and human heme oxygenase transgenic (hHO-1-Tg, Clone #1e3) pigs from birth until 23 weeks of age. Body weight gain after 16 weeks old in WT pigs was higher than hHO-1-Tg pigs.
3.4. Effect of HO-1 on transcript expression related to adipogenic differentiation PPARg and C/EBPa expression was significantly increased in both groups at 1 week of adipogenic differentiation compared to before adipogenic induction. When comparing both cell types at the same time, WT cells showed higher transcript levels of PPARg and C/EBPa compared to hHO-1-Tg cells (Fig. 4a and b). Expression of b-catenin was significantly higher in hHO-1-Tg cells compared to WT cells before differentiation, but there was no difference in its expression level after adipogenic differentiation. In addition, expression of b-catenin decreased after differentiation in both WT and hHO-1-Tg groups (Fig. 4c). Adiponectin expression was significantly higher after adipogenic differentiation in both WT and hHO1-Tg groups, and WT cells showed more than 2.5 times the expression level of adiponectin than hHO-1-Tg cells after differentiation (Fig. 4d). 4. Discussion In this study, we verified that overexpressed human HO-1 reduces adipogenesis in pigs and in ADSC derived from them. Autopsy and weight analyses of dead WT and hHO-1-Tg pigs showed the effect of HO-1 to adipogenesis in vivo. The proportion of fat tissue in pigs is known to be 2% in neonates and rises to 15% within 28 days of birth [19]. As shown in this study, there was no significant difference in body weight between the two groups at birth, but the hHO-1-Tg pigs showed lower body weights than WT pigs of the same strain starting from 16 weeks of age, and their body weights
209
NM_001004027.1
216
NM_002133.2
were lower by at least 20% compared to WT pigs at 23 weeks. In addition, it has been demonstrated that HO-1 induction resulted in reduction of weight gain without a change in food intake and visceral/subcutaneous adipose tissue [20e22]. In agreement with these reports, little subcutaneous fat tissue was observed in dead hHO-1-Tg pigs at autopsy in the present study, which means poor adipogenesis contributes to the lower body weight in hHO-1-Tg pigs. During in vitro adipogenic differentiation, the fibroblast-like cell shape in ADSC changed to a round shape and lipid droplets accumulated in the cytoplasm regardless of HO-1 expression. Oil red O staining showed lipid in WT and hHO-1-Tg adipocytes. These results indicate that adipogenic differentiation proceeded properly and mature adipocytes were produced, as described previously [7]. In addition, hHO-1-Tg ADSC also differentiated into adipocytes, but the degree of differentiation was lower in hHO-1-Tg cells than in WT cells. The proportion of ROS-producing cells was significantly higher in WT ADSC compared to hHO-1-Tg ADSC, which is inversely related to the overexpressed hHO-1 level, meaning that overexpressed HO-1 reduced ROS levels in hHO-1-Tg ADSC. In order to investigate the relationship between HO-1 and adipogenic differentiation at the molecular level, expression levels of HO-1 and several genes related to adipogenesis were analyzed using cells before and after adipogenic differentiation. Results showed that endogenous HO-1 expression was diminished following differentiation. This agrees with a report that inducible HO-1 expression decreased after adipocyte differentiation [14,16]. Possibly, prolonged exposure to the high glucose level in the culture medium was enough to decrease HO-1 expression [14,23]. In contrast, exogenous hHO-1 was only detected in hHO-1-Tg ADSC and adipocytes, as expected. Even hHO-1-Tg adipocytes showed significantly higher hHO-1 expression compared to ADSC, and it is considered that this difference resulted from activity of the CMV promoter which is able to assure constitutive and strong expression of a transgene. Meanwhile, compared to the report that adipocytes produce more ROS than preadipocytes [13], it is reasonable to expect that adipocytes produce much more ROS than ADSC, but ROS could not induce endogenous HO-1 expression during adipogenic differentiation. It is known that b-catenin is involved in cell-to-cell adhesion as well as the Wnt signaling pathway [24]. PPARg and C/EBPa are key factors inducing adipocyte differentiation accompanied by lipid accumulation in the cytoplasm [4,25], and these factors control adipocyte differentiation [26]. It has been studied that HO-1 activates the Wnt/b-catenin signaling pathway [27], and b-catenin inhibits PPARg and C/EBPa activity [25]. In this study, PPARg and C/ EBPa increased after inducing adipocyte differentiation
938
E.J. Park et al. / Biochemical and Biophysical Research Communications 467 (2015) 935e940
Fig. 2. Adipogenic differentiation of adipose-derived stem cell (ADSC) into adipocytes in wild type (WT) and human heme oxygenase transgenic (hHO-1-Tg) pigs. a and b, ADSC of WT and hHO-1-Tg with fibroblast-like morphology before adipogenic differentiation; c and d, Adipocytes of WT and hHO-1-Tg with morphogy changed into round shape and cytoplasmic lipid droplets 7 days after adipogenic differentiation; e and f, Adipocytes of WT and hHO-1-Tg 14 days after adipogenic differentiation; g and h, Oil red O staining of lipid in WT and hHO-1-Tg adipocytes after 14 days, respectively.
Fig. 3. Expression of endogenous HO-1 and exogenous HO-1 (hHO-1). a, Porcine endogenous HO-1 expression levels; b, Exogenous (human) HO-1 expression levels in WT and hHO-1-Tg cells before and after differentiation. Different letters on bars mean significantly different results between the groups.
accompanied by a b-catenin decrease in both cell types, which is consistent with previous studies reporting that upregulation of HO1 decreased adipogenic differentiation of MSC, and downregulation of HO-1 expression resulted in increased adipocyte differentiation and PPARg expression [14,16]. However, whereas hHO-1-Tg cells before differentiation showed large increases in hHO-1 and consequently induces increase in b-catenin expression level although endogenous HO-1 decreased, after differentiation the much higher level of hHO-1 in hHO-1-Tg adipocytes could not increase b-catenin expression compared to that in WT adipocytes. In addition, although PPARg and C/EBPa expression was higher in WT
compared to hHO-1-Tg after adipogenic differentiation, b-catenin expression levels of both group were not different. Vanella et al. reported that HO-1 increases b-catenin activity, which consequently reduces adipogenesis [16], which showed discrepancy in our result in terms of the relationships between HO-1 and b-catenin. Further study is required to investigate the mechanism under the discrepancy, but the exogenous HO-1 seemed not to activate expression of b-catenin in this study. Adiponectin, the most abundant fat-derived cytokine, has antidiabetic and anti-atherogenic properties. It is related to insulinsensitivity and its levels in serum are known to be inversely
E.J. Park et al. / Biochemical and Biophysical Research Communications 467 (2015) 935e940
939
Fig. 4. Adipogenesis-related gene expression. a, PPARg; b, C/EBPa; c, b-catenin and d, adiponectin expression levels in WT and hHO-1-Tg cells before and after differentiation. Gene expression levels were normalized compared to b-actin expression of each group. Different letters on bars indicate significantly different results between the groups.
correlated with visceral fat content in adults, although it is made by adipocytes [28]. In this study, as adipogenic differentiation progressed, the adiponectin expression level increased. Possible explanations for this tendency are first that increase in PPARg might elevate adiponectin levels. It is in accordance with a report that PPARg agonists increase plasma adiponectin levels through transcriptional induction in adipose tissues, which is possible because PPARg response elements (PPREs) are located in the adiponectin promoter [28]. The increase in PPARg level augmented adiponectin promoter activity and it was followed by adiponectin expression. A second possibility is that excess TNF-a produced in fat tissue inhibits tyrosine kinase activity of the insulin receptor, resulting in insulin resistance. In addition, TNF-a decreases expression of adiponectin [29] and PPARg [30]. Adiponectin inhibits TNF-a signaling in endothelial cells and consequently alleviates insulin resistance resulting from TNF-a. Our results showed that adiponectin and PPARg significantly increased after adipogenic differentiation, especially in WT cells. There might be little expression of TNF-a in adipocytes, so insulin sensitivity was not affected. Although it is known that HO-1 increases the expression of adiponectin, adipogenesis increased adiponectin rather than by HO-1 overexpression in this study. In conclusion, overexpression of human HO-1 suppresses adipogenesis in pigs and in ADSC. This finding will support the development of new drug targets for curing obesity and related metabolic diseases using HO-1 overexpression. However, the pathway suppressing adipogenesis by human HO-1 in pig ADSC seems to be different from the classical Wnt/b-catenin signaling, so further study is needed to elucidate the mechanism by which exogenous HO-1 decreases adipogenesis.
Acknowledgments This study was supported by the Ministry of Trade, Industry and Energy of Korea (#10048948), Cooperative Research Program for Agriculture Science and Technology Development (#PJ009802), Rural Development Administration of Korea, the Research Institute for Veterinary Science, the BK21 PLUS Program, TS Corporation and Korea IPET (#311011-05-5-SB010). Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2015.10.040. References [1] M.F. Pittenger, A.M. Mackay, S.C. Beck, R.K. Jaiswal, R. Douglas, J.D. Mosca, M.A. Moorman, D.W. Simonetti, S. Craig, D.R. Marshak, Multilineage potential of adult human mesenchymal stem cells, Sci. (New York, N.Y.) 284 (1999) 143e147. [2] A.L. Strong, J.M. Gimble, B.A. Bunnell, Analysis of the Pro- and AntiInflammatory Cytokines Secreted by Adult Stem Cells during Differentiation, Stem Cells Int. 2015 (2015) 412467. ndez-Real, Adipocyte differentiation, in: [3] J.M. Moreno-Navarrete, J.M. Ferna Adipose Tissue Biology, Springer, 2012, pp. 17e38. [4] E. Hu, P. Tontonoz, B.M. Spiegelman, Transdifferentiation of myoblasts by the adipogenic transcription factors PPAR gamma and C/EBP alpha, Proc. Natl. Acad. Sci. U. S. A. 92 (1995) 9856e9860. [5] E.D. Rosen, O.A. MacDougald, Adipocyte differentiation from the inside out, Nature reviews, Mol. Cell Biol. 7 (2006) 885e896. [6] M.I. Lefterova, A.K. Haakonsson, M.A. Lazar, S. Mandrup, PPARgamma and the global map of adipogenesis and beyond, Trends Endocrinol. Metabolism TEM 25 (2014) 293e302. [7] F.M. Gregoire, C.M. Smas, H.S. Sul, Understanding adipocyte differentiation,
940
E.J. Park et al. / Biochemical and Biophysical Research Communications 467 (2015) 935e940
Physiol. Rev. 78 (1998) 783e809. [8] G. Donati, V. Proserpio, B.M. Lichtenberger, K. Natsuga, R. Sinclair, H. Fujiwara, F.M. Watt, Epidermal Wnt/beta-catenin signaling regulates adipocyte differentiation via secretion of adipogenic factors, Proc. Natl. Acad. Sci. U. S. A. 111 (2014) E1501eE1509. [9] F. Atashi, A. Modarressi, M.S. Pepper, The role of reactive oxygen species in mesenchymal stem cell adipogenic and osteogenic differentiation: a review, Stem Cells Dev. 24 (2015) 1150e1163. [10] X. Wang, C. Hai, Redox modulation of adipocyte differentiation: hypothesis of “Redox Chain” and novel insights into intervention of adipogenesis and obesity, Free Radic. Biol. Med. 89 (2015) 99e125. [11] N.G. Abraham, J. Cao, D. Sacerdoti, X. Li, G. Drummond, Heme oxygenase: the key to renal function regulation, American journal of physiology, Ren. Physiol. 297 (2009) F1137eF1152. [12] G. Kikuchi, T. Yoshida, M. Noguchi, Heme oxygenase and heme degradation, Biochem. Biophysical Res. Commun. 338 (2005) 558e567. [13] A. Burgess, L. Vanella, L. Bellner, M.L. Schwartzman, N.G. Abraham, Epoxyeicosatrienoic acids and heme oxygenase-1 interaction attenuates diabetes and metabolic syndrome complications, Prostagl. Other Lipid Mediat. 97 (2012) 1e16. [14] L. Vanella, D.H. Kim, D. Asprinio, S.J. Peterson, I. Barbagallo, A. Vanella, D. Goldstein, S. Ikehara, A. Kappas, N.G. Abraham, HO-1 expression increases mesenchymal stem cell-derived osteoblasts but decreases adipocyte lineage, Bone 46 (2010) 236e243. [15] A. Burgess, M. Li, L. Vanella, D.H. Kim, R. Rezzani, L. Rodella, K. Sodhi, M. Canestraro, P. Martasek, S.J. Peterson, A. Kappas, N.G. Abraham, Adipocyte heme oxygenase-1 induction attenuates metabolic syndrome in both male and female obese mice, Hypertension 56 (2010) 1124e1130. [16] L. Vanella, D.H. Kim, K. Sodhi, I. Barbagallo, A.P. Burgess, J.R. Falck, M.L. Schwartzman, N.G. Abraham, Crosstalk between EET and HO-1 downregulates Bach1 and adipogenic marker expression in mesenchymal stem cell derived adipocytes, Prostagl. Other lipid Mediat. 96 (2011) 54e62. [17] H.J. Yeom, O.J. Koo, J. Yang, B. Cho, J.I. Hwang, S.J. Park, S. Hurh, H. Kim, E.M. Lee, H. Ro, J.T. Kang, S.J. Kim, J.K. Won, P.J. O'Connell, H. Kim, C.D. Surh, B.C. Lee, C. Ahn, Generation and characterization of human heme oxygenase-1 transgenic pigs, PloS one 7 (2012) e46646. [18] H.J. Oh, E.J. Park, S.Y. Lee, J.W. Soh, I.S. Kong, S.W. Choi, J.C. Ra, S.K. Kang, B.C. Lee, Comparison of cell proliferation and epigenetic modification of gene expression patterns in canine foetal fibroblasts and adipose tissue-derived mesenchymal stem cells, Cell Prolif. 45 (2012) 438e444. [19] L. Giblin, C. Darimont, P. Leone, L.B. McNamara, F. Blancher, D. Berry, E. Castaneda-Gutierrez, P.G. Lawlor, Offspring subcutaneous adipose markers are sensitive to the timing of maternal gestational weight gain, Reproductive Biol. Endocrinol. RB&E 13 (2015) 16.
[20] M. Li, D.H. Kim, P.L. Tsenovoy, S.J. Peterson, R. Rezzani, L.F. Rodella, W.S. Aronow, S. Ikehara, N.G. Abraham, Treatment of obese diabetic mice with a heme oxygenase inducer reduces visceral and subcutaneous adiposity, increases adiponectin levels, and improves insulin sensitivity and glucose tolerance, Diabetes 57 (2008) 1526e1535. [21] A. Nicolai, M. Li, D.H. Kim, S.J. Peterson, L. Vanella, V. Positano, A. Gastaldelli, R. Rezzani, L.F. Rodella, G. Drummond, C. Kusmic, A. L'Abbate, A. Kappas, N.G. Abraham, Heme oxygenase-1 induction remodels adipose tissue and improves insulin sensitivity in obesity-induced diabetic rats, Hypertension 53 (2009) 508e515. [22] S.J. Peterson, D.H. Kim, M. Li, V. Positano, L. Vanella, L.F. Rodella, F. Piccolomini, N. Puri, A. Gastaldelli, C. Kusmic, A. L'Abbate, N.G. Abraham, The L-4F mimetic peptide prevents insulin resistance through increased levels of HO-1, pAMPK, and pAKT in obese mice, J. Lipid Res. 50 (2009) 1293e1304. [23] A.L. Kruger, S. Peterson, S. Turkseven, P.M. Kaminski, F.F. Zhang, S. Quan, M.S. Wolin, N.G. Abraham, D-4F induces heme oxygenase-1 and extracellular superoxide dismutase, decreases endothelial cell sloughing, and improves vascular reactivity in rat model of diabetes, Circulation 111 (2005) 3126e3134. [24] P.J. Morin, beta-catenin signaling and cancer, BioEssays news Rev. Mol. Cell. Dev. Biol. 21 (1999) 1021e1030. [25] S. Kang, C.N. Bennett, I. Gerin, L.A. Rapp, K.D. Hankenson, O.A. Macdougald, Wnt signaling stimulates osteoblastogenesis of mesenchymal precursors by suppressing CCAAT/enhancer-binding protein alpha and peroxisome proliferatoractivated receptor gamma, J. Biol. Chem. 282 (2007) 14515e14524. [26] M.I. Lefterova, Y. Zhang, D.J. Steger, M. Schupp, J. Schug, A. Cristancho, D. Feng, D. Zhuo, C.J. Stoeckert Jr., X.S. Liu, M.A. Lazar, PPARgamma and C/EBP factors orchestrate adipocyte biology via adjacent binding on a genome-wide scale, Genes & Dev. 22 (2008) 2941e2952. [27] L. Vanella, K. Sodhi, D.H. Kim, N. Puri, M. Maheshwari, T.D. Hinds, L. Bellner, D. Goldstein, S.J. Peterson, J.I. Shapiro, N.G. Abraham, Increased hemeoxygenase 1 expression in mesenchymal stem cell-derived adipocytes decreases differentiation and lipid accumulation via upregulation of the canonical Wnt signaling cascade, Stem Cell Res. Ther. 4 (2013) 28. [28] M. Iwaki, M. Matsuda, N. Maeda, T. Funahashi, Y. Matsuzawa, M. Makishima, I. Shimomura, Induction of adiponectin, a fat-derived antidiabetic and antiatherogenic factor, by nuclear receptors, Diabetes 52 (2003) 1655e1663. [29] S. Tateya, F. Kim, Y. Tamori, Recent advances in obesity-induced inflammation and insulin resistance, Front. Endocrinol. 4 (2013) 93. [30] M. Suzawa, I. Takada, J. Yanagisawa, F. Ohtake, S. Ogawa, T. Yamauchi, T. Kadowaki, Y. Takeuchi, H. Shibuya, Y. Gotoh, K. Matsumoto, S. Kato, Cytokines suppress adipogenesis and PPAR-gamma function through the TAK1/ TAB1/NIK cascade, Nat. Cell Biol. 5 (2003) 224e230.