Overexpression of a serine alkaline protease gene in Bacillus licheniformis and its impact on the metabolic reaction network

Enzyme and Microbial Technology 32 (2003) 706–720

Overexpression of a serine alkaline protease gene in Bacillus licheniformis and its impact on the metabolic reaction network Pınar Çalik a , Gregory C. Tomlin b , Stephen G. Oliver b , Tunçer H. Özdamar c,∗ b

a Department of Chemical Engineering, Middle East Technical University, 06531 Ankara, Turkey School of Biological Sciences, University of Manchester, 2.205 Stopford Building, Oxford Road, Manchester M60 9PT, UK c Ankara University Biotechnology Research Center, Tando˘ gan, 06100 Ankara, Turkey

Received 7 January 2003; received in revised form 17 January 2003; accepted 17 January 2003

Abstract This work reports on cloning of serine alkaline protease (SAP) encoding gene subC to a multi-copy plasmid and its expression in Bacillus licheniformis with the quantitative impact of overexpression of the subC gene on metabolic flux distributions. Bioprocess characteristics of the wild-type and the recombinant B. licheniformis were investigated in a defined simple synthetic medium with glucose as the sole carbon source under well-defined bioreactor-operation conditions. Significant physiological changes were observed in the recombinant B. licheniformis in response to altered bioreactor-operation conditions, i.e. initial glucose concentration. The growth kinetics of microbial cells were investigated prior to the investigation of intracellular reactions and rates within the cell; the unstructured substrate inhibition and Monod models were found valid for the wild-type and recombinant B. licheniformis, respectively. Optimum initial glucose concentration for maximum SAP production and the corresponding cultivation time of the recombinant B. licheniformis shifted respectively from CG0 = 6 to 8 kg m−3 and from t = 43 to 67 h. The maximum SAP activity was obtained as 950 U cm−3 with the recombinant B. licheniformis, which was ca. 2.5-fold higher than that of the wild-type. Carbon fluxes through the central metabolic pathways in the wild-type and recombinant B. licheniformis were calculated, using a mass balance-based mathematical model that contains 105 metabolites and 148 reaction fluxes and the time profiles of glucose, dry cell weight, organic acids, amino acids and SAP obtained in 3.5 dm3 bioreactor systems at CG0 = 6 kg m−3 for the exponential growth phase and the SAP production phase. The bioreaction network flux analyses were first accomplished by using the theoretical data-based approach; and then by using the theoretical data-based capacity analysis approach. During the SAP synthesis period, the actual fluxes of the glycolysis pathway, the pentose phosphate pathway, the tricarboxylic acid cycle, the amino acids biosynthetic pathways (and, consequently, SAP synthesis) are higher in the recombinant B. licheniformis strain than in the wild-type. Further, the normalised relative flux values of all the pathways, except the glycolysis pathway, change considerably in the recombinant bacteria. The effectiveness factor, defined as the SAP synthesis rate per maximum possible SAP synthesis rate was η = 0.20 for the recombinant B. licheniformis. This indicates the possibility of a further increase in SAP production through metabolic engineering, and potential strategies to achieve this are also discussed. © 2003 Elsevier Science Inc. All rights reserved. Keywords: Serine alkaline protease; subC gene; Recombinant; Bacillus licheniformis; Metabolic flux analysis

1. Introduction The state of the bioprocess for serine alkaline protease (SAP) production depends primarily on the capacity of the microorganism. Bacillus species are attractive as microbioreactors under well-designed bioreactor-operation conditions due to their secretion ability of large amounts of enzyme into the bioreactor medium. We have previously investigated the Abbreviations: PPP, pentose phosphate pathway; PSS, pseudo steadystate; R#, reaction number; SAP, serine alkaline protease; TCA, tricarboxylic acid ∗ Corresponding author. Tel.: +90-312-212-67-20x1354; fax: +90-312-223-23-95. E-mail address: [email protected] (T.H. Özdamar).

effects of oxygen transfer [1–4] which strongly affects SAP and by-product formations [1] by influencing metabolic pathways and changing metabolic fluxes [2], in relation to the physiology of the wild-type Bacillus licheniformis in a defined medium to clarify the extent of the oxygen-transfer requirements [3] to fine-tune bioreactor performance. Recently, we reported on the maximum SAP theoretical yields and optimum carbon flux distributions for SAP overproduction in B. licheniformis [4–6]; moreover, the metabolic behaviour and theoretical data-based capacity of the wild-type B. licheniformis cells were evaluated using experimental data obtained in batch fermentations with citrate as the carbon source. The results revealed that, in theory, SAP production can be increased to 16.7- and 7.2-fold, respectively, in the

0141-0229/03/$ – see front matter © 2003 Elsevier Science Inc. All rights reserved. doi:10.1016/S0141-0229(03)00030-9

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

Nomenclature A c(t) c1 (t) c2 (t) CG0 CG CSAP KG KI N Q0 pH0 r(t) t T V VR YX/S YP/S YP/X Z Greek µ µmax η αi

Stoichiometric matrix of the metabolic network Metabolite accumulation vector Extracellular metabolite accumulation vectors Intracellular metabolite accumulation vectors Initial glucose concentration (kg m−3 ) Glucose concentration (kg m−3 ) Serine alkaline protease concentrations (kg m−3 ) Parameter in the model for growth (kg m−3 ) Inhibition constant (kg m−3 ) Agitation rate (min−1 ) Volumetric air feed rate (m3 min−1 ) Initial pH value Vector of reaction fluxes Bioreactor cultivation time (h) Temperature (◦ C) Bioreactor volume (dm3 ) Bioreactor working volume (dm3 ) Overall specific cell yield on the substrate glucose (g g−1 ) Overall specific product yield on substrate (g g−1 ) Overall amount of SAP produced per amount of cell generated (g g−1 ) Objective function letters Specific cell growth rate (h−1 ) Maximum specific cell growth rate (h−1 ) Effectiveness factor (SAP synthesis rate per maximum possible SAP synthesis rate) Stoichiometric coefficient of the fluxes

exponential and SAP synthesis periods of the batch fermentation. These results suggest that it may be possible to take advantage of this unused capacity for the production of SAP by introducing highly expressed cloned genes into the bacterium which can increase the performance of the microorganism. To design the genetic structure and to improve the genetic control mechanism, whereupon to regulate the intracellular bioreaction network of B. licheniformis for a more focused approach to the problems of the SAP yield, selectivity and productivity, SAP enzyme should be produced as a recombinant gene product in the genetically modified bacilli, moreover, if the full production potential of the producer strain is to be realised, some metabolic engineering will be required. This work reports the cloning of subC, the gene encoding SAP onto a multi-copy plasmid and its expression in B. licheniformis. Data are presented on the metabolic flux

707

distributions in recombinant and wild-type B. licheniformis in order to provide an integrative evaluation of the impact of genetic manipulation on SAP production. The bioprocess characteristics of wild-type and recombinant B. licheniformis strains were investigated in a defined simple synthetic medium with a single carbon source under well-defined bioreactor-operation conditions in order to generate a coherent picture. By using the data obtained throughout the SAP production period, theoretical data-based intracellular flux analyses (TDAs) were conducted by minimising the difference between SAP synthesis rate and SAP secretion rate to obtain the actual fluxes in the wild-type and recombinant strains in order to determine the response of the organism’s metabolic network to the genetic manipulation. Theoretical data-based capacity (TDC) analyses were also conducted by maximising the SAP synthesis rate in order to calculate the overproduction capacities for SAP formation. The TDA and TDC analysis results for the recombinant strain were compared; and an efficiency factor η, defined as the SAP production rate per maximum possible SAP synthesis rate, was calculated in order to determine the possibility of a further increase in SAP production by the recombinant B. licheniformis.

2. Experimental methods 2.1. Genetic engineering experiments 2.1.1. Bacterial strains, plasmids and growth media Bacterial strains, plasmids and growth media were prepared using standard techniques [7]. Wild-type (DSM 1969) and recombinant B. licheniformis and Escherichia coli strains, XL1-Blue [8] and JM109 [9], were maintained and grown on LB-agar that contained (kg m−3 ): tryptone, 10; NaCl, 5; yeast extract, 5; agar, 15 and in LB broth (without agar) at 37 ◦ C. Ampicillin (50 ␮g ml−1 ) was used for the plasmid maintenance in the E. coli strains and 7 ␮g ml−1 chloramphenicol was used for the plasmid maintenance in the recombinant B. licheniformis [10]. 2.1.2. Manipulation of DNA Bacillus licheniformis (DSM 1969) chromosomal DNA was isolated from exponentially growing cultures as described by Posprech and Neumann [11]. Bacillus licheniformis competent cells were prepared by the method of Vehmaanperä [12]. Plasmid DNA was transformed into B. licheniformis or E. coli by electroporation using a Bio-Rad Gene Pulser II according to the manufacturer’s specifications at 2.5 kV with 2 mm gap separation between the plates and 25 ␮F [10]. 2.1.3. PCR and cloning In order to isolate the subC gene (GenBank Acc. No. X03341) from chromosomal DNA of the wild-type B.

708

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

licheniformis, PCR was used. The following forward and reverse primers were used for the amplification of subC using the polymerase chain reaction according to the published gene sequences [13]. The forward primer: 5 GCTCTAGAGCTGATAAAATGAATCAGATGG 3 and the reverse primer: 5 CGCGGATCCGCGACCATAATGGAACGATTC 3 were purchased from GIBCO BRL Custom Primers, UK. BamHI and XbaI restriction sites were incorporated into the forward and reverse primers, respectively. The target DNA was amplified by Taq DNA polymerase under the following conditions in 30 cycles: denaturation step of 1 min at 94 ◦ C, annealing step of 1 min at 50 ◦ C and extension step of 2 min at 72 ◦ C [10]. The subC gene was first cloned into an E. coli–Saccharomyces cerevisiae shuttle vector pRS316 [14]; then sub-cloned into an E. coli–Bacillus shuttle vector [10] pHV1431 [15]. 2.2. Batch-bioreactor experiments with wild-type and recombinant Bacillus licheniformis 2.2.1. Culture maintenance and media For the bioprocess experiments B. licheniformis (DSM 1969) stock cultures were maintained on agar slants that contained (kg m−3 ): peptone, 2.5; azocasein, 0.2; MnSO4 ·2H2 O, 0.010; agar, 15; and their pH0 values were adjusted to 7.25. The cells on the newly prepared slants were inoculated into the preculture medium for preparation of inocula that contained (kg m−3 ): soytryptone, 15; peptone, 5; MnSO4 ·2H2 O, 0.010; Na2 HPO4 , 0.25; CaCl2 , 0.100, and grown at 37 ◦ C for 6 h. The medium for batch-bioreactor fermentations was designed as (kg m−3 ): glucose, 6.0; (NH4 )2 HPO4 , 4.7; KH2 PO4 , 2.0; 0.04 M Na2 HPO4 and NaH2 PO4 ; the initial pH0 of the medium was adjusted to 7.25 with 10 M KOH. Chloramphenicol (7 ␮g ml−1 ) was used during the incubation and all bioprocess experiments of plasmid-bearing B. licheniformis strains. 2.2.2. Laboratory-scale batch fermentations Small-scale batch laboratory experiments were conducted at N = 200 min−1 , T = 37 ◦ C and pH0 = 7.25, in orbital shakers under agitation and heating rate control, using air-filtered 500-ml Erlenmeyer flasks having 220 ml working volume capacities. The batch-bioreactor experiments were conducted at the air inlet rate of Q0 /VR = 0.5 vvm and agitation rate of N = 750 min−1 at pH0 = 7.25 and T = 37 ◦ C in laboratory-scale 3.5 dm3 bioreactors (Chemap, CF 3000, Switzerland), which were stirred with two four-blade Rushton turbines, consisted of a system of working volume VR = 2.0 dm3 , each with temperature, pH, foam, stirring rate and dissolved oxygen measurements and controls. 2.2.3. Analyses Proteolytic activity was measured by hydrolysis of casein. The culture broth was harvested by centrifugation (Sorvall RC 28S, DuPont, Wilmington, DE) at 7000 × g at 4 ◦ C for 15 min. Two millilitres of 0.5% (w/v) Hammersten casein in

borate buffer was mixed with 1 ml of diluted bacterial broth and hydrolysed under T = 37 ◦ C, pH = 10 and t = 20 min conditions. The reaction was stopped by adding 2 ml of 10% (w/v) trichloroacetic acid, the reaction mixture was centrifuged at 28,700 × g for 10 min at 4 ◦ C, and absorbance of the supernatant was measured at 275 nm with a UV-Vis spectrophotometer (Shimadzu UV-160A, Tokyo, Japan). One unit protease activity was defined as the activity which liberates four nanomoles of tyrosine (Tyr) per minute [1]. The microorganism concentrations were measured with a UV-Vis spectrophotometer and related to cell dry weight as mentioned elsewhere using a previously determined calibration [1]. Glucose consumption was followed by the DNS method [16]. SAP, neutral protease and amylase concentrations were measured using a high-performance capillary electrophoresis (Waters HPCE, Quanta 4000E, Milford, MA). The enzymes were analysed at 12 kV and 15 ◦ C with a positivepower supply as mentioned elsewhere [1]. Amino acid concentrations were measured with an amino acid analysis system (Waters, HPLC, Milford, MA), using the Pico Tag method [17]. The method is based on reversed-phase high-pressure liquid chromatography, using precolumn derivation technique with a gradient program developed for amino acids [1]. Organic acid concentrations were determined with a high-performance capillary electrophoresis at 254 nm (Waters HPCE, Quanta 4000E, Milford, MA). The samples were analysed at 20 kV and 15 ◦ C with a negative-power supply by hydrostatic-pressure injection, using an electrolyte containing 5 mM potassium hydrogen phthalate and 0.5 mM OFM Anion Bt (Waters, Milford, MA) as the flow modifier at pH = 5.6 (for ␣-ketoglutarate (␣KG), acetate (Ac), malate (Mal), fumarate (Fum), succinate (Suc), lactate (Lac), oxaloacetate (OA) and gluconate (Gluc)) and at pH = 7.0 (for pyruvate (Pyr), citrate (Cit), Lac, Gluc). Full details of this analyses may be found in Çalık et al. [1]. 2.2.4. Analyses based on mass flux balance Conceptually, the cells function as the semi-batch microbioreactors with volume V wherein the biochemical reactions take place; and, a small number of compounds of the intracellular biochemical reaction network (e.g. substrate(s), oxygen, H+ , H2 O, CO2 , amino acids, organic acids of the glycolysis or gluconeogenesis pathways and the tricarboxylic acid (TCA) cycle and extracellular SAP enzyme) are exchanged or transferred with facilitated and active transport mechanisms between the metabolic system and the bioreactor medium which is defined as the environment. The metabolic reaction network of B. licheniformis that contains 105 metabolites and 147 reaction fluxes [18] was extended further by the addition of the anaplerotic reaction: R148 :

Pyr + CO2 → OA

catalysed by Pyr carboxylase for the connection of the glycolysis pathway to the TCA cycle. The stoichiometric

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

709

Fig. 1. The metabolic pathway map of Bacillus licheniformis.

reactions of the network of B. licheniformis are summarised in Fig. 1 (Appendix A). The following major assumptions are used in the model: (i) all cells are assumed to show an identical behaviour throughout the bioprocess; (ii) amino acid and organic acid excretions and transportation processes are assumed to function via a passive transport mechanism; (iii) transportation

of CO2 , NH3 in the form of NH4 + , and phosphate from the cell to the broth and from the broth to the cell are also assumed to employ passive transport; (iv) the enzyme secretion is assumed to function via a passive transport mechanism, and the synthesis and degradation of the signal-peptide and pro-peptide amino acid sequences of SAP are not considered in the model; (v) the essential steps of gene transcription and

710

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

mRNA translation, required for the enzyme synthesis and secretion of the enzyme, are assumed to be non-limiting; (vi) conversion of NADPH to NADH via the transhydrogenation reaction is taken to be reversible and non-energy dependent. In the mass flux balance-based analyses, a pseudo steadystate (PSS) approximation for the intracellular metabolites and accumulation rates of the extracellular metabolites measured throughout the fermentations in consideration of the biochemical feature of the bioreaction network was used to acquire the intracellular metabolic flux distributions. A linear optimisation program (GAMS 2.25; General Algebraic Modelling System, GAMS Development Corp., Washington, DC) was used to solve the mass flux balance equation system, expressed as the linear vector differential equation system, as reported elsewhere [1,2]: Ar(t) = c(t)

(1)

c(t) = c1 (t) + c2 (t)

(2)

Z = αi ri

(3)

where A is the stoichiometric coefficient matrix of the metabolic network, r(t) is the vector of reaction fluxes; and c1 (t) and c2 (t) correspond to extracellular and intracellular metabolite accumulation vectors, respectively; lastly, Z is a linear combination of the fluxes ri and α i is the stoichiometric coefficient of the flux ri . As a PSS approximation was used for intracellular metabolites, c2 (t) = 0; therefore, c(t) is the net-output rate of the metabolite accumulation rate vector. Using the mathematical programming, metabolite flux distributions were obtained by minimising or maximising the objective function Z. The model variable that represent the reaction fluxes are expressed as mmol g−1 DW h−1 . The drain flux towards biomass is expressed in grams of biomass formed per gram biomass per hour; otherwise, it represents the growth rate, µ (h−1 ). Since SAP (EC 3.4.21.62) is an extracellular enzyme and is excreted into the broth when synthesis of the polypeptide chain is completed, for the TDA approach the model is solved by minimising the alkaline protease accumulation rate in the cell; for the TDC analysis, the model is solved by maximising the SAP synthesis rate (R146) [19].

Fig. 2. The variation of the wild-type Bacillus licheniformis biomass concentration with the cultivation time and the initial glucose concentration. pH = 7.25, T = 37 ◦ C, N = 200 min−1 , V = 30 ml. CG (kg m−3 ): (䊏) 0.1; (䉱) 0.5; ( ) 1.0; ( ) 2.0; (䊉) 4.0; ( ) 6.0; (䊐) 7.0; ( ) 8.0; (䊊) 15.0.

type B. licheniformis in shake-flasks in the range CG0 = 0–15 kg m−3 . The variation in biomass concentration with the cultivation time and initial substrate concentration is given in Fig. 2. Maximum biomass concentration was obtained at CG0 = 7.0 kg m−3 and t = 20 h. As the maximum SAP activity values at all the initial glucose concentrations were obtained at t = 43 h, except for the values of CG0 < 4.0 kg m−3 , the variation in SAP relative activity with CG0 for t = 43 h is presented in Fig. 3. As it is seen in Fig. 3, CG0 = 6.0 kg m−3 is optimum for SAP activity with the wild-type B. licheniformis. The growth of the cells was investigated by interpreting the exponential growth phase of the batch fermentations, and experimental specific growth rate (µ) values obtained from CX versus t plots show that the variation in µ with CG obeyed the substrate inhibition model: µ = µmax

3. Results and discussion The growth kinetics of microbial cells were investigated prior to the investigation of intracellular reaction rates within the wild-type and recombinant B. licheniformis in order to observe initially the response of the host B. licheniformis to the plasmid pHV1431::subC. 3.1. Effects of substrate concentration and growth kinetics: wild-type Bacillus licheniformis The effects of initial glucose concentration CG0 on growth and SAP activity were investigated using the wild-

CG (KG + CG + CG2 /KI )

(4)

and the kinetic parameters of the model were found to be µmax = 0.746 h−1 , KG = 0.273 kg m−3 and KI = 179.388 kg m−3 ; and the variation of µ with CG according to the model is given in Table 1. 3.2. Effects of substrate concentration and growth kinetics: recombinant Bacillus licheniformis Since interactions between the metabolic reactions and genetic regulatory mechanism of the recombinant B. licheniformis in the bioprocess for the SAP production are dependent on the bioreactor-operation conditions, the effects of

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

711

Fig. 3. The variation of the wild-type Bacillus licheniformis SAP relative activity with the initial glucose concentration. pH = 7.25, T = 37 ◦ C, N = 200 min−1 , V = 30 ml at t = 43 h.

the initial glucose concentration on SAP activity and cell concentration were investigated in shake-flasks in the range CG0 = 0–20 kg m−3 at N = 200 min−1 , T = 37 ◦ C, pH0 = 7.25. CG0 = 20.0 and 8.0 kg m−3 values were found to be optimal for cell formation and maximum SAP synthesis, respectively (Figs. 4 and 5). Nevertheless, the maximum SAP activity that was found to be 950 U cm−3 with the recombinant B. licheniformis was observed, not at t = 43 h as was found for the wild-type, but at t = 67 h. The response of the host to the plasmid pHV1431::subC is marked by a toleration for higher glucose concentrations, but at the cost of prolonged cultivation time. Glucose concentration decreases to limiting levels at t = 18 h, when SAP synthesis starts, in accord with what is known about the regulation of carbon

metabolism in Bacillus. Thus, to overcome glucose catabolite repression, in order to achieve increased SAP production, the promoter region of SAP may need to be modified. The specific growth rate µ values obtained from the experimental CX versus t plots for the recombinant

Table 1 The variation in experimental and calculated specific growth rate with the glucose concentration for the wild-type Bacillus licheniformis CG (kg m−3 )

0.0 0.1 0.5 1.0 2.0 4.0 6.0 7.0 8.0 15.0

Specific growth rate (h−1 ) Experimental

Calculated

– 0.1992 0.5037 0.6106 0.6412 0.6685 0.6931 0.7126 0.6852 0.6507

0 0.199970126 0.481767569 0.583628448 0.650243428 0.684311295 0.691676858 0.692272949 0.691825763 0.677329173

Fig. 4. The variation of the recombinant Bacillus licheniformis biomass concentration with the cultivation time and the initial glucose concentration. pH = 7.25, T = 37 ◦ C, N = 200 min−1 , V = 30 ml. CG (kg m−3 ): (䉬) 4.0; (䊏) 6.0; (䉱) 7.0; (×) 8.0; ( ) 10.0; (䊉) 15.0; (+) 20.0.

712

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

Fig. 5. The variation of the recombinant Bacillus licheniformis SAP relative activity with the cultivation time and the initial glucose concentration. pH = 7.25, T = 37 ◦ C, N = 200 min−1 , V = 30 ml. CG (kg m−3 ): (䉬) 4.0; (䊏) 6.0; (䉱) 7.0; ( ) 8.0; ( ) 10.0; (䊉) 15.0; ( ) 20.0.

microorganism show that the variation in µ with CG —in contrast to wild-type B. licheniformis—obeyed the Monod model: CG µ = µmax (5) KG + C G and the kinetic parameters of the model were found to be µmax = 0.139 h−1 and KG = 0.194 kg m−3 ; and the variation of µ with CG according to the model is given in Table 2. 3.2.1. Control experiments with Bacillus licheniformis carrying the empty vector pHV1431 Negative control experiments were conducted, using B. licheniformis carrying pHV1431 vector without the subC in-

Table 2 The variation in experimental and calculated specific growth rate with the glucose concentration for the recombinant Bacillus licheniformis CG (kg m−3 )

0.0 4.0 6.0 7.0 8.0 10.0 15.0 20.0

Specific growth rate (h−1 ) Experimental

Calculated

– 0.1405 0.1230 0.1308 0.1439 0.1294 0.1390 0.1440

0.0000 0.1326 0.1346 0.1353 0.1357 0.1364 0.1372 0.1377

sert at CG0 = 6 kg m−3 , N = 200 min−1 , T = 37 ◦ C and pH0 = 7.25, in order to clarify the source of the SAP activity. SAP activity of the B. licheniformis carrying pHV1431 was almost the same as that of the wild-type B. licheniformis (A = 220 U cm−3 ); however, cell concentration (CX = 1.1 kg m−3 ) was lower than that of the wild-type. Therefore, we conclude that the activity increase achieved with the recombinant B. licheniformis carrying pHV1431::subC is due to the cloned copy of the gene. 3.2.2. Bioprocess characteristics of the wild-type Bacillus licheniformis Product and by-product distributions of the bioprocess for SAP production were analysed in a defined simple synthetic medium with the initial glucose concentration CG0 = 6.0 kg m−3 in V = 3.5 dm3 bioreactor system, at the air inlet rate of Q0 /VR = 0.5 vvm and agitation rate of N = 750 min−1 at pH0 = 7.25 and T = 37 ◦ C conditions. The variations in the glucose and cell concentrations, SAP concentration and SAP activity with the cultivation time are presented in Fig. 6A. It may be seen that glucose was consumed at a high rate in the first 12 h of the fermentation; and then the consumption rate of the glucose decreased. The cell concentration increased at a high rate between t = 0–12 h, and reached to its highest value 1.70 kg m−3 at t = 20 h. On the other hand, SAP activity and concentration increased after t = 18 h, and the maximum SAP activity 390 U cm−3 was obtained at t = 43 h. Throughout the dynamic fermentation

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

713

Fig. 6. (A) The variations in the glucose, biomass and SAP concentrations, and SAP activity with the cultivation time with the wild-type Bacillus licheniformis operation. CG0 = 6.0 kg m−3 , pH0 = 7.25, T = 37 ◦ C, V = 2.0 × 10−3 m3 , Q0 /V = 0.5 vvm, N = 750 min−1 . CG : (䊏); CX : (䊐); SAP activity: (䊉); CSAP : (䊊). (B) The variations in the glucose, biomass and SAP concentrations, and SAP activity with the cultivation time with the recombinant Bacillus licheniformis operation. CG0 = 6.0 kg m−3 , pH0 = 7.25, T = 37 ◦ C, V = 2.0 × 10−3 m3 , Q0 /V = 0.5 vvm, N = 750 min−1 . CG : (䊏); CX : (䊐); SAP activity: (䊉); CSAP : (䊊).

714

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

process, the following organic acids excreted into or transported from the fermentation broth: ␣KG, Pyr, Lac, Suc, Cit and Ac. Among the amino acids, aspartate (Asp), arginine (Arg), glycine (Gly) and methionine (Met) were found not to be excreted into the fermentation broth. Overall specific cell yield on the substrate glucose (YX/S ), overall specific product yield on substrate (YP/S ) and the overall amount of SAP produced per amount of cell generated (YP/X ) were calculated as 0.28, 0.055 and 0.194, respectively. 3.2.3. Bioprocess characteristics of the recombinant Bacillus licheniformis carrying pHV1431::subC gene In order to determine the response of B. licheniformis to genetic modification, the product and by-product distributions of the SAP production process were analysed in cultures grown in a defined simple synthetic medium with initial glucose concentration CG0 = 6.0 kg m−3 in V = 3.5 dm3 bioreactor system at the air inlet rate of Q0 /VR = 0.5 vvm and agitation rate of N = 750 min−1 at pH0 = 7.25 and T = 37 ◦ C conditions, which were the optimum bioreactor-operation conditions for the wild-type B. licheniformis. The variations in the glucose and cell concentrations, SAP concentration and SAP activity with the cultivation time are presented in Fig. 6B. In common with what was found for the wild-type, glucose was consumed in the first 12 h of the fermentation with a high rate; and then the consumption rate of glucose decreased. Again, similar to wild-type B. licheniformis results, cell concentration of recombinant B. licheniformis increased with a high rate between t = 0–12 h and, at t = 20 h, reached its highest value of 1.24 kg m−3 ; this is a lower value than that of the wild-type. SAP concentration and activity profiles were similar to those of the wild-type: SAP production started after t = 18 h (Fig. 6B) and, at t = 43 h, the SAP activity of recombinant B. licheniformis was 650 U cm−3 , which is almost twice that of the wild-type strain. Both the wild-type and recombinant B. licheniformis start to synthesise SAP after t = 18 h when glucose concentration has decreased to limiting levels. The regulation of protease synthesis has not been studied in B. licheniformis yet, but its pattern is likely to be similar to that found for Bacillus subtilis. The biosynthesis of SAP is dependent on the induction of sporulation and on the concentration of carbon and nitrogen sources. Sporulation in B. subtilis is initiated by a decrease in guanine nucleotides [20] and the subsequent activation of the spoOA gene product, which in turn inhibits the expression of the abrB [21]. The abrB gene product represses synthesis of the protease during exponential growth [22], but a decrease in guanosine triphosphate does not suffice for stimulating protease production in the presence of high concentrations of carbon and nitrogen sources [23]. The signal transduction pathway, which informs the cell about its nutritional status and thus influences the production of extracellular enzymes, is defined by at least four genes, namely, degS, degU, degR and degQ [24]. Other regulatory genes in-

volved in the SAP synthesis [25,26] are sensS [27], sin [28], hpr [29] and pai [30]. Similar to the wild-type B. licheniformis results, the organic acids ␣KG, Pyr, Lac, Suc, Cit and Ac were excreted into or transported from the fermentation broth throughout the bioprocess. Again, in common with what was found for the wild-type, among the amino acids Arg and Asn were not found to be excreted into the fermentation broth. For the recombinant B. licheniformis, the overall specific cell yield on substrate (YX/S ), overall specific product yield on substrate (YP/S ) and overall amount of SAP produced per amount of cell generated (YP/X ) were calculated as 0.20, 0.10 and 0.46, respectively. While the overall YX/S was 1.4-fold lower than that of the wild-type, the YP/S and YP/X values were respectively 1.8- and 2.42-fold higher than those of the wild-type. 3.3. Intracellular bioreaction network rate analyses To evaluate the SAP synthesis performance of the recombinant B. licheniformis on a comparative quantitative basis, metabolic flux analyses were conducted by using the data obtained at the initial glucose concentration CG0 = 6.0 kg m−3 in V = 3.5 dm3 bioreactor systems at the air inlet rate of Q0 /VR = 0.5 vvm and agitation rate of N = 750 min−1 at pH0 = 7.25 and T = 37 ◦ C conditions for both the wild-type and recombinant B. licheniformis. Considering the biomass and SAP concentration and activity profiles, the bioprocess can be divided simply into two periods. Period I (0 < t ≤ 20 h) covers the exponential growth phase and period II (20 < t < 43 h) is the SAP synthesis period. The data at t1 = 6 h and t2 = 36 h were used to calculate the intracellular metabolic flux distributions in periods I and II, respectively. The extensive analysis of the broth did not reveal any pools of metabolic products that are not included in the model. The data obtained throughout the two types of SAP fermentation were exploited, using a linear optimisation approach, to calculate the specific growth rate and the uptake and excretion rates of the metabolites, i.e. the organic acids (Cit, Pyr, Ac) and the amino acids, and secretion rate of SAP. The measured net-output rates of metabolites that are derived from the data points of the batch-bioreactor experiments were used in the model in order to calculate the intracellular flux distributions according to Eqs. (2) and (3). In period I, Pyr, ␣KG and Cit, and among the amino acids serine (Ser), histidine (His), alanine (Ala), proline (Pro), Tyr, cysteine (Cys), isoleucine (Ile), leucine (Leu) and lysine (Lys) were produced in excess of cellular demand and excreted to the fermentation broth. In period II, among the organic acids, Pyr, and among the amino acids, His, Ala and Pro, were partly supplied from the fermentation broth; while threonine (Thr), phenylalanine (Phe) and Lys were excreted. In contrast, with the recombinant B. licheniformis only Pyr and (among the amino acids) glutamate (Glu), Thr, valine (Val), Met, Ile and Lys were excreted during period I, while the amino acids Tyr and Cys were partly supplied from the

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

fermentation broth. Further, in period II the organic acids, Pyr, Cit, Suc and Ac, and among the amino acids, Tyr and Met, were supplied from the broth; while Ser, His, Ala and Lys were excreted to the fermentation broth. 3.4. TDA The TDA approach provides a reasonable first approximation to the actual metabolic flux distributions in the cell in which the difference between SAP synthesis rate (R146) and SAP secretion rate were minimised. The metabolic flux distributions obtained, using TDA approach, for the wild-type and recombinant B. licheniformis in periods I and II are given in Table 3. In period I, the following metabolic patterns are found for both the wild-type and recombinant strains. The glycolysis pathway, the pentose phosphate pathway (PPP) (R21–R30), the TCA cycle (R37–R45) and the fluxes through the nucleotides (R93–R113), cofactors (R114–R119), fatty acids (R132–R136) and biomass components (R137–R144) are active; while the gluconeogenesis pathway reactions are inactive. On the other hand, in the recombinant strain for the connection of the glycolysis pathway to the TCA cycle, the anapleorotic reaction R148 catalysed by Pyr carboxylase and reaction R16 catalysed by Pyr dehydrogenase are both active while the glyoxylate shunt (R46, R47) is inactive; in the wild-type strain the connection of the glycolysis pathway to the TCA cycle achieved only by R16 and the glyoxylate shunt (R46, R47) is active. The glycolysis pathway flux values of the recombinant B. licheniformis are approximately 1.3- to 1.5-fold higher than those of the wild-type. The PPP flux values of oxidative reactions of the recombinant B. licheniformis are 2.0-fold lower than those of the wild-type, while the interconversion reaction flux values of the wild-type are ca. 2.5-fold higher than those of the recombinant strain. The TCA cycle fluxes of the wild-type B. licheniformis are higher than those of the recombinant B. licheniformis. The flux of the reaction (R37) catalysed by aconitase hydratase (EC 4.2.1.3) is 1.18and 0.58-fold than that of the glucose uptake rate for the wild-type and recombinant B. licheniformis, respectively. With glucose as carbon source, ATP is generated in the glycolysis pathway by the substrate-level phosphorylation reactions (R10, R14), and in the TCA cycle by both substrate-level phosphorylation (R41) and oxidative phosphorylation (R122, R123) reactions. The ATP generation rates throughout the fermentations, as represented by the results of periods I and II with the wild-type and recombinant B. licheniformis, are shown in Table 3. The ATP generation rate and the ATP used for the maintenance (R147) are ca. 1.8- and 2.70-fold higher than the wild-type Bacillus. The biomass formation rate (R145) was 1.15-fold higher than the wild-type and, in period I SAP synthesis rate was zero for both with the wild-type and recombinant B. licheniformis. The main branch points of amino acid biosynthesis are as follows: for the glutamic acid family amino acids, ␣KG; for the aspartic acid family, OA; for the Ala family, Pyr; for

715

the Ser family, PG3; for the aromatic amino acids, PEP and E4P; and for the His synthesis R5P. Among the amino acid biosynthetic pathways, the flux directed to glutamate from ␣KG (R73) is certainly important. Since ␣KG is a branch point in the TCA cycle, the magnitude of the flux diverted to glutamate synthesis influences the TCA cycle fluxes and, consequently, energy generation. According to the model, Glu is used for the biosynthesis of Ser (R48), Ala (R51), Val (R53), Leu (R54), Asp (R57), mDAP (R62), Ile (R66), Phe (R69), Tyr (R70), Glu (R74), Pro (R75) and ornithine (Orn; R76), while it is also produced from ␣KG (R73) via the catabolism reactions of Ala (R79), Pro (R90), Arg (R80), Val (R95) and His (R86) and by the biosynthesis reactions of Asn (R58), GMP (R98), CaP (R136), UDPNAG (R137). In period I, with the recombinant B. licheniformis a slight decrease in the TCA cycle fluxes from R38 to R39 was observed due to the synthesis of Glu from ␣KG (R73) as Glu was supplied from the other amino acid synthesis reactions. On the other hand, with the recombinant B. licheniformis a decrease in the TCA cycle fluxes from R38 to R39 was not observed as ␣KG, that was supplied from the synthesis of other amino acids, was used for Glu synthesis (R73). In period I, the fluxes towards Ala (R51), Leu (R54), His (R56), Phe (R69), Tyr (R70), Gln (R74), Pro (R75) and Arg (R78) with the wild-type are higher than those in the recombinant strain. In the recombinant B. licheniformis, the fluxes through the main branch point OA to Asp (R57), AspSa (R59), HSer (R64), Thr (R65) and Ile (R66), and the fluxes through KVal (R52) and Val (R53) are high due to respectively high Ile and Val synthesis rates. In contrast to the results from period I, the metabolic flux distributions calculated with the TDA approach for the wild-type and recombinant B. licheniformis in period II show that biomass formation flux (R145) reached zero, while (as expected) flux R146 increased due to the SAP synthesis in both strains. Nevertheless, the SAP synthesis flux (R146) of the recombinant B. licheniformis was 4.0-fold higher than that of the wild-type. The analysis of the dynamic bioprocess with the each strain reveal that in period II the glycolysis pathway fluxes slow down by ca. 25-fold with respect to the flux values obtained in period I. Nevertheless, in common with the results of period I, the period II glycolysis pathway fluxes of the recombinant B. licheniformis is ca. 1.5-fold higher than those of the wild-type. In period II, the PPP is also active in both strains, and the total flux to R5P is higher in the recombinant B. licheniformis, in contrast to the values obtained in period I. Further, the TCA cycle fluxes of the recombinant B. licheniformis are ca. 5.5-fold higher than those of the wild-type due to the increased ATP requirement for SAP synthesis and maintenance of the cell. The flux of the reaction (R37) catalysed by aconitase hydratase (EC 4.2.1.3) is 2.8 and 7.7 times the glucose uptake rate respectively for the wild-type and recombinant B. licheniformis. Further, at the Pyr node the flux of the reaction R16 catalysed by the Pyr carboxylase (EC 4.1.1.1) is 5.3-fold higher in the recombinant than that of the wild-type. The difference between the

716

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

Table 3 Variation in metabolic flux distributions for SAP production in the wild-type and recombinant Bacillus licheniformis (reaction rows having zero flux values have been eliminated) R#

TDA period I Recombinant bacilli (mmol g−1 DW h−1 )

1 4 8 9 10 12 14 15 16 17 20 21 22 23 24 25 28 29 34 25 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74

4.71000 4.62300 4.61600 0.00000 9.21500 9.01400 4.25400 0.00000 2.82800 0.07500 0.07500 0.00000 0.00000 0.01300 0.00000 0.01300 0.01300 0.01100 0.37400 0.00000 0.00000 2.75100 2.75100 2.75100 2.62800 2.62800 0.00000 2.62800 2.67800 2.67800 0.00000 0.00000 0.20100 0.12300 0.04500 0.03900 0.29000 0.25900 0.03100 0.06000 0.00700 2.51800 0.01600 2.40500 0.02500 0.02800 0.02800 0.02600 2.37700 2.23900 2.04000 0.13800 0.02400 0.01500 0.00700 0.00400 0.00400 5.27800 0.15600

TDA period II Wild-type bacilli (mmol g−1 DW h−1 ) 3.46000 3.30000 3.32500 0.00000 6.64500 6.48900 2.96300 0.00000 4.92200 0.14700 0.14700 0.03300 0.00000 0.03300 0.00000 0.03300 0.00000 0.03100 0.16700 0.00000 0.00000 4.08800 4.08300 3.48100 3.08600 3.08600 0.00000 3.68800 3.75400 4.35600 0.60200 0.60200 0.15600 0.07200 0.03900 0.12300 0.06900 0.03300 0.03600 0.07800 0.01800 0.26800 0.01800 0.13100 0.07800 0.07800 0.07800 0.07500 0.05300 0.04200 0.02200 0.01100 0.03100 0.07600 0.01300 0.00400 0.00400 0.93400 0.18500

Recombinant bacilli (mmol g−1 DW h−1 ) 0.20000 0.19100 0.19100 0.00000 0.37900 0.34000 0.12200 0.00000 2.27800 0.00900 0.00900 0.00000 0.00000 0.00400 0.00000 0.00400 0.00400 0.00400 0.66400 0.00000 1.64300 1.55500 1.67500 0.03100 0.29400 0.29400 0.00000 1.90000 1.90600 3.27100 1.36500 1.36500 0.03900 0.01300 0.00100 0.02400 0.02800 0.01900 0.10000 0.00400 0.00400 0.07300 0.01100 0.02600 0.00700 0.00700 0.00700 0.00700 0.01900 0.01800 0.00600 0.00100 0.00900 0.00600 0.00600 0.00060 0.00060 0.20700 0.02200

TDC analysis period II Wild-type bacilli (mmol g−1 DW h−1 )

Recombinant bacilli (mmol g−1 DW h−1 )

Wild-type bacilli (mmol g−1 DW h−1 )

0.12500 0.12500 0.12000 0.00000 0.23300 0.22400 0.07500 0.00000 0.42900 0.00000 0.00000 0.00000 0.00500 0.00400 0.00000 0.00400 0.00800 0.00400 0.05900 0.00000 0.00000 0.35100 0.35100 0.27500 0.27100 0.74200 0.00000 0.34700 0.34900 0.42500 0.07600 0.07600 0.00900 0.00300 0.00075 0.00600 0.00700 0.00500 0.00200 0.00090 0.00075 0.07400 0.00300 0.06900 0.05600 0.05600 0.05600 0.05600 0.01300 0.01200 0.00100 0.00075 0.01200 0.00100 0.00200 0.00015 0.00015 0.17000 0.00500

0.20000 0.20000 0.16600 0.00000 0.28800 0.07600 0.00000 0.24400 0.00000 0.00000 0.00000 0.00000 0.03400 0.01300 0.00000 0.01300 0.04700 0.01300 0.74400 0.00000 0.00000 0.46200 0.58200 0.43400 0.34400 0.34400 0.00000 0.73200 0.76400 0.76300 0.14900 0.14900 0.21200 0.07700 0.01600 0.13800 0.16200 0.10700 0.05500 0.02100 0.01800 0.30100 0.06200 0.15200 0.03300 0.03300 0.03300 0.03300 0.11900 0.10400 0.03500 0.01600 0.06000 0.03500 0.04300 0.00300 0.00300 1.05800 0.12100

0.12500 0.12500 0.11400 0.00000 0.21200 0.16600 0.00000 0.00000 0.12100 0.00000 0.00000 0.00000 0.01100 0.00600 0.00000 0.00600 0.01700 0.00600 0.07600 0.00000 0.00000 0.11200 0.11200 0.11200 0.09200 0.09200 0.00000 0.09200 0.09900 0.09900 0.00000 0.00000 0.04700 0.01700 0.00400 0.03100 0.03600 0.02400 0.01200 0.00500 0.00400 0.12400 0.01400 0.09600 0.06100 0.06100 0.06100 0.06100 0.03400 0.03100 0.00800 0.00400 0.02300 0.00800 0.01000 0.00077 0.00077 0.35600 0.02700

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

717

Table 3 (Continued ) R#

75 76 77 78 84 96 97 98 99 100 102 103 104 105 106 107 108 109 110 113 114 115 116 117 118 119 120 121 122 123 124 126 128 129 130 132 133 134 135 136 137 138 139 140 141 142 144 145 146 147 148

TDA period I

TDA period II

TDC analysis period II

Recombinant bacilli (mmol g−1 DW h−1 )

Wild-type bacilli (mmol g−1 DW h−1 )

Recombinant bacilli (mmol g−1 DW h−1 )

Wild-type bacilli (mmol g−1 DW h−1 )

Recombinant bacilli (mmol g−1 DW h−1 )

Wild-type bacilli (mmol g−1 DW h−1 )

0.01200 0.02500 0.02000 0.02000 0.00000 0.01900 0.02600 0.01600 0.01600 0.02400 0.00100 0.00100 0.01000 0.30600 0.03100 0.03100 0.02900 0.01400 0.00100 0.00100 0.00100 0.06200 0.01380 0.04500 0.04500 0.00000 10.75400 0.00000 6.95600 2.62800 7.82700 3.21900 0.18300 0.31500 0.15600 0.00900 0.00200 0.00200 0.01900 0.05100 0.00500 0.00200 0.00200 0.00200 0.00200 0.01200 0.00100 0.07300 0.00000 18.53000 2.59100

0.01400 0.02800 0.02300 0.02300 1.2820 0.02200 0.03900 0.01800 0.01800 0.03800 0.00200 0.00200 0.02100 0.20900 0.03500 0.03500 0.03300 0.01500 0.00200 0.00200 0.00200 0.00300 0.01100 0.06100 0.06100 0.00000 0.00000 1.76100 21.06700 3.68800 11.74800 1.09800 0.05000 0.22000 0.17600 0.01100 0.00200 0.00200 0.02100 0.05800 0.00600 0.00200 0.00200 0.00200 0.00200 0.01400 0.00100 0.08200 0.00000 50.14600 0.00000

0.00500 0.00200 0.00200 0.00200 0.00000 0.00000 0.00400 0.00000 0.00000 0.00400 0.00000 0.00000 0.00400 0.02400 0.00000 0.00000 0.00000 0.00000 0.000000 0.00000 0.00000 0.00000 0.00100 0.00400 0.00400 0.00800 0.00000 0.00000 6.27700 1.90000 4.55000 0.22900 0.00300 0.02400 0.00000 0.00000 0.000000 0.00000 0.00000 0.00200 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00060 14.24600 0.00000

0.02000 0.00060 0.00060 0.00060 0.00000 0.00000 0.00075 0.00000 0.00000 0.00075 0.00000 0.00000 0.00075 0.00600 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00075 0.00075 0.00075 0.00200 0.06300 0.00000 1.30800 0.34700 1.04200 0.17500 0.00100 0.00600 0.00000 0.00000 0.00000 0.00000 0.00000 0.00060 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00015 3.24400 0.00000

0.02500 0.01400 0.01400 0.01400 0.00000 0.00000 0.01800 0.00000 0.00000 0.01800 0.00000 0.00000 0.01800 0.14700 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.01600 0.01800 0.01800 0.04400 1.24200 0.00000 0.45400 0.73200 1.00900 1.17300 0.03200 0.14700 0.24400 0.00000 0.00000 0.00000 0.00000 0.01400 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00300 0.00000 0.00000

0.02600 0.00300 0.00300 0.00300 0.00000 0.00000 0.00400 0.00000 0.00000 0.00400 0.00000 0.00000 0.00400 0.03300 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00400 0.00400 0.00400 0.01000 0.55100 0.00000 0.04000 0.09200 0.27100 0.38100 0.00800 0.03300 0.00600 0.00000 0.00000 0.00000 0.00000 0.00300 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00000 0.00077 0.00000 0.13700

flux R16 that produces AcCoA from Pyr and the flux R37 that produces Cit from AcCoA is caused by the increased requirement for Ala family amino acid biosynthesis in the recombinant strain compared to the wild-type. The ATP generation and, further, the ATP used for maintenance (R147) in period II are approximately 4.5- and 4.4-fold higher in the recombinant B. licheniformis (Table 3).

In period II, a slight decrease in the TCA cycle fluxes from R38 to R39 was observed with the wild-type due to Glu synthesis from ␣KG (R73) for the synthesis of the other amino acids, as Glu and Gln (R74) serve as the donor of virtually all amino and amide groups in cellular components, either by the direct participation of glutamine in biosynthetic reaction or through the action of glutamate as a substrate for

718

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

transamination reaction. In period II with the recombinant B. licheniformis, in contrast to period I results, a considerable decrease in the TCA cycle fluxes is observed as a part of ␣KG directed to Glu and the syntheses of other amino acids. In period II, except for the fluxes through Lys (R59–R63) and Phe (R68, R69), the amino acid fluxes of the recombinant B. licheniformis are at least 3.0-fold higher than those of the wild-type. When periods I and II amino acid fluxes of the wild-type B. licheniformis are compared, it is clear that all the amino acid fluxes in period I are higher than those of period II (Table 3). Nevertheless, with the recombinant B. licheniformis the fluxes through Ala (R51), His (R56) and Asn (R58) are increased to higher values in period II; this shows the importance of the fluxes of Ala (R51), His (R56) and Asn (R58) for SAP synthesis. 3.5. TDC analysis By using the TDC analysis approach, in which SAP synthesis rate is maximised for SAP production, metabolic flux distributions were obtained to determine the SAP synthesis capacities of the wild-type and the recombinant strains for period II alone and are presented in Table 3. This analysis allows the determination of the theoretical ultimate limits to SAP production by wild-type and recombinant cells. This is a prerequisite for the successful application of metabolic engineering to obtain increased yield and selectivity by predicting the changes in the fluxes and rate-controlling step(s). The SAP synthesis rates of the wild-type and recombinant B. licheniformis obtained by the TDC analysis are ca. 5.0-fold higher than those produced by the TDA approach. Further, the TDC analysis results show that the glycolysis pathway fluxes and the TCA cycle fluxes are lower than those from the TDA approach. The PPP fluxes are higher than the TDC analysis flux values, and the glucose utilised through the PPP is ca. 23 and 13% of the total glucose uptake rate, respectively, with the recombinant and with the wild-type strains. The increase in the PPP fluxes of the TDC analysis is due to the increase in the demand of each strain for His and aromatic acid group amino acids which are produced via the PPP metabolites. On the other hand, all amino acid fluxes were higher than the flux values obtained with the TDA approach; this shows that, for higher SAP production, the fluxes towards the amino acids need to be high. With the wild-type strain and recombinant B. licheniformis, ATP is not used to supply maintenance energy and this shows the energy limitation of the bioreaction network. The actual fluxes calculated with the TDA approach show that ATP is used for the maintenance energy which indicates that bioreaction network is carbon limited.

4. Conclusions Characterising the changes in physiology of the recombinant B. licheniformis in response to environmental change

should be considered a valuable contribution to establishing strategies for metabolic optimisation of the bioprocess for SAP production. Significant physiological changes were observed in the recombinant B. licheniformis in response to an altered bioreactor-operation condition, i.e. initial glucose concentration. Optimum glucose concentration for maximum SAP production and the corresponding cultivation time of the recombinant B. licheniformis shifted respectively from CG0 = 6 to 8 kg m−3 and from t = 43 to 67 h. Moreover, SAP activity doubled in the recombinant B. licheniformis with CG0 = 6 kg m−3 , and a further increase was achieved with the recombinant B. licheniformis with the increase in CG0 to 8 kg m−3 . An increase in SAP production, and (consequently) in SAP activity, was achieved by cloning additional copies of the subC gene at the initial glucose concentration of CG0 = 6 kg m−3 ; this is due to a more efficient metabolic state maintaining the productivity of SAP by a wide array of regulatory responses in the metabolic reaction network. The comparison of the intracellular metabolic reaction network fluxes of the wild-type and recombinant B. licheniformis verifies the metabolic shifts by showing increases in the fluxes of more energetically efficient pathways towards the amino acid biosynthesis pathways for SAP production. The catabolite repression effect of glucose on protease synthesis was reported by Priest [31], Frankena et al. [32,33] and Çalık et al. [34]. In period I, due to the high glycolysis pathway fluxes SAP is not synthesised. However, in period II, the fluxes of the glycolysis pathway decrease below 1.0 and this resulted in a stimulation of SAP synthesis. Therefore, during SAP synthesis the glycolysis pathway fluxes should be low due to the regulation effects of the glycolysis pathway metabolite levels. On the other hand, during the SAP synthesis period the TCA cycle fluxes are high. This shows that the TCA cycle metabolites do not have a catabolite repression effect on SAP synthesis. These results are in good agreement with the results of Çalık et al. [1] with the wild-type B. licheniformis. All in all, this encourages the design of a bioprocess medium, where glucose is substituted with any of the TCA cycle organic acids or with Pyr or with the economic substrate Ac, in order to achieve a constitutively high level of SAP production. Alternatively, the development of a glucose-feeding regime that maintains the glycolysis pathway fluxes below 0.5 mmol g−1 DW h−1 should enhance SAP production. Throughout the dynamic bioprocess, the actual flux distributions differ considerably between the wild-type and recombinant B. licheniformis, as expected. The normalised relative flux values with respect to the glucose uptake rate were also analysed and it was seen that only the glycolysis pathway relative flux distributions do not change significantly for the wild-type and the recombinant organisms. Nevertheless, the changes in the relative fluxes of all the other pathways show that the wild-type and the recombinant B. licheniformis do not have identical behaviour in response to the physiological change. These results validate

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

a bioprocess strategy that maintains the glycolysis pathway fluxes below a certain level. Furthermore, when actual fluxes (mmol g−1 DW h−1 ) are compared in the SAP synthesis period, the glycolysis pathway fluxes, the PPP reaction fluxes, the TCA cycle fluxes, and (consequently) the fluxes towards the amino acids, are higher in the recombinant than in the wild-type organism; these changes stimulate higher SAP synthesis. On the other hand, in the biomass formation period, the TCA cycle and the PPP fluxes of the wild-type strain were higher than those of the recombinant, confirming that the PPP reaction fluxes are indeed important for biomass synthesis. An effectiveness factor η, defined as the SAP synthesis rate per maximum possible SAP synthesis rate, was calculated for the recombinant B. licheniformis as 0.20. This indicates that SAP synthesis can be increased further, and we are currently studying the use of different Bacillus strains as hosts for SAP production. Acknowledgments This work is a part of The British Council Academic Link Scheme between Ankara University Biotechnology Research Center and the Manchester Biotechnology Centre (UMIST). P. Çalık was the recipient of a TUBITAK-NATO Science Fellowship (A2). P. Çalık and T.H. Özdamar gratefully acknowledge the support of the British Council within the Academic Link Scheme. The genetic engineering experimental programme was started by P. Çalık in Manchester and continued in Ankara University with the establishment of the Genetic Engineering Laboratory by the SPO-TUBITAK (Turkey) Grant 97K120590. G.C. Tomlin was supported by a research studentship from BBSRC. Appendix A. Abbreviations used in the metabolic flux map Ac AcCoA ADP Ala Arg Asn Asp AspSa ATP Chor Cit Citr Cys DC E4P F6P FADH Fum

Acetate Acetyl coenzyme A Adenosine 5 -diphosphate l-Alanine l-Arginine l-Asparagine l-Aspartate Aspartate semi-aldehyde Adenosine 5 -triphosphate Chorismate Citrate Citruline l-Cysteine l-2,3-Dihyrodipicolinate Erythrose 4-phosphate Fructose 6-phosphate Flavine adenine dinucleotide (reduced) Fumarate

719

Appendix A (Continued ) G6P Glc Gln Glu Glx Gly His HSer Icit IGP Ile ␣KG Kval Lac Leu Lys Mal mDAP Met NADH NADPH

OA Orn PEP PG3 Phe PPP Pro PRPP Pyr R5P Rib5P S7P Ser Suc SucCoA Xyl5P T3P TCA Tet Thr Trp Tyr Val

Glucose 6-phosphate Glucose l-Glutamine l-Glutamate Glyoxlate l-Glycine l-Histidine Homoserine Isocitrate Indole glycerol phosphate l-Isoleucine ␣-Ketoglutarate Ketovaline Lactate l-Leucine l-Lysine Malate meso-Diaminopimelate l-Methionine Nicotinamide adenine dinucleotide (reduced) Nicotinamide adenine dinucleotide phosphate (reduced) Oxaloacetate Ornithine Phospho(enol)pyruvate Glycerate 3-phosphate l-Phenylalanine Pentose phosphate pathway l-Proline 5-Phospo-d-ribosylpyrophosphate Pyruvate Ribulose 5-phosphate Ribose 5-phosphate Sedoheptulose 7-phosphate l-Serine Succinate Succinate coenzyme A Xylulose 5-phosphate Triose 3-phosphate Tricarboxylic acid l-2,3,4,5-Tetrahydrodipicolinate l-Threonine l-Tyrptophan l-Tyrosine l-Valine

References [1] Çalık P, Çalık G, Özdamar TH. Oxygen transfer effects in serine alkaline protease fermentation by Bacillus licheniformis: use of citric acid as the carbon source. Enzyme Microb Technol 1998;23:451– 61.

720

P. Çalik et al. / Enzyme and Microbial Technology 32 (2003) 706–720

[2] Çalık P, Çalık G, Takaç S, Özdamar TH. Metabolic flux analysis for serine alkaline protease fermentation by Bacillus licheniformis in a defined medium: effects of the oxygen transfer rate. Biotechnol Bioeng 1999;64:151–67. [3] Çalık P, Çalık G, Özdamar TH. Oxygen transfer strategy and its regulation effects in serine alkaline protease production by Bacillus licheniformis. Biotechnol Bioeng 2000;69:301–11. [4] Çalık P, Çalık G, Takaç S, Özdamar TH. Metabolic flux analysis for serine alkaline protease production. Enzyme Microb Technol 2000;27(10):793–805. [5] Çalık P, Takaç S, Çalık G, Özdamar TH. Serine alkaline protease overproduction capacity of Bacillus licheniformis. Enzyme Microb Technol 2000;64:45–60. [6] Çalık P, Özdamar TH. Effects of carbon sources on metabolic capacity of Bacillus licheniformis for serine alkaline protease, neutral protease and ␣-amylase production. Biochem Eng J 2001;8(1):61–81. [7] Maniatis T, Fritsch EF, Sambrook J. Molecular cloning—a laboratory manual. USA: Cold Spring Harbor Laboratory; 1982. [8] Bullock WO, Fernandez JM, Short JM. XL1-Blue—a high-efficiency plasmid transforming recA Escherichia coli strain with beta-galactosidase selection. Biotechniques 1987;5:376. [9] Yanisch-Perron C, Viera J, Messing J. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 1985;33:103–19. [10] Çalık P. Bioprocess development for serine alkaline protease production, Ph.D. thesis, Ankara University, Ankara, 1998. [11] Posprech A, Neumann B. A versatile quick-prep of genomic DNA from Gram-positive bacteria. Trends Genet 1995;11(6):217–8. [12] Vehmaanperä J. Transformation of Bacillus amyloliquefaciens by electroporation. FEMS Microbiol Lett 1989;61:165–70. [13] Jacobs M. Expression of the subtilisin Carlsberg-encoding gene in Bacillus licheniformis and Bacillus subtilis. Gene 1995;152:69–74. [14] Sikorski RS, Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 1989;122:19–27. [15] Janniere L, Braund C, Ehrlich D. Structurally stable Bacillus subtilis cloning vectors. Gene 1990;87:53–61. [16] Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 1959;31:426–8. [17] Bidlinmeyer BA, Cohen SA, Tarvin TL. Rapid analysis of amino acids using pre-column derivatization. J Chromatogr 1984;336:93– 104. [18] Çalık P, Özdamar TH. Mass flux balance based model and metabolic pathway engineering analysis for serine alkaline synthesis by Bacillus licheniformis. Enzyme Microb Technol 1999;24:621–35. [19] Çalık P, Özdamar TH. Metabolic flux analysis for industrial microorganisms: a review. Rev Chem Eng 2002;18(6):553–96. [20] Lopez JM, Marks CL, Freese E. The decrease of guanine nucleotides initiates sporulation of Bacillus subtilis. Biochim Biophys Acta 1979;587(2):238–52.

[21] Perego M, Spiegelman GB, Hoch JA. Structure of the gene for the transition state regulator, abrB: regulator synthesis is controlled by the spo0A sporulation gene in Bacillus subtilis. Mol Microbiol 1988;2(6):689–99. [22] Ferrari E, Henner DJ, Perego M, Hoch GB. Transcription of Bacillus subtilis subtilisin and expression of subtilisin in sporulation mutants. J Bacteriol 1988;170(1):289–95. [23] Vasantha N, Freese E. Enzyme changes during Bacillus subtilis sporulation caused by deprivation of guanine nucleotides. J Bacteriol 1980;144(3):1119–25. [24] Msadek T, Kunst F, Henner D, Klier A, Rapoport G, Dedonder R. Signal transduction pathway controlling synthesis of a class of degradative enzymes in Bacillus subtilis: expression of the regulatory genes and analysis of mutations in degS and degU. J Bacteriol 1990;172:824–34. [25] Bierbaum G, Giesecke UE, Wandrey C. Analysis of nucleotide pools during protease production by Bacillus licheniformis. Appl Microbiol Biotechnol 1991;35:725–30. [26] Ferrari E, Jarnagin AS, Schmidt BF. Commercial production of extracellular enzymes. In: Sonenshein AL, Hoch JA, Losick R, editors. Bacillus subtilis and other Gram-positive bacteria: biochemistry, physiology, and molecular genetics. Washington, DC: American Society for Microbiology; 1993. p. 917–37. [27] Wang LF, Doi RH. Complex character of senS, a novel gene regulating expression of extracellular-protein genes of Bacillus subtilis. J Bacteriol 1991;172(4):1939–47. [28] Gaur NK, Oppenheim J, Smith I. The Bacillus subtilis sin gene, a regulator of alternate developmental processes, codes for a DNA-binding protein. J Bacteriol 1991;173:678–86. [29] Perego M, Hoch GB, Hoch JA. Sequence analysis and regulation of the hpr locus, a regulatory gene for protease production and sporulation in Bacillus subtilis. J Bacteriol 1988;170(6): 2560–7. [30] Honjo M, Nakayama A, Fukazawa K, Kawamura K, Ando K, Hori M, et al. A novel Bacillus subtilis gene involved in negative control of sporulation and degradative-enzyme production. J Bacteriol 1990;172(4):1783–90. [31] Priest FG. Extracellular enzyme synthesis in the genus Bacillus. Bacteriol Rev 1977;41:71–753. [32] Frankena J, van Verseveld HW, Stouthamer AH. A continuous culture study of the bioenergetic aspects of growth and production of exocellular protease in Bacillus licheniformis. Appl Microbiol Biotechnol 1985;22:169–76. [33] Frankena J, Koningstein GM, Verseveld HW, Stouthamer AH. Effect of different limitations in chemostat cultures on growth and production of exocellular protease by Bacillus licheniformis. Appl Microbiol Biotechnol 1986;24:106–12. [34] Çalık P, Çalık G, Özdamar TH. Bioprocess development for serine alkaline protease production: a review. Rev Chem Eng 2001;17(Suppl S):1–62.