Overexpression of Escherichia coli nucleotide excision repair genes after cisplatin-induced damage

DNA Repair 12 (2013) 63–72

Contents lists available at SciVerse ScienceDirect

DNA Repair journal homepage: www.elsevier.com/locate/dnarepair

Overexpression of Escherichia coli nucleotide excision repair genes after cisplatin-induced damage Deise Fonseca Felício a , Leonardo da Silva Vidal a , Roberto Silva Irineu b,d , Alvaro Costa Leitão a , Wanda Almeida von Kruger b , Constanc¸a de Paoli Britto c , Angélica Cardoso c , Janine Simas Cardoso a , Claudia Lage d,∗ a

Laboratório de Radiobiologia Molecular, Instituto de Biofísica Carlos Chagas Filho, UFRJ, Brazil Unidade Genômica, Instituto de Biofísica Carlos Chagas Filho, UFRJ, Brazil c Departamento de Bioquímica e Biologia Molecular, Instituto Oswaldo Cruz, Brazil d Laboratório de Radiac¸ões em Biologia, Instituto de Biofísica Carlos Chagas Filho, Brazil b

a r t i c l e

i n f o

Article history: Received 15 May 2012 Received in revised form 25 October 2012 Accepted 30 October 2012 Available online 12 December 2012 Keywords: Cisplatin Escherichia coli Nucleotide excision repair

a b s t r a c t Cisplatin is currently used in tumor chemotherapy to induce the death of malignant cells through blockage of DNA replication. It is a commonly used chemotherapeutic agent binding mono- or bifunctionally to guanines in DNA. Escherichia coli K12 mutant strains deficient in nucleotide excision repair (NER) were submitted to increasing concentrations of cisplatin, and the results revealed that uvrA and uvrB mutants are sensitive to this agent, while uvrC and cho mutants remain as the wild type strain. The time required for both gene expression turn-off and return to normal weight DNA in wild-type E. coli was not accomplished even after 4 h post-treatment with cisplatin, while the same process takes place within 1.5 h after ultraviolet radiation (UV). Besides, a heavily damaging action of cisplatin can be seen not only by persistent nicks on genomic DNA, but also by NER gene expression exceeding manifold that seen after equivalent lethal doses of UV. Moreover, cisplatin caused an increase in uvrB gene expression from its putative upstream promoter P3 in an SOS-independent manner. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The inorganic compound cis-diamminedichloroplatinum (II), commonly referred to as cisplatin (cis-Pt) or cis-DDP, is one of the most potent chemotherapeutic anticancer drugs. Its biological activity was discovered in the early sixties [1,2] and it was approved in 1978 for clinical treatment. It is clinically used against a wide variety of tumors, including testicular, ovarian, esophageal, head and neck, and lung cancer [3]. Cisplatin-bound chloride ions are rapidly displaced in solution by neighbor water hydroxyl groups [4], generating the so-called aqua species. These species are strong bifunctional electrophilic agents [5] actively attacking any nucleophilic site present in DNA, especially guanines amongst the four nucleic acid residues. Such association was thought as triggering cis-Pt-induced anti-tumor and pro-carcinogenic dual actions, firstly believed to target O6 -guanine [6]. One year later, this proposal was amended [7], since the reactivity of cis-Pt with a

∗ Corresponding author at: Lab. Radiac¸ões em Biologia, Programa de Biologia Molecular e Estrutural, Instituto de Biofísica Carlos Chagas Filho – UFRJ, Centro de Ciências da Saúde, Bloco G, 21941-540 Rio de Janeiro, RJ, Brazil. Tel.: +55 21 2562 6576; fax: +55 21 2280 8193. E-mail address: [email protected] (C. Lage). 1568-7864/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.dnarep.2012.10.009

guanine-like structure (1,3,9-trimethylxanthine) showed it to bind to N7 and not to O6 sites. Further studies revealed cis-Pt to target N7 positions in purines and N3 adenines. The interaction between cis-Pt and DNA can result in monoand bifunctional adducts, as well as DNA–protein crosslinks. Bifunctional adducts, which can take the forms of either intra- or inter-strand crosslinks, may cause major local distortions of DNA structure, involving both bending and unwinding of the double helix. By forming adducts to DNA, cis-Pt can inhibit DNA replication and chain elongation [8], which is believed to be one of the main causes of its antineoplastic activity. Nevertheless, it has never been elucidated whether one of those adducts is critical for the observed cytotoxic effects of cis-Pt. The intra-strand crosslinks cis-Pt–(NH3 )2 -d(GpG) (60–65% of the total) and cis-Pt–(NH3 )2 d(ApG) (22–30%) are the most abundant cis-Pt induced-damage [9,10]. Inter-strand crosslinks represent a small amount of the total cis-Pt lesions, even though many authors have suggested their important contribution on the cytotoxic effects attributed to the drug. Many studies have focused on nucleotide excision repair (NER) after evidence has implicated it as one important cellular response involved in the elimination of the induced genotoxic effects of cis-Pt [11]. Of note is its ability to recognize a vast repertoire of unrelated damaged base substrates, achieving the removal of the

64

D.F. Felício et al. / DNA Repair 12 (2013) 63–72

damage by hydrolyzing phosphodiester bonds on both sides of the lesion. NER mediated by the UvrABC complex in Escherichia coli is among the best characterized DNA repair systems [12]. In vitro, NER was shown to begin with the ATP-dependent dimerization of UvrA thus matchmaking UvrB to the DNA, to form either a UvrA2 B or UvrA2 B2 complex [13,14] which scans DNA, halts at the damaged site, and binds to it. This binding activates the UvrB-dependent helicase function and leads to a local unwinding/kinking that allows further coupling of UvrB to the damaged strand. Such strand opening causes the dissociation of UvrA2 and the formation of a stable complex between UvrB and damaged-DNA [15] then enabling the binding of UvrC producing dual incisions surrounding the damage [12]. After the dual incisions, both DNA polymerase I (DNA pol I) and UvrD (helicase II) remove the postincision complex, allowing DNA pol I to synthesize the repair patch which is sealed by DNA ligase [16,17]. The cis-Pt-induced pool of DNA damage appears to be differently repaired by NER. It has been shown [18] that 1,2-GG ICLs are efficiently excised by this system. Interestingly, the 1,2-GG intra-strand biadducts were more efficiently repaired by the E. coli UvrABC endonuclease in vitro than the 1,3-GNG ones [19]. Consistent with earlier observations, 1,3-intrastrand biadducts were repaired considerably better than 1,2-intrastrand biadducts in vitro by the mammalian excinuclease complex in contrast to what had been determined for the E. coli UvrABC excinuclease. The latter results support the view that NER different efficiency to remove 1,2and 1,3-intra-strand biadducts may result from particular conformational constraints inflicted to DNA by each one [20,21]. Within the eukaryotic kingdom, differential repair of adducts may arise from different fits between DNA repair proteins and each substrate damage and, besides the NER mainframe [22], other DNA binding proteins do seem to affinity attach to cisplatin adducts, as hMSH2 [23] and HMGB1 [24], although it is still arguable whether recognition of such cis-Pt adducts by different proteins effectively promotes their repair or blocks the access of downstream proteins. Following left unanswered points concerning repair of cis-Ptinduced damage, this study was designed to evaluate the response of different E. coli wild-type and NER mutants in terms of survival, amount of DNA strand breaks and expression of main repair genes after treatment with cis-Pt. Indeed cis-Pt-induced damage appear to have a persistent effect and lead cells to an overexpressed state of DNA repair genes, what is discussed in terms of the correlation with its highly genotoxic action.

2. Materials and methods 2.1. Bacterial strains The E. coli K-12 strains used in this study are listed in Table 1. 2.2. Cisplatin Cisplatin (astaplatin 1 mg/ml) was purchased from Pharmachemie B.V. Haarlem – The Netherlands (Asta Medica Ltd.). 2.3. Growth conditions Bacterial cultures were obtained by transferring 50 ␮l aliquots from 50%-glycerol stocks at −20 ◦ C to 10 ml LB (Lysogeny Broth) medium [27] containing the appropriate antibiotics. These cultures were grown overnight at 37 ◦ C with shaking (150 rpm), and then kept for use up to one week at 4 ◦ C. Survival experiments were performed with fresh mid-exponential cultures prepared from the refrigerated stocks, by diluting it 1:40 in fresh LB medium and shaking at 37 ◦ C to reach ca. 2 × 108 cells/ml (O.D.600 = 0.5). 2.4. Treatment with cisplatin Cultures in the mid-exponential growth phase were washed (7710 × g, 10 min each, 4–10 ◦ C), and resuspended in M9 buffer [27]. After washing, one aliquot was taken for titration of the initial cell viability. The remaining culture was split into 2-ml samples from each culture and treated with the cis-Pt doses indicated on the survival graphs’ abscissas, at 37 ◦ C for up to 60 min under vigorous shaking (240 rpm). 2.5. Measurement of bacterial inactivation by cisplatin After treatment with cis-Pt at the indicated concentrations, aliquots were diluted in M9 buffer, and plated in LB containing 1.5% agar. Plates were incubated at 37 ◦ C for 24 h, and the colonies were scored. Survival was calculated by dividing the number of remaining viable cells at each dose (N) by those of the initial titer (No ). The results are expressed as the mean and standard errors of at least three independent experiments. N/No was plotted in semi-logarithmic graphs as a function of the concentration of cis-Pt (␮g ml−1 ).

Table 1 Main genetic markers of the Escherichia coli K12 strains used in this study. Designation

Relevant genotype

Source

GW1000 GW1000 SOS Ind− GW1000/pIC552 GW1000/pIC552:uvrB3 GW1000/pIC552:uvrB2 GW1000/pIC552:uvrA GW1000 SOS−/pIC552 GW1000 SOS−/pIC552:uvrB3 GW1000 SOS−/pIC552:uvrB2 GW1000 SOS−/pIC552:uvrA AB1157 AB2463 KA797 CS5539 CS5017 CS4926 CS5540 CS5018 CS5638 RJF674 RJF675

[GC3217] tif sfi pro+ lac(U169) recA+ lexA+ [GW1000] (lexA1Ind− ) recA+ [GW1000] pIC552 (empty vector) [GW1000] pIC552:uvrBP1P2P3 [GW1000] pIC552:uvrBP1P2 [GW1000] pIC552:uvrA [GW1000] SOS Ind− pIC552 (empty vector) [GW1000] SOS Ind− pIC552:uvrBP1P2P3 [GW1000] SOS Ind− pIC552:uvrBP1P2 [GW1000] SOS Ind− pIC552:uvrA Wild type [AB1157] recA13 Wild type [KA797] uvrA [KA797] uvrB [KA797] uvrC [KA797] cho [KA797] uvrA uvrB [KA797] uvrB uvrC [CS4926] uvrA [CS4926] cho

G. Walker, MIT, Cambridge, USA G. Walker, MIT, Cambridge, USA Our laboratory Our laboratory Our laboratory Our laboratory Our laboratory Our laboratory Our laboratory Our laboratory P. Howard-Flanders, Yale University, USA P. Howard-Flanders, Yale University, USA N. Goosen, Leiden University, The Netherlands N. Goosen, Leiden University, The Netherlands N. Goosen, Leiden University, The Netherlands N. Goosen, Leiden University, The Netherlands N. Goosen, Leiden University, The Netherlands N. Goosen, Leiden University, The Netherlands N. Goosen, Leiden University, The Netherlands Our laboratory Our laboratory

D.F. Felício et al. / DNA Repair 12 (2013) 63–72

65

Table 2 Main genetic markers of plasmids used in this study. Designation

Relevant characteristics

Reference

pNP12 pNP50 pNP120 pIC552 pIC552-uvrB3 pIC552-uvrB2 pIC552-uvrA

pACY177 ApS KmR vector containing the intact uvrB gene and promoter regions Equivalent to pNP12 but without P3 uvrB promoter pWU1 TcR ; contains the intact uvrA gene and promoter regions vector containing the lacZ reporter gene, ApR Recombinant pIC552 containing the entire uvrB promoter region from pNP12 fused to lacZ Recombinant pIC552 containing the SOS-regulated uvrB promoters from pNP50 fused to lacZ Recombinant pIC552 containing the intact uvrA promoter region from pNP120 fused to lacZ

Van den Berg et al. [25] Moolenaar et al. [26] Moolenaar et al. [26] Macián et al. [31] This work This work This work

2.6. Growth conditions and radioactive labeling Bacterial cultures were grown overnight in LB medium at 37 ◦ C with shaking. Mid-exponential cultures were diluted 1:100 overnight inoculum in fresh LB medium and cultivated until reached 2 × 108 cells/ml. Cellular washing, dilutions and cis-Pt treatment were performed in M9 buffer. Whenever necessary, M9 was supplemented (M9S) with 4 g l−1 glucose, and supplemented with 2.5 mg ml−1 casaminoacids and 10 ␮g ml−1 thiamine. Radioactive cultures were grown in M9S medium containing 10 ␮Ci ml−1 [methyl-3 H]-thymidine (6.7 Ci mmol−1 ; New England Nuclear, Boston, MA) and 250 ␮g ml−1 2 -deoxyadenosine until the initial exponential growth phase. Cells were then harvested, resuspended in cold M9S medium, to which was added 10 ␮g ml−1 thymidine and incubated for 30 min at 37 ◦ C to chase whatever unincorporated radiolabeled thymidine from the intracellular pool. 2.7. DNA sedimentation studies The formation and disappearance of DNA breaks were analyzed by sedimentation of DNA in alkaline sucrose gradients as described by McGrath and Williams [28], with slight modifications. Radioactive cultures prepared as described in the item above were treated or not (controls) with cis-Pt for 60 min at concentrations that led cultures to 10% survival (DL10 ) as described in the previous item, centrifuged (7710 × g, 4 ◦ C, 10 min) and resuspended in cold M9S medium. Cells were allowed to recover from DNA damage in nonradioactive M9S medium at 37 ◦ C with shaking, and samples were collected at the indicated intervals of time. Undiluted 100-␮l aliquots were added on top of 0.2 ml lyzing solution (0.5 M NaOH, 0.01 M EDTA, and 0.05% sodium dodecyl sulfate) layered on the top of a 4.2-ml sucrose gradient of 5–20% (wt/vol) in 0.4 M NaCl, 0.2 M NaOH, 0.01 M EDTA. The tubes were maintained for 30 min at room temperature and then centrifuged in a Beckman SW 55Ti rotor for 120 min at 25,000 rpm and 20 ◦ C. After centrifugation, 30 fractions were collected by means of a peristaltic pump on paper strips (Whatman No. 17) presoaked with 5% trichloroacetic acid.

Paper strips were washed once in ice-cold 5% trichloroacetic acid, once in 95% ethanol, and once in absolute acetone. After drying, the 3 H radioactive content of each fraction was determined in a Beckman liquid scintillation counter. The average molecular weights were calculated according to the method described by Ley [29], and the number of DNA strand breaks per E. coli genome (2.5 × 109 Da) was calculated as described by Ananthaswamy and Eisenstark [30]. 2.8. Determination of transcriptional activity of uvrA and uvrB promoters through ˇ-galactosidase reporter gene The E. coli uvrA and uvrB promoter regions, each one comprising its SOS box, were cloned after amplification of the 108 bp regions upstream their start codons from plasmids pNP120 and pNP50 (Table 2), respectively. Both uvrA and uvrB promoter regions were flanked by NcoI and XhoI sites for posterior cloning into the MCS of plasmid pIC552 (carrying the lacZ reporter gene; Table 2). The same restriction sites flanked the 405 bp amplicon made from the entire P1, P2 and P3 uvrB promoter region present in pNP12 (Table 2) to clone it into the MCS of the pIC552 plasmid. The pIC552 plasmid also carries a ␤-lactamase gene allowing determination of ␤lactamase activity in each sample [31,32] and normalizes the actual ␤-galactosidase activity by estimation of plasmid copy number. All primers and amplification conditions are described in Table 3. Constructions uvrA::lacZ, uvrBP1P2 ::lacZ, and uvrBP1P2P3 ::lacZ were herein named pIC552-uvrA, pIC552-uvrB2 and pIC552-uvrB3, respectively. Each one was double checked in terms of digestion with the subcloning enzymes and PCR with a pair of primers designed to anneal upstream the cloned region (forward primer on T7 promoter region upstream the MCS of pIC552) and the reverse one used during the cloning process. Analysis of the transcriptional activity from both uvrA and uvrB promoters after treatment with cis-Pt and UV-C was performed by transforming both SOS-proficient and SOS Ind− GW1000 E. coli K12 lacZ strains (Table I) with the constructed plasmids. Fifteenmillilitre of each culture in the mid-exponential growth phase was washed twice (7710 × g, 10 min, 4–10 ◦ C) and resuspended in 1:1

Table 3 Primers, amplicon sizes and amplification conditions used to amplify uvrA and uvrB genes promoters regions. Target

5 → 3 sequence

Fragment size (bp); annealing temperatures (◦ C)

uvrB3 (full uvrB promoter region)

ATCCGCCATGGTTATCCACATTTCCTGTGG CGCCGCTCGAGAATGTAATTTTACTCGTCG ATTACCTCGAGTGCTCATGATTGACAGCGG CGCCGCTCGAGAATGTAATTTTACTCGTCG ATTGGCCATGGTACTATGTTGTGACCTCGG CGCCGCTCGAGAATTATGACACAAATTGAC ACGGTTTACAAGCATAAAGC ACGGTTTACAAGCATAAAGC ATCCGCCATGGTTATCCACATTTCCTGTGG ACGGTTTACAAGCATAAAGC ATTACCTCGAGTGCTCATGATTGACAGCGG ACGGTTTACAAGCATAAAGC ATTGGCCATGGTACTATGTTGTGACCTCGG ACGGTTTACAAGCATAAAGC

405; 55

uvrB2 (SOS-dependent promoter region) uvrA promoter region pIC552 MCS flanking region in empty vector pIC552-uvrB3 pIC552-uvrB2 pIC552-uvrA

136; 55 136; 55 145; 42 536; 42 270; 42 270; 42

66

D.F. Felício et al. / DNA Repair 12 (2013) 63–72

Table 4 Primers used in real time RT-PCR and characterization of products generated by amplification. Target gene

5 → 3 sequence

Amplicon size (bp)

Melting temperature of amplification products (◦ C)

uvrA

GTG CGA CCA GTG CAA AGG TAA GCG CCT CTT CGA TGG TCA TAT GAC GCT GTT TGA TTA CCT GCC T CCG TAC TCC ACC AGT GTC TCT TTA C GAA TAC GCT CAG CAG GTC GAG TA ACG TGC AGC TTC TTC AAA CTC C GGT GTA TGC CAA AGA GGT GGA TT TTC ATC AGC GAT GGT CTG CA GTA ACC TGA AGC AGT CCA ACA CG AGA GGC GTA GAA TTT CAG CGC CAA CCG TAT TTC CCA GAT G TGG CTC TTT GGC GAT CTT CA

104

82.1

126

85.4

126

81.0

103

83.9

122

82.0

124

83.6

uvrB uvrC cho recA rpoD

phosphate buffered M9 (0.4% NH4 Cl, 1.5% Na2 HPO4 ·12H2 O, 0.3% KH2 PO4 , 0.5% NaCl and 0.4% glucose) and divided in three aliquots of 5 ml each. One of these aliquots was reserved as a control sample in each experiment, one was exposed to UV-C (from a 254 nm emitting 15-W GE lamp at a dose rate of 1 J m−2 s−1 ), and the third exposed to cis-Pt as described under the item 3.4 above. The UV and cisPt doses were those that led cultures to 50% survival, according to prior inactivation experiments performed for each strain (data not shown). Immediately after, 100 ␮l aliquots (control, UV and cis-Pt) were taken from each one of the cultures and added to the ONPG assay buffer for determining ␤-galactosidase activity as described by Quillardet and Hofnung [33]. The remaining volumes were incubated at 37 ◦ C under shaking for recuperation, and aliquots of 100 ␮l were taken at the indicated time intervals shown on the graphs, and processed to determine ␤-galactosidase activity. Concomitantly to this procedure, additional aliquots were taken from each one to measure absorbance to 600 nm and ␤-lactamase activity [32] to obtain the actual ␤-galactosidase activity by normalizing it to both cell number and plasmid copy number, respectively. 2.9. Quantitative analysis of uvrA, uvrB uvrC, cho and recA transcripts by real time RT-PCR (SyBr Green Methodology) AB1157 E. coli strain was submitted or not (controls) to either UV-C or cis-Pt treatments according to as described above. After treatment, cultures were washed to remove cis-Pt and resuspended in 1:1 vol/vol fresh LB medium and left for 4 h at 37 ◦ C to recover from damage. Three-millilitre aliquots were taken from each culture for total RNA extraction before treatment and at times 0, 1, 2, 3 and 4 h of recovery. The experimental procedure was performed according to the Trizol protocol (Invitrogen) and all solutions were prepared with diethylpyrocarbonate (DEPC)treated MilliQ water to avoid any RNAse contamination. The final RNA precipitate was washed in 70% ethanol and was later dissolved in DEPC-treated MilliQ water. Both RNA concentration and quality were estimated by spectrophotometry (absorbance ratio at 260 and 280 nm of 1.6–1.8) and prompted to cDNA synthesis. The remaining volume was stored at −70 ◦ C. 2.10. cDNA synthesis A volume containing 0.5 ␮g total RNA was incubated at 65 ◦ C for 5 min with 2.5 ␮l of random hexamer primers and 5 ␮l 10 mM dNTP. This mixture was incubated at 42 ◦ C for 40 min in a total volume of 25 ␮l containing 10 mM dithiothreitol, 50 mM Tris–HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2 and 500 U Superscript III enzyme (Invitrogen) to allow cDNA synthesis. The cDNA reaction mixture was then treated with RNAseH (5 U) for 20 min at 37 ◦ C. Finished

this step the reaction was diluted with MilliQ water to 50 ␮l and kept at 4 ◦ C. A volume of 2 ␮l of RNA solution (with 1 ␮l RNA) was heated to 65 ◦ C and placed in an ice bath. Synthesis of cDNA was achieved by adding 10 ␮l cDNA mix [2.0 ␮l dNTPs of a 10 mM solution containing equimolar amounts of dATP, dCTP, dGTP and dTTP; 2.0 ␮l of 0.1 M dithiothreitol (DTT) (Invitrogen); 1.0 ␮l of a 50pM Random Hexamer Primers solution (Invitrogen); 4.0 ␮l of 5×-buffer (Invitrogen) and 1.0 ␮l of 200 ␮g/␮l Superscript III (Invitrogen)]. Final volumes (20 ␮l per tube) were kept at room temperature for 10 min followed by incubation at 50 ◦ C for 50 min. Reactions were terminated by heating at 85 ◦ C for 5 min. cDNAs were stored at −20 ◦ C until further use. 2.11. Quantitative real time RT-PCR The mRNA sequences of uvrA, uvrB, uvrC, cho and recA genes were obtained from The Institute of Genomic Research/Comprehensive Microbial Resource in http://cmr.tigr. org/tigr-scripts/CMR/genomePage. These sequences were used as templates for designing all primers (Primer Express® 2.0 software, Applied Biosystems). Their sequences, melting temperatures and size of the amplification products are listed in Table 4. Each PCR was performed in a final volume of 25 ␮l consisting of: 50 ng cDNA, 12.5 ␮l Platinum SyBr Green qPCR Super Mix-UDG (Invitrogen) [SyBr Green I, 60 U ml−1 Platinum Taq DNA Polymerase, 40 mM Tris–HCl pH 8.4, 100 mM KCl, 6 mM MgCl2 , 400 ␮M dGTP, 400 ␮M dATP, 400 ␮M dCTP and 40 ␮M UTP, 40 U ml−1 UDG and stabilizers], 1 ␮l Rox reference Dye and autoclaved distilled water up to 25 ␮l. PCR and fluorescence analysis were performed using the ABI Prisma 7000 Sequence Detector System. Amplification conditions were: 2 min at 50 ◦ C (for optimal UDG activity), 10 min at 95 ◦ C (for deactivation of UDG and activation of Platinum Taq DNA polymerase) then 45 cycles of 1 min at 95 ◦ C, 1 min at 59 ◦ C and 1 min at 72 ◦ C. After that, a final extension step of 2 min at 72 ◦ C was performed. After each reaction, a melting curve was performed to check for the specificity of the generated amplicons, by heating products for 15 s at 95 ◦ C followed by a cooling step to 60 ◦ C for 20 s and again 95 ◦ C during 19 min and 59 s. Relative quantification was performed using the comparative Ct method as described by the manufacture’s manual. 3. Results 3.1. Cell survival to cis-Pt Survival was measured as a function of the increasing cisPt-induced damage. Initial experiments performed with cis-Pt were designed to define the incubation time with the chemical

D.F. Felício et al. / DNA Repair 12 (2013) 63–72

67

Fig. 1. (A) Survival of E. coli wild type, recA- and NER-deficient strains to cisplatin in M9 buffer. Cultures in the mid-exponential phase of growth were treated with different concentrations of cisplatin for 60 min. () Wild type (KA797), () uvrA (CS5539), () uvrB (CS5017), (䊉) uvrC (CS4926), (♦) cho (CS5540), and (*) recA13 (AB2463). Plots represent mean values ± standard errors. (B) Survival of E. coli wild type and NER-deficient strains to cisplatin in M9 buffer. Cultures in the mid-exponential phase of growth were treated with different concentrations of cisplatin for 60 min. () uvrC/cho (RJF675), (䊉) uvrA/uvrB (CS5018), () uvrA/uvrC (RJF674), and () uvrB/uvrC (CS5638). Plots represent mean values ± standard errors.

necessary to obtain maximal lethality for each used dose (i.e., the point in time after which inactivation does not increase with longer incubation times). This time interval was defined as 60 min for the wild type strain AB1157 (data not shown) and was thereafter used for treatment of DNA repair deficient strains. Aliquots of each culture were exposed to increasing concentrations of cis-Pt for 60 min. Such experimental design allowed us to distinguish different sensitivities to cis-Pt among all studied strains. 3.2. Inactivation of NER mutants by cis-Pt The first indication that an uvr-deficient strain was sensitive to cis-Pt was obtained with a single specific uvr mutant strain, compared to its parental uvr+ [17,34]. Our present study started with analysis of survival to cis-Pt of single and double mutants in uvrA, uvrB and uvrC genes. The uvrB (CS5017) and uvrA (CS5539) deleted mutants were significantly more sensitive to the treatment than the uvrC (CS4926) one (Fig. 1A). The double mutants uvrA uvrB (CS5018), uvrB uvrC (CS5638) and uvrA uvrC (RJF674) were all similarly sensitive to cis-Pt (Fig. 1B). Nevertheless, both cho (CS5520) single- and cho uvrC (RJF759) double mutants were similarly resistant to cis-Pt as the wild type strain, as it can be observed in Fig. 1B. The recA (Def) mutant strain (recA13) was tested for sensitivity to cis-Pt since the RecA protein is involved in both the regulation of uvrA and uvrB expression and in homologous recombination. Interestingly, the recA13 (AB2463) single mutant was still more sensitive to the treatment when compared with any uvr mutant (Fig. 1A). Thus, it appears that both RecA functions are involved in the repair of lesions induced by cis-Pt as well.

wild-type cells were able to repair DNA strand breaks, although in a slower kinetics when compared to UV-C treatment. This information is depicted by observing data in Fig. 2, since repair appears to be on activity even at 180 min post-incubation time in the wild type strain. After treatment of wild type E. coli with UV-C, Tang and Ross [35] have shown that some 90 min appeared to suffice to accomplish repair of CPD by the same technique. 3.4. Activities of uvrA and uvrB promoters in SOS+ and SOS− E. coli strains in the presence of cis-Pt Transcriptional activity from uvrA and uvrB promoters was followed in SOS+ GW1000 strain, along time intervals of 30 min post-cis-Pt treatment relatively to the non-treated control culture. Expression of ␤-gal was maximal from the plasmid construction harboring the full uvrB promoter region (pIC552-uvrB3), reaching some 36-fold above control levels past 4 h treatment with cis-Pt (Fig. 3A). Under the same experimental conditions, cis-Pt treatment

3.3. DNA strand breaks induction by cis-Pt treatment The kinetics of repair of cis-Pt-induced DNA lesions was followed in the wild type strain. The ability of this to repair strand breaks was investigated by using DNA sedimentation on alkaline sucrose gradients. The number of DNA strand breaks per genome appearing during the treatment, immediately after treatment and after different recovery times is shown in Fig. 2. cis-Pt treated

Fig. 2. Bar diagram representing the number of average DNA strand breaks per genome generated by treatment with cisplatin (at a concentration leading to its DL10 ) and after different post-incubation times, in E. coli AB1157 strain (wild type).

68

D.F. Felício et al. / DNA Repair 12 (2013) 63–72

Fig. 3. Comparative analysis between ␤-gal/␤-lac normalized activities expressed from pIC-uvrB3:lacZ (A), pIC-uvrB2:lacZ (B) and pIC-uvrA:lacZ (C) constructions in the wild type SOS strain after treatment with either UVC or cisplatin (LD 50%). Plots represent the average fold-induction above control cultures resulting from two independent experiments plus their standard errors.

caused a lower fold increment (average 20-fold) in ␤-gal expression from pIC552-uvrB2 construction (Fig. 3B). ␤-gal expression from pIC552-uvrA construction (Fig. 3C) attained similar 30-fold induction as those observed for the pIC552-uvrB3. Regarding UV-C treatment under the same LD (50%) survival as that obtained for cis-Pt, ␤-gal expression was much less pronounced. Compared with ␤-gal expression from all three constructions in non-irradiated controls, UV-C damage signaled less than 10-fold increment in ␤-gal activity. Expression from SOS-dependent promoters in pIC552-uvrB2 and pIC552-uvrA constructions displayed a “switch on–switch off” induction pattern, both with averaged maximal 4.5-fold induction by 1.5–2 h post-irradiation. Interestingly, ␤-gal expression from full uvrB promoter region present in pIC552-uvrB3 construction resembled the steeply “switch-on” pattern past 4 h after irradiation, similarly as what was seen during recovery from cis-Pt damage. Nonetheless, all fold-inductions after cis-Pt treatment were significantly above those observed after UV-C radiation (compare gray and black bars in Fig. 3A–C). In SOS− GW1000 strain challenged with either cis-Pt or UV-C, ␤-gal expression was seen not to surpass some 2.5-fold induction above controls when expressed from SOS-dependent constructions pIC552-uvrB2 (Fig. 4B) and pIC552-uvrA (Fig. 4C). On the other hand, ␤-gal expression raised some 7-fold above controls from pIC552-uvrB3 construction after exposure to cis-Pt (Fig. 4A), suggesting an SOS-independent control on uvrB promoter region in response to this chemotherapeutic agent. 3.5. Relative quantitation of uvrA, uvrB, uvrC, cho and recA transcripts in E. coli AB1157 treated with cis-Pt Quantification of transcripts from NER genes uvrA, uvrB, uvrC and cho, and recombinational repair gene recA, was followed in

cells submitted to cis-Pt treatment (Fig. 5A). Upon treatment with doses leading to 50% cis-Pt survival, the relative expressions of uvrA, uvrB, uvrC transcripts were 5-, 6- and 3-fold, respectively, compared to non-treated cells past 5 min after treatment. Their expression sloped up during the recovery phase reaching 22-, 15and 23-fold increments, relatively to control cells, after 240 min cisPt treatment. In respect to cho expression, its transcripts were seen to raise 4-fold as early as 5 min after cis-Pt relatively to non-treated cultures, approaching 17- and 22-fold upon recuperation at 120 and 240 min post-treatment, respectively. Although cho mutants appeared to be resistant to cis-Pt, cho transcripts were detected in a similar fashion as other NER genes, reflecting its SOS regulation (Fig. 5A). On its turn, recA transcripts display an immediate and stronger increment in comparison to NER genes within 5 min posttreatment, yet transcripts leveled similarly to other analyzed genes with average 20-fold increments relatively to non-treated controls (Fig. 5A). UV-induced signals for NER and recA gene transcription observed during the same time interval (up to 240 min) depicted a steeply rise in the amount of transcripts up to 120 min after UV exposure. According to results of DNA sedimentation on akaline sucrose after UV, wild-type E. coli cells were able to accomplish nicking, synthesis and resealing of DNA within 1.5 h post-UV [36]. In conclusion, the relative amounts of uvrA, uvrB, uvrC, cho and recA transcripts in cis-Pt-treated E. coli cells are significantly more pronounced than the corresponding ones for UV-irradiated cells at the same LD. The post-treatment induction kinetics is also remarkable, one agent compared to the other: cis-Pt keeps signaling transcriptional stimuli even after 240 min recuperation (Fig. 5A and B). Altogether, collected data on quantitative analyses of cisPt-induced DNA repair genes expression reveal that its damaging action on DNA seem to exceed that of UV.

D.F. Felício et al. / DNA Repair 12 (2013) 63–72

69

Fig. 4. Comparative analysis between ␤-gal/␤-lac normalized activities expressed from pIC-uvrB3:lacZ (A), pIC-uvrB2:lacZ (B) and pIC-uvrA:lacZ (C) constructions in the SOS-deficient strain after treatment with either UVC or cisplatin (LD 50%). Plots represent the average fold-induction above control cultures resulting from two independent experiments plus their standard errors.

4. Discussion Cisplatin (cis-diamminedichloroplatinum) is one of the most effective chemotherapeutic agents eligible for anti-cancer chemotherapy [3]. It is generally accepted that cis-Pt cytotoxic activity mainly results from its interactions with DNA, although cis-Pt effects on cellular components appear to somehow be counteracted by cellular defenses such as membrane efflux protein pumps and DNA repair mechanisms [36]. The interaction between cis-Pt and DNA can result in mono- and bifunctional adducts, as well as DNA–protein crosslinks. DNA–platinum covalent adducts were shown to inhibit fundamental cellular processes, namely DNA repair, replication, transcription and translation [37–44]. Regarding known repair mechanisms, mismatch repair proteins seem to specifically recognize major DNA-cis-Pt adducts [23] so that important cellular sensitivity to cis-Pt is observed in their absence [45]. Two excision repair pathways have been identified for the removal of bulky DNA damages and for the overall maintenance of genomic integrity: nucleotide excision repair (NER) and base excision repair (BER). The first approach in this work was to check for the sensitivity of NER mutants. NER participation in the repair of damage produced by several chemical agents had for long been inferred by testing only uvrA mutants [17,34]. By the mid-1990s, studies on the sensitivity of the three NER uvrA, uvrB and uvrC deficient strains in vivo had been performed only for UV-C-induced CPDs [46] and 6-4 photoproducts [47]. Removal of other bulky lesions believed to be substrates for NER were demonstrated by in vitro experiments with purified damaged DNA and enzymes [48]. The evidence for a structural determinant on alternative ways to NER proteins to process different DNA damages compelled our group to a detailed investigation on survival of the three uvr-deficient strains (A, B, C). Previous papers published by our group have collected evidence

that NER subunits may proceed via alternative, independent roles according to the particular requirement for UvrB function (mitomycin C [49] and PUVA [50]) or NER (nitrogen mustards [51]). This paper brings evidence that not all Uvr enzymes believed to be involved in NER are necessary to repair cis-Pt induced damage in E. coli. The finding of similar sensitivity to the drug in uvrA and uvrB single mutants means, however, that the recognition task proceeds through the same pathway as for other DNA damages. The inactivation produced in double mutants constructed by deletions in two uvr genes (helicase deficient uvrA uvrB, nucleasedeficient uvrB uvrC, and UvrB recognition-proficient uvrA uvrC) was nearly identical to that obtained for their parental single mutants. It has been accepted that the fundamental reason for the broad activity of NER enzymes upon quite different substrates is that any degree of topological DNA distortion can render it recognizable by the UvrA2 –UvrB assembly [13,14,52,53]. If cis-Pt induces NER-recognizable DNA distortions, their repair should count on participation of all three Uvr subunits, but that was not otherwise observed. Survival to cis-Pt profiled uvrA- and uvrB-deficient strains in a sensitive background, with no correspondent sensitivity observed for either uvrC or cho mutant strains (Fig. 1). The requirement for both UvrA and UvrB functions on cis-Pt damage recognition had already been demonstrated in a previous study by Visse et al. [18] showing that a UvrB-DNA pre-incision complex formed on a single cis-Pt::GG DNA adduct in the dependence on the presence of UvrA. Bichara and Fuchs [54] have already reached a likewise result for other DNA-adducting agent 2-aceto-aminefluorene (2-AAF), with the repair of 2-AAF-DNA adducts depending on the UvrA and UvrB recognition activity, without any requirement for UvrC activity. Particular structural modifications of the double helix may be the key to trigger UvrA2 B recognition, although the endonucleolytic processing of the damaged site may follow by the UvrC activity [46,47,51] or not [49,50] (see Fig. 1 in this paper).

70

D.F. Felício et al. / DNA Repair 12 (2013) 63–72

Fig. 5. Relative (to housekeeping gene rpoD) quantification of transcripts from uvrA, uvrB, uvrC, cho and recA genes in wild type cells (AB1157) submitted to cisplatin (A) or UVC (B) at the indicated recovery times after treatment with UV or cisplatin equivalent doses leading to 50% bacterial survival.

The repair of cis-Pt-induced damage revealed another striking feature: breaks on DNA appear immediately after addition of the drug, then they were seen to increase along the first recovery hour, but they are still detected in significant amounts up to 3 h recovery (Fig. 2). Remarkably, repair of cis-Pt damage in the wild type strain was seen to span over longer periods of time when compared to that required to overcome an equivalent LD10 UV-C treatment. This information is depicted by comparing the repair kinetics, since DNA breaks were detected even after 180-min post-treatment with cisPt. After treatment with UV-C, it was shown that the same strain repair is accomplished after 90 min of incubation [35]. Cisplatin-induced damage was shown to require the damagerecognition activity by the NER UvrA2 B complex, but somehow an UvrC deficient strain behaved wild-type-wise. Among all cisPt-induced adducts, it is fairly well assumed the role played by E. coli RecA protein in both derepressing NER uvrA and uvrB genes and providing accessory homologous recombination processing of DNA crosslinks [55]. As expected by previous studies on repair of DNA crosslinks, a RecA-deficient strain was thus highly sensitive to cis-Pt (Fig. 1A). The RecA task in response to cis-Pt thus appeared to stem from its dual role in activate expression of SOS-related genes, as uvrA, uvrB, and cho, and also in homologous recombination. This was further investigated by two approaches: the analysis of beta-galactosidase reporter gene induction from uvrA and uvrB promoters cloned upstream a lacZ reporter gene and transformed either in a SOS+ (Fig. 3) or SOS− (Fig. 4) background, and real time PCR analysis of NER (uvrA, uvrB, uvrC, cho) and recA genes (Fig. 5). The approach to measure transcript levels of NER genes in response to a non-UV damaging agent prompted us to include a construction

of the lacZ reporter gene fused to the unique SOS-independent uvrB promoter P3 region [56]. In the present report, the analysis of net transcription from uvr genes measured as ␤-galactosidase activity revealed that both uvrA and uvrB SOS-dependent promoters were indeed stimulated by cis-Pt, but in a stronger level when compared with that observed after irradiation with the same LD10 UV-C. This result remarks how the UvrA2 B complex is effectively on demand in the damage recognition process of cis-Pt induced lesions on DNA. Interestingly, the ␤-galactosidase activity was seen to attain an even higher level when expression was driven from the SOSindependent promoter in pIC552-uvrB3 in both cis-Pt-treated and UV-C irradiated SOS-proficient cells. Even for the well-known set of UV-C-induced photodamages, the kinetic feature concerning ␤galactosidase activity after UV-C radiation also differs when read from pIC-uvrB2 or pIC552-uvrB3 promoters (compare Fig. 3A with B). Besides the greater expression (∼7-fold from uvrB3 vs. ∼3.75fold from uvrB2), UV-C irradiated cells keep ␤-galactosidase levels steeply increasing even after 4 h post-radiation (Fig. 3A) when ␤galactosidase was expressed from the pIC522-uvrB3 promoter. Such increased activity of uvr promoters in the cis-Pt context is also observed for the uvrA promoter, with some 10-fold maximum ␤-galactosidase transcription past 4 h cis-Pt exposure relatively to an equivalent LD10 UV-C dose (∼30-fold for cis-Pt vs. ∼3-fold for UV-C). In the case of cis-Pt, ␤-galactosidase activity keeps its maximal levels up to the last experimental determination at 4 h post-treatment, for all three constructions pIC552-uvrA, pIC552uvrB2 and pIC552-uvrB3, a kinetics that reflects how complex may be the repair of the repertoire of different cis-Pt adducts. Regarding the late SOS sfi-mediated cell filamenting function, data from Keller et al. [57] have shown a particular aspect in that approximate DL10 doses of UV and cisplatin were able to activate the sfi::lacZ fusion in a wild type background by similar fold values (∼26 for UV and ∼30 for cisplatin). Considering that early SOS uvrA and uvrB genes were moderately activated under similar conditions in the present study, it seems reasonable to assume that cisplatin fires a more intense signal for NER expression, although fold induction for the late SOS sfi gene seem to be undistinguishable for both agents. On the basis of the SOS regulatory action on the expression of uvrA and uvrB genes, only minimal ␤-galactosidase induction was observed from SOS-dependent promoters in pIC552-uvrA and pIC552-uvrB2 constructions for both treatments, cis-Pt and UV-C, in an SOS− background (Fig. 4B and C). The ∼7-fold ␤-galactosidase induction from pIC552-uvrB3 after cis-Pt treatment (but not UV-C) in an SOS-deficient background was somehow unexpected (Fig. 4A), suggesting a novel regulation of uvrB gene by the P3 promoter in an SOS independent circuitry. We thus hypothesize that besides its heavy DNA damaging action demanding high levels of uvrA and uvrB gene products, cis-Pt appears to additionally increment uvrB expression by activating P3 promoter reading by an SOSindependent signaling. Altogether, uvrB expression from more than one regulatory circuitry contributes to the observed up-regulated uvrB expression (indirectly measured as ␤-galactosidase activity). Besides inspecting the effect of cis-Pt treatment on promoter activation of two main NER genes, uvrA and uvrB, the relative amounts of transcripts of other DNA repair genes were determined after equivalent doses of cis-Pt and UV-C were applied to wild-type E. coli. Real time RT-PCR analysis indicated that uvrA, uvrB, uvrC, cho and recA transcripts sloped up after both UV-C and cis-Pt treatments. According to what was seen to occur with ␤-galactosidase activity, while all analyzed genes were kept copying their mRNAs after 4 h past cis-Pt treatment (Fig. 5A), the levels of transcription of the same gene set after UV-C attained its maximum expression half-way the total experimental time of 4 h (Fig. 5B). Real time PCR results agree with the kinetic patterns observed for ␤-galactosidase activity from uvrA and uvrB promoters after cis-Pt

D.F. Felício et al. / DNA Repair 12 (2013) 63–72

and UV-C, reinforcing the stronger signaling effect ensued by cis-Pt DNA damages on the activation of NER and recA genes, at least at the level of transcription. These results also agree with inactivation rates obtained for uvrA, uvrB and recA deficient strains after cis-Pt treatment, as well as the post-UV-C induction kinetics of the presently analyzed NER genes uvrA, uvrB and uvrC matches the previously report by Tang and Ross [35] showing that all nicks on UV-C damaged DNA required nearly 1.5 h to be completely resealed. Disagreeing results between gene expression and inactivation rates were observed for uvrC and cho related functions in response to cis-Pt. In the case of repair of UV-induced photodamage, expressive UV sensitivity was seen in cho-, uvrC- and cho uvrC-deficient strains [58]. uvrC and cho deficient strains were shown to be wild-type-like against cis-Pt damage in E. coli cells, although transcription of both genes increased by similar extents as their NER partner genes uvrA and uvrB (Fig. 5A). When compared with results obtained with cells exposed to UV-C in the same LD10 , uvrC and cho expression levels, past 4 h UV-C recovery start to decrease, coping with the expected NER switch-off after accomplishment of UV-C photodamage removal [35]. In respect to detection of cho transcript levels by real time RT-PCR, its expression can be a result of activation of SOS regulatory circuitry [58], but might also indicates that Cho protein may be required as an auxiliary enzyme repairing cis-Pt damages, as reported before by [58]. Using a cis-Pt-containing DNA fragment, these authors showed that Cho can interact with the UvrB-DNA pre-incision complex, promoting 3 -side incisions at cis-Pt adducts. The structurally shorter Cho protein is predicted to substitute UvrC on some damaged substrates because of the poorer ability of UvrC to interact with the UvrB-DNA pre-incision complex, possibly by structural constraints blocking 3 incisions by UvrC. cis-Pt damages would thus be repaired by a combined action of Cho (for 3 incisions) and UvrC (for 5 incisions) [58]. As expected by those previous findings, the present study revealed that relative amounts of both uvrC and cho transcripts raised up to ∼20-fold above basal levels post cis-Pt treatment, indicating a relevant requirement for Cho activity in the repairing process of cis-Pt-induced damages. In this sense, given the wild type-like survival seen for both uvrC and cho deficient strains, it appears that UvrC and Cho are surrogates for DNA incisions in the cis-Pt repair process. Notwithstanding, the absence of both UvrC and Cho in the uvrC cho double mutant causes survival to be wild type-like as well (Fig. 1B). Considering that a recA deficient strain is the most sensitive one to cis-Pt, it appears that, besides activating SOS-dependent NER uvrA and uvrB genes, RecA recombinational function play a role in cis-Pt damage repair. The detected high levels of recA transcripts in real time PCR, which, unlike the other analyzed genes, promptly sloped within times as early as 5 min post cis-Pt treatment (Fig. 5A), can thus derive from two demands: first, recA is expressed as a consequence of SOS signaling and brings about transcription of associated NER genes, including the SOS-regulated cho gene; second, the recA gene product mediates recombinational repair which is involved in removing interstrand crosslinks or cis-Pt induced double-strand DNA breaks, already shown in a series of papers by the team led by Marinus and Essigmann [59,60]. Such endonucleolytic damage processing by post-replicative recombinational repair may somehow overcome that from UvrC or Cho whenever access to UvrC or Cho is prevented by structural hindrances. Taken into account the unique uvrB overexpression from its SOS-independent P3 promoter succeeding cis-Pt exposure, one can stress the UvrB function to be particularly essential to deal with adduct-forming chemotherapeutic agents. This last remark deserves attention because the homologous human correspondent XPD protein impressively fit to an E. coli UvrB structural model [61], revealing how critically involved in NER damage recognition this subunit may be under such evolutionary perspective. Altogether,

71

data on NER action on DNA damages induced by chemotherapeutic agents collected by our group has highlighted UvrB function to be an essential one. Independently of the target base, either purines (cisPt, mitomycin C, nitrogen mustards) or pyrimidines (UV-C, PUVA), a key role in NER processing of DNA adducts is depicted for UvrB function and, in some structurally determined occasions, assembled with UvrA and UvrC [62]. Conflict of interest There are no conflicts of interest. Acknowledgments The authors acknowledge the financial support provided by the following Brazilian funding agencies: Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Coordenac¸ão de Aperfeic¸oamento de Pessoal de Nível Superior (CAPES), and Fundac¸ão Carlos Chagas Filho de Apoio a Ciência do Estado do Rio de Janeiro (FAPERJ). We are also grateful to the technical support given by Ms. Rita de Cassia de Albuquerque in preparing all labware material. References [1] B. Rosenberg, L. Vancamp, T. Krigas, Inhibition of cell division in Escherichia coli by electrolysis products from a platinum electrode, Nature 205 (1965) 698–699. [2] B. Rosenberg, L. Van Camp, E.B. Grimley, A.J. Thomson, The inhibition of growth or cell division in Escherichia coli by different ionic species of platinum(IV) complexes, J. Biol. Chem. 242 (6) (1967) 1347–1352. [3] P.J. Loehrer, L.H. Einhorn, Drugs five years later. Cisplatin, Ann. Intern. Med. 100 (5) (1984) 704–713, Review. [4] R.J. Knox, F. Friedlos, D.A. Lydall, J.J. Roberts, Mechanism of cytotoxicity of anticancer platinum drugs: evidence that cis-diamminedichloroplatinum(II) and cis-diammine-(1,1-cyclobutanedicarboxylato)platinum(II) differ only in the kinetics of their interaction with DNA, Cancer Res. 46 (4) (1986) 1972–1979. [5] J. Brugge, T. Curran, E. Harlow, F. McCormick, Origins of Human Cancer: A Comprehensive Review, Cold Spring Harbor Press, New York, 1991. [6] F.R. Hartley, Palladium and platinum, Coord. Chem. Rev. 67 (1985) 1–108. [7] P.A. Chaloner, Palladium and platinum, Coord. Chem. Rev. 72 (1986) 1–195. [8] C.M. Sorenson, A. Eastman, Mechanism of cis-diamminedichloroplatinum(II)induced cytotoxicity: role of G2 arrest and DNA double-strand breaks, Cancer Res. 48 (16) (1988) 4484–4488. [9] A.M. Fichtinger-Schepman, J.L. van der Veer, J.H. den Hartog, P.H. Lohman, J. Reedijk, Adducts of the antitumor drug cis-diamminedichloroplatinum(II) with DNA: formation, identification, and quantitation, Biochemistry 24 (3) (1985) 707–713. [10] A.M. Fichtinger-Schepman, R.A. Baan, A. Luiten-Schuite, M. van Dijk, P.H. Lohman, Immunochemical quantitation of adducts induced in DNA by cis-diamminedichloroplatinum (II) and analysis of adduct-related DNAunwinding, Chem. Biol. Interact. 55 (3) (1985) 275–288. [11] V. Brabec, J. Kasparkova, Molecular aspects of resistance to antitumor platinum drugs, Drug Resist. Updates 5 (3–4) (2002) 147–161. [12] B. Van Houten, D.L. Croteau, M.J. DellaVecchia, H. Wang, C. Kisker, ‘Close-fitting sleeves’: DNA damage recognition by the UvrABC nuclease system, Mutat. Res. 577 (1–2) (2005) 92–117, Review. [13] E. Malta, G.F. Moolenaar, N. Goosen, Dynamics of the UvrABC nucleotide excision repair proteins analyzed by fluorescence resonance energy transfer, Biochemistry 46 (31) (2007) 9080–9088. [14] N.M. Kad, H. Wang, G.G. Kennedy, D.M. Warshaw, B. Van Houten, Collaborative dynamic DNA scanning by nucleotide excision repair proteins investigated by single-molecule imaging of quantum-dot-labeled proteins, Mol. Cell 37 (5) (2010) 702–713. [15] J.H.J. Hoeijmakers, Nucleotide excision repair I: from E. coli to yeast, Trends Genet. 9 (1993) 173–177. [16] P.R. Caron, S.R. Kushner, L. Grossman, Involvement of helicase II (uvrD gene product) and DNA polymerase I in excision mediated by the uvrABC protein complex, Proc. Natl. Acad. Sci. U.S.A. 82 (15) (1985) 4925–4929. [17] I. Husain, B. Van Houten, D.C. Thomas, M. Abdel-Monem, A. Sancar, Effect of DNA polymerase I and DNA helicase II on the turnover rate of UvrABC excision nuclease, Proc. Natl. Acad. Sci. U.S.A. 82 (20) (1985) 6774–6778. [18] R. Visse, M. de Ruijter, G.F. Moolenaar, P. van de Putte, Analysis of UvrABC endonuclease reaction intermediates on cisplatin-damaged DNA using Mobility shift gel electrophoresis, J. Biol. Chem. 267 (1992) 6736–6742. [19] J.A. Brandsma, M. de Ruijter, R. Visse, D. van Meerten, M. van der Kaaden, J.G. Moggs, P. van de Putte, The in vitro more efficiently repaired cisplatin adduct cis-Pt.GG is in vivo a more mutagenic lesion than the relative slowly repaired cis-Pt.GCG adduct, Mutat. Res. 362 (1) (1996) 29–40.

72

D.F. Felício et al. / DNA Repair 12 (2013) 63–72

[20] A. Gelasco, S.J. Lippard, NMR solution structure of a DNA dodecamer duplex containing a cis-diammineplatinum(II) d(GpG) intrastrand cross-link, the major adduct of the anticancer drug cisplatin, Biochemistry 37 (26) (1998) 9230–9239. [21] J.M. Teuben, C. Bauer, A.H. Wang, J. Reedijk, Solution structure of a DNA duplex containing a cis-diammineplatinum(II) 1,3-d(GTG) intrastrand cross-link, a major adduct in cells treated with the anticancer drug carboplatin, Biochemistry 38 (38) (1999) 12305–12312. [22] S.J. Araújo, R. Tirode, R. Coin, H. Pospiech, J.E. Syväoja, M. Stucki, U. Hübscher, J.M. Egly, R.D. Wood, Nucleotide excision repair of DNA with recombination by CVAK, Genes Dev. 14 (3) (2000) 349–359. [23] J.A. Mello, S. Acharya, R. Fishel, J.M. Essigmann, The mismatch-repair protein hMSH2 binds selectively to DNA adducts of the anticancer drug cisplatin, Chem. Biol. 3 (7) (1996) 579–589. [24] S.-L. Bruhn, P.M. Pil, J.M. Essigmann, D.E. Housman, S.J. Lippard, Isolation and characterization of human cDNA clones encoding a high mobility group box protein that recognizes structural distortions to DNA caused by binding of the anticancer agent cisplatin, Proc. Natl. Acad. Sci. U.S.A. 89 (6) (1992) 2307–2311. [25] E.A. van den Berg, R.H. Geerse, H. Pannekoek, P. van de Putte, In vivo transcription of the E. coli uvrB gene: both promoters are inducible by UV, Nucl. Acids Res. 11 (13) (1983) 4355–4363. [26] G.F. Moolenaar, C. Moorman, N. Goosen, Role of the Escherichia coli nucleotide excision repair proteins in DNA replication, J. Bacteriol. 182 (20) (2000) 5706–5714. [27] J. Miller, A Short Course in Bacterial Genetics, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1992. [28] R.A. McGrath, R.W. Williams, Reconstruction in vivo of irradiated E. coli deoxyribonucleic acid, the rejoining of broken pieces, Nature 212 (1966) 532–535. [29] R.D. Ley, Postreplication repair in an excision-defective mutant of Escherichia coli: ultraviolet light-induced incorporation of bromodeoxyuridine into parental DNA, Photochem. Photobiol. 18 (1973) 87–95. [30] H.N. Ananthaswamy, A. Eisenstark, Repair of hydrogen peroxide-induced single-strand breaks in Escherichia coli deoxyribonucleic acid, J. Bacteriol. 130 (1977) 187–191. [31] F. Macián, I. Pérez-Roger, M. Armengod, An improved vector system for constructing transcriptonal lacZ fusions: analysis of regulation of the dnaA, dnaN, recF, and gyrB genes of Escherichia coli, Gene 145 (1984) 17–24. [32] L. Andrup, T. Atlung, N. Ogasawara, H. Yoshikawa, F.G. Hansen, Interaction of the Bacillus subtilis DnaA-like protein with the Escherichia coli DnaA protein, J. Bacteriol. 170 (1988) 1333–1338. [33] P. Quillardet, M. Hofnung, The SOS chromotest: a review, Mutat. Res. 297 (3) (1993) 235–279, Review. [34] D.J. Beck, R.R. Brubaker, Effect of cis-platinum(II)diamminodichloride on wild type and deoxyribonucleic acid repair deficient mutants of Escherichia coli, J. Bacteriol. 116 (3) (1973) 1247–1252. [35] M.S. Tang, L. Ross, Single-strand breakage of DNA in UV-irradiated uvrA, uvrB, and uvrC mutants of Escherichia coli, J. Bacteriol. 161 (3) (1985) 933–938. [36] U. Olszewski, G. Hamilton, A better platinum-based anticancer drug yet to come? Anticancer Agents Med. Chem. 10 (4) (2010) 293–301, Review. [37] Y. Corda, C. Job, M.F. Anin, M. Leng, D. Job, Transcription by eucaryotic and procaryotic RNA polymerases of DNA modified at a d(GG) or a d(AG) site by the antitumor drug cis-diamminedichloroplatinum(II), Biochemistry 30 (1) (1991) 222–230. [38] K.M. Comess, J.N. Burstyn, J.M. Essigmann, S.J. Lippard, Replication inhibition and translesion synthesis on templates containing site-specifically placed cis-diamminedichloroplatinum(II) DNA adducts, Biochemistry 31 (16) (1992) 3975–3990. [39] D.E. Szymkowski, K. Yarema, J.M. Essigmann, S.J. Lippard, R.D. Wood, An intrastrand d(GpG) platinum crosslink in duplex M13 DNA is refractory to repair by human cell extracts, Proc. Natl. Acad. Sci. U.S.A. 89 (22) (1992) 10772–10776. [40] J.M. Rosenberg, P.H. Sato, Cisplatin inhibits in vitro translation by preventing the formation of complete initiation complex, Mol. Pharmacol. 43 (3) (1993) 491–497.

[41] P. Vichi, F. Coin, J.P. Renaud, W. Vermeulen, J.H. Hoeijmakers, D. Moras, J.M. Egly, Cisplatin-UV-damaged DNA lure the basal transcription factor TFIID/TBP, EMBO J. 16 (24) (1997) 7444–7456. [42] K.A. Heminger, S.D. Hartson, J. Rogers, R.L. Matts, Cisplatin inhibits protein synthesis in rabbit reticulocyte lysate by causing an arrest in elongation, Arch. Biochem. Biophys. 344 (1) (1997) 200–207. [43] P. Jordan, M. Carmo-Fonseca, Cisplatin inhibits synthesis of ribosomal RNA in vivo, Nucleic Acids Res. 26 (12) (1998) 2831–2836. [44] Z. Suo, S.J. Lippard, K.A. Johnson, Single d(GpG)/cis-diammineplatinum(II) adduct-induced inhibition of DNA polymerization, Biochemistry 38 (2) (1999) 715–726. [45] S. Manic, L. Gatti, N. Carenini, G. Fumagalli, F. Zunino, P. Perego, Mechanisms controlling sensitivity to platinum complexes: role of p53 and DNA mismatch repair, Curr. Cancer Drug Targets 3 (1) (2003) 21–29. [46] M. Ramaswamy, A.T. Yeung, Sequence-specific interactions of UvrABC endonuclease with psoralen interstrand cross-links, J. Biol. Chem. 269 (1994) 485–492. [47] W.A. Franklin, W.A. Haseltine, Removal of UV light-induced pyrimidinepyrimidone (6–4) products from Escherichia coli DNA requires the uvrA, uvrB, and uvrC gene products, Proc. Natl. Acad. Sci. U.S.A. 81 (1984) 3821–3824. [48] A. Snowden, Y.W. Kow, B. Van Houten, Damage repertoire of the Escherichia coli UvrABC nuclease complex includes abasic sites, base-damage analogues, and lesions containing adjacent 5 or 3 nicks, Biochemistry 29 (1990) 7251–7259. [49] L.S. Vidal, L.B. Santos, C. Lage, A.C. Leitão, Enhanced sensitivity of Escherichia coli uvrB mutants to mitomycin C points to a UV-C distinct repair for DNA adducts, Chem. Res. Toxicol. 19 (10) (2006) 1351–1356. [50] C. Lage, S.R. Gonc¸alves, L.L. Souza, M. de Pádula, A.C. Leitão, Differential survival of Escherichia coli uvrA, uvrB, and uvrC mutants to psoralen plus UV-A (PUVA): evidence for uncoupled action of nucleotide excision repair to process DNA adducts, J. Photochem. Photobiol. B 98 (1) (2010) 40–47. [51] de Alencar, A.C. Leitão, C. Lage, Nitrogen mustard- and half-mustard-induced damage in Escherichia coli requires different DNA repair pathways, Mutat. Res. 582 (1–2) (2005) 105–115. [52] E.Y. Oh, L. Grossman, Helicase properties of the Escherichia coli UvrA2 B protein complex, Proc. Natl. Acad. Sci. U.S.A. 84 (1987) 3638–3642. [53] Y. Zou, B. Van Houten, Strand opening by the UvrA2 B complex allows dynamic recognition of DNA damage, EMBO J. 18 (1999) 4889–4901. [54] M. Bichara, R.P. Fuchs, uvrC gene function has no specific role in repair of N-2aminofluorene adducts, J. Bacteriol. 169 (1) (1987) 423–426. [55] M.L. Dronkert, R. Kanaar, Repair of DNA interstrand cross-links, Mutat. Res. 486 (4) (2001) 217–247. [56] E. Arikan, M.S. Kulkarni, D.C. Thomas, A. Sancar, Sequences of the E. coli uvrB gene and protein, Nucleic Acids Res. 14 (6) (1986) 2637–2650. [57] K.L. Keller, L. Terri, D. Overbeck-Carrick, J. Beck, Survival and induction of SOS in Escherichia coli treated with cisplatin, UV-irradiation, or mitomycin C are dependent on the function of the RecBC and RecFOR pathways of homologous recombination, Mutat. Res. 486 (2001) 21–29. [58] G.F. Moolenaar, S. van Rossum-Fikkirt, M. van Kesteren, N. Goosen, Cho, a second endonuclease involved in Escherichia coli nucleotide excision repair, Proc. Natl. Acad. Sci. U.S.A. 99 (2002) 1467–1472. [59] Z.Z. Zdraveski, J.A. Mello, M.G. Marinus, J.M. Essigmann, Multiple pathways of recombination define cellular responses to cisplatin, Chem. Biol. 7 (1) (2000) 39–50. [60] A. Nowosielska, M.A. Colmann, Z.Z. Draveski, J.M. Essigmann, M.G. Marinus, Spontaneous and cisplatin-induced recombination in Escherichia coli, DNA Repair 3 (7) (2004) 719–728. [61] R.J. Bienstock, M. Skorvaga, B.S. Mandavilli, B. Van Houten, Structural and functional characterization of the human DNA repair helicase XPD by comparative molecular modeling and site-directed mutagenesis of the bacterial repair protein UvrB, J. Biol. Chem. 278 (7) (2003) 5309–5316. [62] C. Lage, M. de Pádula, T.A.M. de Alencar, S.R.F. Gonc¸alves, L.S. Vidal, J. CabralNeto, A.C. Leitão, New insights on how nucleotide excision repair could remove DNA adducts induced by chemotherapeutic agents and psoralens plus UV-A (PUVA) in Escherichia coli, Mutat. Res. Rev. 544 (2003) 143–157.