- Email: [email protected]
Overexpression of FADD and Caspase-8 inhibits proliferation and promotes apoptosis of human glioblastoma cells
Biomedicine & Pharmacotherapy 93 (2017) 1–7
Available online at
ScienceDirect www.sciencedirect.com
Overexpression of FADD and Caspase-8 inhibits proliferation and promotes apoptosis of human glioblastoma cells Hong-Bin Wanga , Tao Lia , Dong-Zhou Maa , Yan-Xin Jib , Hua Zhic,* a b c
Department of Neurosurgery, Affiliated Hospital of Hebei University of Engineering, Handan 056029, PR China Department of Rehabilitation, Xingtai Hospital of Traditional Chinese Medicine, Xingtai 054000, PR China Department of Cardiology, Affiliated Hospital of Hebei University of Engineering, Handan 056029, PR China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 20 December 2016 Received in revised form 19 May 2017 Accepted 22 May 2017
Introduction: The study aimed at exploring the effects involved in Fas-Associated protein with Death Domain (FADD) expression and cysteine-aspartic acid specific protease-8 (Caspase-8) in relation to the proliferation and apoptosis of human glioblastoma (GBM) cells. Material and methods: 93 GBM tissues and 64 normal brain tissues were the central mediums used for the investigation of the study. Cultured human GBM SC189 cells were divided into separate groups including the blank negative control (NC), FADD and Caspase-8 groups. The mRNA and protein expressions of FADD and Caspase-8 in tissues and human glioblastoma (GBM) cells were detected using qRT-PCR and Western blotting techniques. Cell proliferation was tested by CCK-8. Flow cytometry was used for the measure of cell cycle and apoptosis rates. Results: The mRNA and protein expressions of FADD and Caspase-8 in GBM tissues were less than the levels of expression displayed in normal brain tissues. Correlations between the expressions of FADD and Caspase-8 in GBM tissues were analyzed as being linked with the clinical grades of GBM patients. Patients in stage III + IV displayed lower expressions of FADD and Caspase-8 than patients in stage I + II. In comparison with the blank group, the FADD and Caspase-8 groups showed decreased proliferation rates of SHG44 cells and lower ratios of cells in the S phase and Bcl-2 expression. Greater ratios of cells in the G0/G1 stage as well as increased cell apoptosis and expressions of Caspase-8 and Bax were exhibited. The expression of FADD in the FADD group was higher than the blank group, however no significant differences in FADD expression was observed between the blank and Caspase-8 groups. Conclusion: The data obtained during the study demonstrated that overexpression of FADD and Caspase-8 suppresses proliferation whilst promoting the apoptosis of human GBM cells. © 2017 Published by Elsevier Masson SAS.
Keywords: Fas-Associated protein with Death Domain Cysteine-aspartic acid specific protease-8 Glioblastoma Cell apoptosis Cell proliferation Overexpression
1. Introduction Glioblastoma (GBM) is widely renowned as being the most frequent and destructive malignant tumor of the brain. GBM is characterized by rapid metastasis, high heterogeneity, and diffusive and infiltrative growth in brain parenchyma. The tumor exhibits high rates of recurrence as well as having a poor prognosis
Abbreviations: GBM, glioblastoma; NC, negative control; FADD, fas Associated protein with Death Domain; HRP, horse radish peroxidase; OD, optical density; FCM, flow cytometry; qRT-PCR, quantitative real-time polymerase chain reaction; SD, standard deviation; DR5, death receptor 5; DD, death domain; DISC, deathinducing signaling complex; DED, death effector domain; SDS-PAGE electrophoresis, sodium dodecyl sulfate polyacrylamide gel electrophoresis. * Corresponding author at: Department of Cardiology, Affiliated Hospital of Hebei University of Engineering, No. 81, Congtai Road, Handan 056029, Hebei Province, PR China. E-mail address: [email protected] (H. Zhi). http://dx.doi.org/10.1016/j.biopha.2017.05.105 0753-3322/© 2017 Published by Elsevier Masson SAS.
[1,2]. Currently methods of treating GBM are limited to mainly surgical resection, radiotherapy, chemotherapy, immunotherapy and molecular targeted therapy [3]. GBM exhibits widespread molecular alterations as well as a highly-distorted epigenome [4]. At present various scientific literature and evidence supports notion held that microRNAs (miRNAs) promote tumor development through interaction with their target genes including GBM. Furthermore, many individual genes (as well as the aforementioned miRNAs) assigned to survival-related modules share a close relationship with the survival of GBM patients [2]. Fas-Associated protein along with Death Domain (FADD), also referred to as MORT1, is encoded by the FADD gene on the 11q13.3 region of the 11th chromosome in the human genome [5]. It consists of a C terminal death domain (DD) and an N terminal death effector domain (DED) [6] FADD is understood to be a necroptosisregulating gene that accelerates inflammation. Patients suffering from relapsing remitting multiple sclerosis have displayed higher
2
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7
FADD levels of expression in comparison to healthy individuals [7]. Additionally, mutant cells lacking caspase-8 or FADD are resistant to cell death induced by tumor necrosis factor-related apoptosisinducing ligand (TRAIL) [8]. TRAIL is a cell apoptosis inducing ligand [9]. FADD combined with cysteine-aspartic acid specific protease-8 (Caspase-8) plays a significant role in the transmission of TRAIL-induced apoptosis signals [10]. Caspase-8 is a cysteineaspartic acid specific protease encoded by the CASP8 gene, whose sequential activation is essential in the execution-phase of cell apoptosis [11,12]. This study aimed to detect cell apoptosis in patients with GBM and measure the mRNA expression of FADD and Caspase-8 proteins amongst healthy brain tissues, GBM tissues, human cell lines, and human embryonic kidney HEK293 cells. Through various modes of analysis, the ability of FADD and Caspase-8 proteins to influence the proliferation and apoptosis rates in GBM cells was observed. 2. Materials and methods 2.1. Ethics statement The study was conducted in full accordance with The Ethics Committee of the Institutional Review Board of the Affiliated Hospital of Hebei University of Engineering. Written informed consent documentation was obtained from all participants of the study. 2.2. Sample collection Between October 2012 and October 2015 93 GBM tissues obtained from GBM patients at the Affiliated Hospital of Hebei University of Engineering. The 93 GBM tissues obtained were selected as the case group. The GBM tissues were confirmed as positive by means of surgery at the Department of Neurosurgery of the aforementioned hospital. All included patients were reevaluated and again diagnosed, based on the World Health Organization (WHO) classification of tumors of the nervous system (2000) [13]. The control group consisted of 64 patients undergoing internal decompression due to severe craniocerebral injuries, as well as the normal brain tissues around the area of trauma. All patients included in the case group had no history of radiotherapy, chemotherapy or immunotherapy. Additionally, all participants in the study had no evidence of significant necrotic tumor tissues. Following hospitalization, all patients underwent an enhanced MRI examination of the head to verify the existence of GBM tissues. The case group consisted of 43 males and 50 females, with a mean age of 45.5 11.5 years (age: 28–64 years). The control group consisted of 38 males and 26 females, with a mean age of 47.1 8.5 years (age: 31–67 years). Both the GBM and normal tissues were obtained during surgery and immediately stored in liquid nitrogen. 2.3. Cell culture and grouping The Human GBM cells (SC189, U251, SHG44) and human embryonic kidney cells (HEK293) were purchased from the Cell Center of Shanghai Institute for Biological Sciences. The cells were cultured in a DMEM culture medium (Corning Inc., Corning, NY, USA) containing 10% fetal calf serum (Gibico, Grand Island, NY, USA) in an incubator at 5% CO2 with a saturated humidity temperature of 37 C. The culture medium was changed every 3– 5 days. The SHG44 cells in the logarithmic phase of growth were transfected and divided into the blank group, negative control (NC) group (transfected with empty plasmids), FADD group (transfected with overexpressed FADD plasmids) and Caspase-8 group (transfected with overexpressed Caspase-8 plasmids). Based on the
sequences of FADD and Caspase-8 genes in the Gen Bank, the cDNA primer sequences were set as follows: FADD: upstream: 50 GCTAGCATGGACCCGTTCCTGGTGCTG-30 , downstream: 50 -TCAGGACGCTTCGGAGGT-30 ; Caspase-8: upstream, 50 -TCAGTGCCATAGATGATGCCC-30 ; downstream: 50 -AAGGGAACTTCAGACACCAGG30 . The Bam H I and Xho I restriction-enzyme cleavage sites were inserted into the primers of FADD and Caspase-8 plasmids, were synthesized by the Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). PCR amplification was conducted and purified FADD was cloned into the pEGFPN1 vectors for the construction of overexpressed FADD and Caspase-8 plasmids. 2.4. Quantitative real-time polymerase chain reaction (qRT-PCR) The total RNA was extracted from the frozen tissues. Cells in the logarithmic phase of growth were obtained using the Trizol method (Invitrogen, Carlsbad, CA, USA) and subsequently stored at a controlled temperature of 80 C. The PrimeSeript@ RT reagent Kit (Perfect Real Time, Takara Biotechnology Co., Ltd., Dalian, China) was utilized in order to reverse-transcribe the total RNA into cDNA which was then stored at 20 C and reserved for further use. GAPDH was considered as the internal reference. The ABI 7500 quantitative PCR instrument (ABI, Austen, TX, USA) was used for qRT-PCR. The conditions of qRT-PCR were as follows: predenaturation for 5 min at 95 C, denaturation for 30 s at 90 C, annealing for 40 s at 60 C and extension for 40 s at 72 C, for a total of 40 cycles. Each experiment was conducted three times. Table 1 displays the primer sequences used in the PCR reactions. The 244Ct methods were used in order to calculate the relative expression of target gene to GAPDH. 2.5. Western blotting Protein lysing solution (Beyotime Biotechnology, Shanghai, China) was added to the frozen tissues and cells in logarithmic phase of growth for the extraction of total protein content. The Bradford method (Thermo, USA) was employed to quantify the total protein extracted. The total protein (50 mg) was separated using 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). Following this the membrane was blocked using 5% slim milk in a shaking bed for 1 h, and was incubated with rabbit anti human monoclonal antibodies, including FADD, Caspase-8, B-cell lymphoma-2 (Bcl-2), BCL2-Associated X (Bax), GAPDH (Cell Signaling Technology, USA, 1:1000), at 4 C overnight. The membrane was then washed by phosphatebuffered saline Tween (PBST) 3 times (5 min each time) and incubated for 2 h at 37 C with horse radish peroxidase (HRP)labeled goat anti rabbit secondary antibodies (Cell Signaling Technology, USA, 1:4000), and again washed by PBST. Luminol Reagent was mixed with Peroxide Solution (Millipore, USA) at a ratio of 1:1 for the purposes of photography and analysis. The
Table 1 The primer sequences for qRT-PCR. Gene
Sequence
FADD
F: CCGCCATCCTTCACCAGA R: CAATCACTCATCAGC F: CCTCATCAATCGGCTGGAC R: ATGACCCTGTAGGCAGAAACC F: AGAGGCAGGGATGTTCTG R: GACTCATGACCACAGTCCATGC
Caspase-8 GAPDH
Note: qRT-PCR, quantitative real-time polymerase chain reaction; FADD, FasAssociated protein with Death Domain; Caspase-8, cycstein-containing aspiratespecific protease-8;.
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7
3
Forty-eight hours after transfection, the SHG44 cells in logarithmic phrase of growth were obtained and adjusted to a density of 5 105 cells/mL. Cells were then inoculated in a 96-well plate and further incubated in a 5% CO2 incubator at 37 C for 0 h, 24 h, 48 h and 72 h, respectively. 100 mL of fresh culture medium containing 10 ul of CCK-8 reagent (Beyotime Biotechnology, Shanghai, China) was then added into each well for cell incubation. After 2 h, the medium was discarded, and the optical density (OD) value was measured at a wavelength of 490 nm using the Bio-Rad 680 micro-plate reader (Bio-Rad, USA). Cell proliferation rate was calculated based on the following formula: proliferation rate (%) = (OD value experimentalgroup OD value controlgroup)/OD value controlgroup 100%.
for 30 min, and finally stained using propidiom iodide (PI). Thereafter, the red fluorescence in cells was recorded using FCM and the cell cycle was analyzed. The ratio of cells in G0/G1, S and G2/M phases to total cells was calculated. Each experiment was conducted thrice. The SHG44 cells in logarithmic phrase of growth were adjusted to a density of 1 106 cells/mL. Cell suspension (0.5 mL) was obtained and placed into a centrifuge tube containing AnnexinVFITC (1.25 mL; Nanjing KeyGEN Biotech. Co., Ltd., Nanjing, China) reaction in the dark at room temperature for 15 min. Cell suspension was then subsequently centrifuged for 5 min at a rate of 1000g and the supernatant was then abandoned. Next, the cells were re-suspended in 0.5 mL of a pre-cooled binding buffer, followed by the addition of 10 mL of PI for staining. FCM (BD, USA) was immediately applied to detect cell apoptosis. In the scatter diagram, the right lower quadrant indicates early apoptotic cells and the right upper quadrant indicates late apoptotic cells. Rate of apoptosis = percentage of early apoptotic cells + percentage of late apoptotic cells.
2.7. Flow cytometry (FCM)
2.8. Statistical analysis
Twenty-four hours after transfection, the SHG44 cells in logarithmic phrase of growth were harvested, fixed in pre-cooled 75% ice ethanol (20 C) and preserved in a refrigerator at 4 C overnight. Following this the cells were centrifuged and washed in cold PBS twice in order to remove the stationary liquid. Next the cells were mixed with RNaseA, treated with water-bath in the dark
Statistical analysis was performed using the SPSS 21.0 software (SPSS Inc, Chicago, IL, USA). Enumeration data were expressed as ratio or percentage, and comparisons between groups were analyzed using the chi-square test. Measurement data were presented as mean standard deviation (SD), and both a t-test and one-way analysis of variance (ANOVA) were performed for
relative protein expression was calculated using the ratio of target band to control band. Each experiment was conducted 3 times, and the average values were calculated. 2.6. Cell count kit-8 (CCK-8) assay
Fig. 1. Expressions of FADD and Caspase-8 in GBM tissues and cells. Note: A, the mRNA expressions of FADD and Caspase-8 in GBM tissues and normal brain tissues, in which * indicates P < 0.05 compared with normal brain tissues; B, Western blotting analysis of the protein expressions of FADD and Caspase-8 in GBM tissues and normal brain tissues; C, the mRNA expressions of FADD and Caspase-8 in human GBM cells (SC189, U251, SHG44) and human embryonic kidney cells (HEK293), in which * indicates P < 0.05 compared with HEK293 cells; D, Western blotting analysis of the protein expressions of FADD and Caspase-8 in human GBM cells (SC189, U251, SHG44) and human embryonic kidney cells (HEK293); GBM, glioblastoma; FADD, fas-Associated protein with Death Domain; Caspase-8, cysteine-aspartic acid specific protease-8.
4
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7
comparisons between groups as well as for analysis amongst multiple groups. P < 0.05 was considered as being statistically significant. 3. Results 3.1. Expressions of FADD and Caspase-8 were reduced in GBM tissues and cells qRT-PCR (Fig. 1A, C) and Western blotting (Fig. 1B, D). Compared with normal brain tissues, the GBM tissues indicated significantly diminished mRNA and protein expressions of FADD and Caspase-8 (all P < 0.05). In comparison with the HEK293 cells, the mRNA and protein expressions of FADD and Caspase-8 were reduced in the SC189 cells (all P > 0.05), and expression in the U251 and SHG44 cells were significantly lower than the HEK293 cells (all P < 0.05). SHG44 cells displayed the lowest expressions of FADD and Caspase-8 and were selected for following experiments. 3.2. Associations between expressions of FADD and Caspase-8 and clinicopathological characteristics of GBM patients The results obtained indicated that the expressions of FADD and Caspase-8 in GBM tissues were correlated with the clinical grade of GBM patients. The expressions of FADD and Caspase-8 in patients at stage III + IV were lower than those in patients at stage I + II (both P < 0.05). However, no associations were detected between the expressions of FADD and Caspase-8, in regards to age, gender and lesion sites (all P > 0.05) as seen in Table 2. 3.3. Over-expressions of FADD and Caspase-8 inhibit proliferation of SHG44 cells CCK-8 (Fig. 2) illustrated cell proliferation observed in the SHG44 cells amongst all groups over a specific time period. No significant difference was detected amongst the NC groups and the blank groups at any time point (all P > 0.05). Twenty-four hours after incubation, there was no significant difference in the proliferation rate of SHG44 cells amongst the FADD, Caspase-8, and blank groups (all P > 0.05). Forty-eight hours after incubation, the proliferation rate of SHG44 cells in the FADD and Caspase-8 groups had significantly decreased compared with the blank group (all P < 0.0.5). No significant differences were detected between the FADD group and the Caspase-8 group (P > 0.05). The results obtained from the study highlighted that the overexpressions of FADD and Caspase-8 could inhibit the proliferation of SHG44 cells.
Table 2 Associations between the expressions of FADD and Caspase-8 with clinicopathological characteristics of patients with GBM. n Age (year) 40 >40 Gender Male Female Lesion site Frontal lobe Temporal lobe Other sites Clinical stage Stage I + II Stage III + IV
FADD
P
Caspase-8
>0.999 37 56
1.13 0.14 1.13 0.10
>0.999 0.49 0.07 0.49 0.07
0.099 43 50
1.15 0.13 1.11 0.11
41 32 20
1.15 0.13 1.13 0.11 1.10 0.11
61 32
1.15 0.12 1.10 0.11
P
3.4. Over-expressions of FADD and Caspase-8 arrest cell cycle of SHG44 cells in G0/G1 phase FCM (Fig. 3) revealed evidence relating to findings that cell cycles in the blank group and the NC group as being insignificant (P > 0.05). Compared with the blank group, the cells in the S phase in the FADD and Caspase-8 groups had reduced significantly. In contrast the cells in the G0/G1 phase had all increased (all P < 0.05), further indicating that over-expressions of FADD and Caspase-8 can suppress the cell transformation from the G0/G1 phase to the S phase. 3.5. Over-expressions of FADD and Caspase-8 promote apoptosis of SHG44 cells The FCM results indicate that the rate of apoptosis in the SHG44 cells of the blank group (12.29 3.12%) as not being significantly different from that of the NC group (13.96 3.43%). Compared with the blank group, the apoptosis rate of SHG44 cells in the FADD group (25.57 5.42%) and the Caspase-8 group (22.59 4.54%) had significantly increased (t = 3.678, P = 0.021; t = 3.239, P = 0.032) as seen in Fig. 4. 3.6. Comparisons of expressions of FADD, Caspase-8 and apoptosisrelated proteins among four groups Western blotting demonstrated that there was no significant difference in the expressions of FADD, Caspase-8, Bax and Bcl-2 between the blank and NC groups (all P > 0.05). In comparison with the blank group, the FADD group showed increased expressions of FADD, Caspase-8 and Bax whilst displaying decreased expressions of Bcl-2 (all P < 0.05). The Caspase-8 group showed increased expressions of Caspase-8 and Bax and decreased expression of Bcl2 (all P < 0.05). The expression of FADD showed no significant difference between the blank group and the Caspase-8 group (P > 0.05) as seen in Fig. 5. 4. Discussion
0.099 0.51 0.08 0.47 0.06
0.309
0.139 0.51 0.08 0.48 0.06 0.48 0.07
0.036
Fig. 2. Proliferation of GBM SHG44 cells in the blank, NC, FADD and Caspase-8 groups detected by CCK-8. Note: *, P < 0.05 compared with the blank group; CCK-8, cell count kit-8; GBM, glioblastoma; NC, negative control; FADD, fas-Associated protein with Death Domain; Caspase-8, cysteine-aspartic acid specific protease-8.
0.51 0.07 0.46 0.07
0.036
Note: GBM, glioblastoma; FADD, Fas-Associated protein with Death Domain; Caspase-8, cycstein-containing aspirate-specific protease-8; F, forward; R, reverse.
GBM is the most widespread primary brain tumor in adults. It is typically fatal [13]. Previous studies have demonstrated that patients with GBM had poor prognoses owing to therapeutic resistance and tumor recurrence after surgical removal of tumor [14]. This being said it is of the utmost importance that identification of new treatment approaches is applied for more effective treatment of GBM patients. Thus, the central objective of the study was to investigate the possible relationship between FADD and Caspase-8, as well as cell apoptosis in human GBM cells.
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7
5
Fig. 3. Cell cycle of GBM SHG44 cells in the blank, NC, FADD and Caspase-8 groups detected by FCM. Note: *, P < 0.05 compared with the blank group; GBM, glioblastoma; FCM, flow cytometry; NC, negative control; FADD, fas-Associated protein with Death Domain; Caspase-8, cysteine-aspartic acid specific protease-8.
Fig. 4. Apoptosis of GBM SHG44 cells in the blank, NC, FADD and Caspase-8 groups detected by FCM. Note: *, P < 0.05 compared with the blank group; GBM, glioblastoma; FCM, flow cytometry; NC, negative control; FADD, fas-Associated protein with Death Domain; Caspase-8, cysteine-aspartic acid specific protease-8.
Our results suggest that the over-expression of FADD and Caspase8 could suppress proliferation and promote apoptosis of GBM cells. GBM tissues and GBM cells exhibited reduced levels of expression in FADD and Caspase-8. This was further highlighted by the observation of GBM patients in stage III + IV. Patients in stage III + IV had relatively lower expressions of FADD and Caspase-8 than those in stage I + II. Furthermore, evidence suggests that
several key components in the extrinsic apoptotic pathway, including Fas, death receptor 5 (DR5), FADD and Caspase-8, may implicate the cell growth or metastasis in cancers [15]. Therefore, it is suspected that the reduced expression of FADD and Caspase-8 may provide a favorable microenvironment for the development of tumor cells. It has previously been reported that the apoptotic defects facilitate tumor cells with survival advantages [16]. In the
6
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7
Fig. 5. Protein expressions of FADD, Caspase-8, Bax and Bcl-2 in the blank, NC, FADD and Caspase-8 groups. Note: (A), Western blotting analysis of the protein expressions of FADD, Caspase-8, Bax and Bcl-2 in each group; (B), histogram showing the relative protein expressions of FADD, Caspase-8, Bax and Bcl-2 in each group; *, P < 0.05 compared with the blank group; NC, negative control; FADD, fas-Associated protein with Death Domain; Caspase-8, cysteine-aspartic acid specific protease-8; Bcl-2, B-cell lymphoma-2; Bax, BCL2-Associated X.
present case, deduced based on empirical that the decreased expression of FADD and Caspase-8 may be related to the cell apoptosis in GBM. Previous reported research has indicated that the loss of Caspase-8 in cells contributes to chronic inflammation, which results from enhanced signaling upon necrotic cell death, mediated by the protein kinases, RIPK1 and RIPK3 and cleaved by Caspase-8 [16]. The absence of FADD expression in synoviocytes has been reported by various studies as contributing to chronic inflammation mediated by Toll-like receptor 4 (TLR4) and type I interleukin-1 receptor (IL-1R1) [17]. Tourneur et al. postulated that the in thyroid follicular cells, silenced protein expression of FADD can result in increased cell proliferation and resistance to cell apoptosis mediated by various death receptors through Fas/FasL interaction [18]. Due to the oligomerization and the linkage between death receptors in plasma membrane and FADD molecules, the overexpression of FADD can stimulate cell apoptosis even with a lack of death receptor ligands [19]. In the progression of inducing tumor cell apoptosis, TRAIL initially combines with the death receptor (DR5) on the cell surface, and subsequently collects FADD and pro-Caspase-8 through the Death Effector Domain (DED) of FADD, thereby contributing to the assembly of death-inducing signaling complex (DISC) of DR5-FADD-Caspase-8 [20]. Once Caspase-8 is collected in DISC by FADD, two subunits, P10 and P18, are released after the two-step process of auto-protein hydroxylation, and Caspase-8 pathway is activated accordingly to transmit and intensify the apoptosis signals, inducing the apoptosis reaction of tumor cells whilst specifically killing the tumor cells [21,22]. At present, there is evidence supporting the idea that mutagenesis of FADD and functional reconstitution with its binding partners defines the interaction with the intracellular domain of CD95 and the prodomain of procaspase-8 [23]. Gene mutations hinder the transmission of apoptosis signals induced by TRAIL could be a plausible reason for TRAIL resistance in malignant tumor cells [24]. Thus it was accordingly hypothesized that low expression of FADD and Caspase-8 hinders the correct assembly of DISC. This also blocks the transmission of apoptosis signals induced by TRAIL and results in the generation of TRAIL resistance in cancer cells [10]. Yang et al. additionally highlighted that the methylation of Caspase-8 gene as being a key factor accounting for the low expression of Caspase-8, however these finding require further insight and confirmation through more study. [25]. Bax protein forms a heterodimer through a combination with Bcl-2, functions
as an apoptotic activator [26,27]. Consistent with previously reported findings, our results similarly revealed that groups with over-expressed FADD and Caspase-8, exhibit increased expression of Bax as well as reduced levels bcl-2 expression. Therefore, based on these findings, it was concluded that over-expression of FADD and Caspase-8 inhibits cell proliferation and induces cell apoptosis in GBM. 5. Conclusion In summary, the conducted study has provided evidence suggesting that GBM patient’s display reduced expression of FADD and Caspase-8. GBM patients additionally exhibit over-expression of FADD and Caspase-8. Based on the analysis of these altered levels of expression it has been postulated that these changes in expressions are capable of suppressing cell proliferation and accelerating cell apoptosis in GBM. Declare of interest None Acknowledgement The authors want to show their appreciation to reviewers for their helpful comments. References [1] A. Omuro, L.M. DeAngelis, Glioblastoma and other malignant gliomas: a clinical review, JAMA 310 (2013) 1842–1850. [2] Z.T. Bing, G.H. Yang, J. Xiong, L. Guo, L. Yang, Identify signature regulatory network for glioblastoma prognosis by integrative mRNA and miRNA coexpression analysis, IET Syst. Biol. 10 (2016) 244–251. [3] H. Sarin, Recent progress towards development of effective systemic chemotherapy for the treatment of malignant brain tumors, J. Transl. Med. 7 (2009) 77. [4] K.C. Johnson, E.A. Houseman, J.E. King, K.M. von Herrmann, C.E. Fadul, B.C. Christensen, 5-Hydroxymethylcytosine localizes to enhancer elements and is associated with survival in glioblastoma patients, Nat. Commun. 7 (2016) 13177. [5] P.K. Kim, A.S. Dutra, S.C. Chandrasekharappa, J.M. Puck, Genomic structure and mapping of human FADD, an intracellular mediator of lymphocyte apoptosis, J. Immunol. 157 (1996) 5461–5466. [6] C. Sandu, G. Morisawa, I. Wegorzewska, T. Huang, A.F. Arechiga, J.M. Hill, et al., FADD self-association is required for stable interaction with an activated death receptor, Cell Death Differ. 13 (2006) 2052–2061.
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7 [7] R. Reuss, M. Mistarz, A. Mirau, J. Kraus, R.H. Bodeker, P. Oschmann, FADD is upregulated in relapsing remitting multiple sclerosis, Neuroimmunomodulation 21 (2014) 221–225. [8] J.L. Bodmer, N. Holler, S. Reynard, P. Vinciguerra, P. Schneider, P. Juo, et al., TRAIL receptor-2 signals apoptosis through FADD and caspase-8, Nat. Cell Biol. 2 (2000) 241–243. [9] S.R. Wiley, K. Schooley, P.J. Smolak, W.S. Din, C.P. Huang, J.K. Nicholl, et al., Identification and characterization of a new member of the TNF family that induces apoptosis, Immunity 3 (1995) 673–682. [10] C.P. Dillon, A. Oberst, R. Weinlich, L.J. Janke, T.B. Kang, T. Ben-Moshe, et al., Survival function of the FADD-CASPASE-8-cFLIP(L) complex, Cell Rep. 1 (2012) 401–407. [11] F.G. Gervais, R. Singaraja, S. Xanthoudakis, C.A. Gutekunst, B.R. Leavitt, M. Metzler, et al., Recruitment and activation of caspase-8 by the Huntingtininteracting protein Hip-1 and a novel partner Hippi, Nat. Cell Biol. 4 (2002) 95– 105. [12] A. Alcivar, S. Hu, J. Tang, X. Yang, DEDD and DEDD2 associate with caspase-8/10 and signal cell death, Oncogene 22 (2003) 291–297. [13] H. Radner, I. Blumcke, G. Reifenberger, O.D. Wiestler, The new WHO classification of tumors of the nervous system 2000. Pathology and genetics, Pathologe 23 (2002) 260–283. [14] J. Chen, Y. Li, T.S. Yu, R.M. McKay, D.K. Burns, S.G. Kernie, et al., A restricted cell population propagates glioblastoma growth after chemotherapy, Nature 488 (2012) 522–526. [15] S.Y. Sun, Understanding the role of the death receptor 5/FADD/caspase-8 death signaling in cancer metastasis, Mol. Cell. Pharmacol. 3 (2011) 31–34. [16] W. Hou, J. Han, C. Lu, L.A. Goldstein, H. Rabinowich, Autophagic degradation of active caspase-8: a crosstalk mechanism between autophagy and apoptosis, Autophagy 6 (2010) 891–900. [17] L. Tourneur, S. Mistou, V. Vilmont, AB0284 Local and systemic (ESPOIR cohort) human soluble fadd is a new inflammatory marker in rheumatoid arthritis, Ann. Rheum. Dis. 71 (2013) 653–654.
7
[18] L. Tourneur, S. Mistou, F.M. Michiels, V. Devauchelle, L. Renia, J. Feunteun, et al., Loss of FADD protein expression results in a biased Fas-signaling pathway and correlates with the development of tumoral status in thyroid follicular cells, Oncogene 22 (2003) 2795–2804. [19] M. Gomez-Angelats, J.A. Cidlowski, Molecular evidence for the nuclear localization of FADD, Cell Death Differ. 10 (2003) 791–797. [20] M.C. Tse, A.C. Bellail, J.H. Song, DR5-mediated DISC controls caspase-8 cleavage and initiation of apoptosis in human glioblastomas, J. Cell. Mol. Med. 14 (2010) 1303–1317. [21] M. Kumazaki, H. Shinohara, K. Taniguchi, H. Ueda, M. Nishi, A. Ryo, et al., Understanding of tolerance in TRAIL-induced apoptosis and cancelation of its machinery by alpha-mangostin, a xanthone derivative, Oncotarget 6 (2015) 25828–25842. [22] P. Gurung, P.K. Anand, R.K. Malireddi, L. Vande Walle, N. Van Opdenbosch, C.P. Dillon, et al., FADD and caspase-8 mediate priming and activation of the canonical and noncanonical Nlrp3 inflammasomes, J. Immunol. 192 (2014) 1835–1846. [23] P.E. Carrington, C. Sandu, Y. Wei, J.M. Hill, G. Morisawa, T. Huang, et al., The structure of FADD and its mode of interaction with procaspase-8, Mol. Cell 22 (2006) 599–610. [24] R.G. Verhaak, K.A. Hoadley, E. Purdom, V. Wang, Y. Qi, M.D. Wilkerson, et al., Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1, Cancer Cell 17 (2010) 98–110. [25] X. Yang, C.J. Thiele, Targeting the tumor necrosis factor-related apoptosisinducing ligand path in neuroblastoma, Cancer Lett. 197 (2003) 137–143. [26] D. Westphal, R.M. Kluck, G. Dewson, Building blocks of the apoptotic pore: how Bax and Bak are activated and oligomerize during apoptosis, Cell Death Differ. 21 (2014) 196–205. [27] J.M. Hardwick, L. Soane, Multiple functions of BCL-2 family proteins, Cold Spring Harbor Perspect. Biol. 5 (2013).
Available online at
ScienceDirect www.sciencedirect.com
Overexpression of FADD and Caspase-8 inhibits proliferation and promotes apoptosis of human glioblastoma cells Hong-Bin Wanga , Tao Lia , Dong-Zhou Maa , Yan-Xin Jib , Hua Zhic,* a b c
Department of Neurosurgery, Affiliated Hospital of Hebei University of Engineering, Handan 056029, PR China Department of Rehabilitation, Xingtai Hospital of Traditional Chinese Medicine, Xingtai 054000, PR China Department of Cardiology, Affiliated Hospital of Hebei University of Engineering, Handan 056029, PR China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 20 December 2016 Received in revised form 19 May 2017 Accepted 22 May 2017
Introduction: The study aimed at exploring the effects involved in Fas-Associated protein with Death Domain (FADD) expression and cysteine-aspartic acid specific protease-8 (Caspase-8) in relation to the proliferation and apoptosis of human glioblastoma (GBM) cells. Material and methods: 93 GBM tissues and 64 normal brain tissues were the central mediums used for the investigation of the study. Cultured human GBM SC189 cells were divided into separate groups including the blank negative control (NC), FADD and Caspase-8 groups. The mRNA and protein expressions of FADD and Caspase-8 in tissues and human glioblastoma (GBM) cells were detected using qRT-PCR and Western blotting techniques. Cell proliferation was tested by CCK-8. Flow cytometry was used for the measure of cell cycle and apoptosis rates. Results: The mRNA and protein expressions of FADD and Caspase-8 in GBM tissues were less than the levels of expression displayed in normal brain tissues. Correlations between the expressions of FADD and Caspase-8 in GBM tissues were analyzed as being linked with the clinical grades of GBM patients. Patients in stage III + IV displayed lower expressions of FADD and Caspase-8 than patients in stage I + II. In comparison with the blank group, the FADD and Caspase-8 groups showed decreased proliferation rates of SHG44 cells and lower ratios of cells in the S phase and Bcl-2 expression. Greater ratios of cells in the G0/G1 stage as well as increased cell apoptosis and expressions of Caspase-8 and Bax were exhibited. The expression of FADD in the FADD group was higher than the blank group, however no significant differences in FADD expression was observed between the blank and Caspase-8 groups. Conclusion: The data obtained during the study demonstrated that overexpression of FADD and Caspase-8 suppresses proliferation whilst promoting the apoptosis of human GBM cells. © 2017 Published by Elsevier Masson SAS.
Keywords: Fas-Associated protein with Death Domain Cysteine-aspartic acid specific protease-8 Glioblastoma Cell apoptosis Cell proliferation Overexpression
1. Introduction Glioblastoma (GBM) is widely renowned as being the most frequent and destructive malignant tumor of the brain. GBM is characterized by rapid metastasis, high heterogeneity, and diffusive and infiltrative growth in brain parenchyma. The tumor exhibits high rates of recurrence as well as having a poor prognosis
Abbreviations: GBM, glioblastoma; NC, negative control; FADD, fas Associated protein with Death Domain; HRP, horse radish peroxidase; OD, optical density; FCM, flow cytometry; qRT-PCR, quantitative real-time polymerase chain reaction; SD, standard deviation; DR5, death receptor 5; DD, death domain; DISC, deathinducing signaling complex; DED, death effector domain; SDS-PAGE electrophoresis, sodium dodecyl sulfate polyacrylamide gel electrophoresis. * Corresponding author at: Department of Cardiology, Affiliated Hospital of Hebei University of Engineering, No. 81, Congtai Road, Handan 056029, Hebei Province, PR China. E-mail address: [email protected] (H. Zhi). http://dx.doi.org/10.1016/j.biopha.2017.05.105 0753-3322/© 2017 Published by Elsevier Masson SAS.
[1,2]. Currently methods of treating GBM are limited to mainly surgical resection, radiotherapy, chemotherapy, immunotherapy and molecular targeted therapy [3]. GBM exhibits widespread molecular alterations as well as a highly-distorted epigenome [4]. At present various scientific literature and evidence supports notion held that microRNAs (miRNAs) promote tumor development through interaction with their target genes including GBM. Furthermore, many individual genes (as well as the aforementioned miRNAs) assigned to survival-related modules share a close relationship with the survival of GBM patients [2]. Fas-Associated protein along with Death Domain (FADD), also referred to as MORT1, is encoded by the FADD gene on the 11q13.3 region of the 11th chromosome in the human genome [5]. It consists of a C terminal death domain (DD) and an N terminal death effector domain (DED) [6] FADD is understood to be a necroptosisregulating gene that accelerates inflammation. Patients suffering from relapsing remitting multiple sclerosis have displayed higher
2
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7
FADD levels of expression in comparison to healthy individuals [7]. Additionally, mutant cells lacking caspase-8 or FADD are resistant to cell death induced by tumor necrosis factor-related apoptosisinducing ligand (TRAIL) [8]. TRAIL is a cell apoptosis inducing ligand [9]. FADD combined with cysteine-aspartic acid specific protease-8 (Caspase-8) plays a significant role in the transmission of TRAIL-induced apoptosis signals [10]. Caspase-8 is a cysteineaspartic acid specific protease encoded by the CASP8 gene, whose sequential activation is essential in the execution-phase of cell apoptosis [11,12]. This study aimed to detect cell apoptosis in patients with GBM and measure the mRNA expression of FADD and Caspase-8 proteins amongst healthy brain tissues, GBM tissues, human cell lines, and human embryonic kidney HEK293 cells. Through various modes of analysis, the ability of FADD and Caspase-8 proteins to influence the proliferation and apoptosis rates in GBM cells was observed. 2. Materials and methods 2.1. Ethics statement The study was conducted in full accordance with The Ethics Committee of the Institutional Review Board of the Affiliated Hospital of Hebei University of Engineering. Written informed consent documentation was obtained from all participants of the study. 2.2. Sample collection Between October 2012 and October 2015 93 GBM tissues obtained from GBM patients at the Affiliated Hospital of Hebei University of Engineering. The 93 GBM tissues obtained were selected as the case group. The GBM tissues were confirmed as positive by means of surgery at the Department of Neurosurgery of the aforementioned hospital. All included patients were reevaluated and again diagnosed, based on the World Health Organization (WHO) classification of tumors of the nervous system (2000) [13]. The control group consisted of 64 patients undergoing internal decompression due to severe craniocerebral injuries, as well as the normal brain tissues around the area of trauma. All patients included in the case group had no history of radiotherapy, chemotherapy or immunotherapy. Additionally, all participants in the study had no evidence of significant necrotic tumor tissues. Following hospitalization, all patients underwent an enhanced MRI examination of the head to verify the existence of GBM tissues. The case group consisted of 43 males and 50 females, with a mean age of 45.5 11.5 years (age: 28–64 years). The control group consisted of 38 males and 26 females, with a mean age of 47.1 8.5 years (age: 31–67 years). Both the GBM and normal tissues were obtained during surgery and immediately stored in liquid nitrogen. 2.3. Cell culture and grouping The Human GBM cells (SC189, U251, SHG44) and human embryonic kidney cells (HEK293) were purchased from the Cell Center of Shanghai Institute for Biological Sciences. The cells were cultured in a DMEM culture medium (Corning Inc., Corning, NY, USA) containing 10% fetal calf serum (Gibico, Grand Island, NY, USA) in an incubator at 5% CO2 with a saturated humidity temperature of 37 C. The culture medium was changed every 3– 5 days. The SHG44 cells in the logarithmic phase of growth were transfected and divided into the blank group, negative control (NC) group (transfected with empty plasmids), FADD group (transfected with overexpressed FADD plasmids) and Caspase-8 group (transfected with overexpressed Caspase-8 plasmids). Based on the
sequences of FADD and Caspase-8 genes in the Gen Bank, the cDNA primer sequences were set as follows: FADD: upstream: 50 GCTAGCATGGACCCGTTCCTGGTGCTG-30 , downstream: 50 -TCAGGACGCTTCGGAGGT-30 ; Caspase-8: upstream, 50 -TCAGTGCCATAGATGATGCCC-30 ; downstream: 50 -AAGGGAACTTCAGACACCAGG30 . The Bam H I and Xho I restriction-enzyme cleavage sites were inserted into the primers of FADD and Caspase-8 plasmids, were synthesized by the Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. (Shanghai, China). PCR amplification was conducted and purified FADD was cloned into the pEGFPN1 vectors for the construction of overexpressed FADD and Caspase-8 plasmids. 2.4. Quantitative real-time polymerase chain reaction (qRT-PCR) The total RNA was extracted from the frozen tissues. Cells in the logarithmic phase of growth were obtained using the Trizol method (Invitrogen, Carlsbad, CA, USA) and subsequently stored at a controlled temperature of 80 C. The PrimeSeript@ RT reagent Kit (Perfect Real Time, Takara Biotechnology Co., Ltd., Dalian, China) was utilized in order to reverse-transcribe the total RNA into cDNA which was then stored at 20 C and reserved for further use. GAPDH was considered as the internal reference. The ABI 7500 quantitative PCR instrument (ABI, Austen, TX, USA) was used for qRT-PCR. The conditions of qRT-PCR were as follows: predenaturation for 5 min at 95 C, denaturation for 30 s at 90 C, annealing for 40 s at 60 C and extension for 40 s at 72 C, for a total of 40 cycles. Each experiment was conducted three times. Table 1 displays the primer sequences used in the PCR reactions. The 244Ct methods were used in order to calculate the relative expression of target gene to GAPDH. 2.5. Western blotting Protein lysing solution (Beyotime Biotechnology, Shanghai, China) was added to the frozen tissues and cells in logarithmic phase of growth for the extraction of total protein content. The Bradford method (Thermo, USA) was employed to quantify the total protein extracted. The total protein (50 mg) was separated using 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane (Millipore, USA). Following this the membrane was blocked using 5% slim milk in a shaking bed for 1 h, and was incubated with rabbit anti human monoclonal antibodies, including FADD, Caspase-8, B-cell lymphoma-2 (Bcl-2), BCL2-Associated X (Bax), GAPDH (Cell Signaling Technology, USA, 1:1000), at 4 C overnight. The membrane was then washed by phosphatebuffered saline Tween (PBST) 3 times (5 min each time) and incubated for 2 h at 37 C with horse radish peroxidase (HRP)labeled goat anti rabbit secondary antibodies (Cell Signaling Technology, USA, 1:4000), and again washed by PBST. Luminol Reagent was mixed with Peroxide Solution (Millipore, USA) at a ratio of 1:1 for the purposes of photography and analysis. The
Table 1 The primer sequences for qRT-PCR. Gene
Sequence
FADD
F: CCGCCATCCTTCACCAGA R: CAATCACTCATCAGC F: CCTCATCAATCGGCTGGAC R: ATGACCCTGTAGGCAGAAACC F: AGAGGCAGGGATGTTCTG R: GACTCATGACCACAGTCCATGC
Caspase-8 GAPDH
Note: qRT-PCR, quantitative real-time polymerase chain reaction; FADD, FasAssociated protein with Death Domain; Caspase-8, cycstein-containing aspiratespecific protease-8;.
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7
3
Forty-eight hours after transfection, the SHG44 cells in logarithmic phrase of growth were obtained and adjusted to a density of 5 105 cells/mL. Cells were then inoculated in a 96-well plate and further incubated in a 5% CO2 incubator at 37 C for 0 h, 24 h, 48 h and 72 h, respectively. 100 mL of fresh culture medium containing 10 ul of CCK-8 reagent (Beyotime Biotechnology, Shanghai, China) was then added into each well for cell incubation. After 2 h, the medium was discarded, and the optical density (OD) value was measured at a wavelength of 490 nm using the Bio-Rad 680 micro-plate reader (Bio-Rad, USA). Cell proliferation rate was calculated based on the following formula: proliferation rate (%) = (OD value experimentalgroup OD value controlgroup)/OD value controlgroup 100%.
for 30 min, and finally stained using propidiom iodide (PI). Thereafter, the red fluorescence in cells was recorded using FCM and the cell cycle was analyzed. The ratio of cells in G0/G1, S and G2/M phases to total cells was calculated. Each experiment was conducted thrice. The SHG44 cells in logarithmic phrase of growth were adjusted to a density of 1 106 cells/mL. Cell suspension (0.5 mL) was obtained and placed into a centrifuge tube containing AnnexinVFITC (1.25 mL; Nanjing KeyGEN Biotech. Co., Ltd., Nanjing, China) reaction in the dark at room temperature for 15 min. Cell suspension was then subsequently centrifuged for 5 min at a rate of 1000g and the supernatant was then abandoned. Next, the cells were re-suspended in 0.5 mL of a pre-cooled binding buffer, followed by the addition of 10 mL of PI for staining. FCM (BD, USA) was immediately applied to detect cell apoptosis. In the scatter diagram, the right lower quadrant indicates early apoptotic cells and the right upper quadrant indicates late apoptotic cells. Rate of apoptosis = percentage of early apoptotic cells + percentage of late apoptotic cells.
2.7. Flow cytometry (FCM)
2.8. Statistical analysis
Twenty-four hours after transfection, the SHG44 cells in logarithmic phrase of growth were harvested, fixed in pre-cooled 75% ice ethanol (20 C) and preserved in a refrigerator at 4 C overnight. Following this the cells were centrifuged and washed in cold PBS twice in order to remove the stationary liquid. Next the cells were mixed with RNaseA, treated with water-bath in the dark
Statistical analysis was performed using the SPSS 21.0 software (SPSS Inc, Chicago, IL, USA). Enumeration data were expressed as ratio or percentage, and comparisons between groups were analyzed using the chi-square test. Measurement data were presented as mean standard deviation (SD), and both a t-test and one-way analysis of variance (ANOVA) were performed for
relative protein expression was calculated using the ratio of target band to control band. Each experiment was conducted 3 times, and the average values were calculated. 2.6. Cell count kit-8 (CCK-8) assay
Fig. 1. Expressions of FADD and Caspase-8 in GBM tissues and cells. Note: A, the mRNA expressions of FADD and Caspase-8 in GBM tissues and normal brain tissues, in which * indicates P < 0.05 compared with normal brain tissues; B, Western blotting analysis of the protein expressions of FADD and Caspase-8 in GBM tissues and normal brain tissues; C, the mRNA expressions of FADD and Caspase-8 in human GBM cells (SC189, U251, SHG44) and human embryonic kidney cells (HEK293), in which * indicates P < 0.05 compared with HEK293 cells; D, Western blotting analysis of the protein expressions of FADD and Caspase-8 in human GBM cells (SC189, U251, SHG44) and human embryonic kidney cells (HEK293); GBM, glioblastoma; FADD, fas-Associated protein with Death Domain; Caspase-8, cysteine-aspartic acid specific protease-8.
4
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7
comparisons between groups as well as for analysis amongst multiple groups. P < 0.05 was considered as being statistically significant. 3. Results 3.1. Expressions of FADD and Caspase-8 were reduced in GBM tissues and cells qRT-PCR (Fig. 1A, C) and Western blotting (Fig. 1B, D). Compared with normal brain tissues, the GBM tissues indicated significantly diminished mRNA and protein expressions of FADD and Caspase-8 (all P < 0.05). In comparison with the HEK293 cells, the mRNA and protein expressions of FADD and Caspase-8 were reduced in the SC189 cells (all P > 0.05), and expression in the U251 and SHG44 cells were significantly lower than the HEK293 cells (all P < 0.05). SHG44 cells displayed the lowest expressions of FADD and Caspase-8 and were selected for following experiments. 3.2. Associations between expressions of FADD and Caspase-8 and clinicopathological characteristics of GBM patients The results obtained indicated that the expressions of FADD and Caspase-8 in GBM tissues were correlated with the clinical grade of GBM patients. The expressions of FADD and Caspase-8 in patients at stage III + IV were lower than those in patients at stage I + II (both P < 0.05). However, no associations were detected between the expressions of FADD and Caspase-8, in regards to age, gender and lesion sites (all P > 0.05) as seen in Table 2. 3.3. Over-expressions of FADD and Caspase-8 inhibit proliferation of SHG44 cells CCK-8 (Fig. 2) illustrated cell proliferation observed in the SHG44 cells amongst all groups over a specific time period. No significant difference was detected amongst the NC groups and the blank groups at any time point (all P > 0.05). Twenty-four hours after incubation, there was no significant difference in the proliferation rate of SHG44 cells amongst the FADD, Caspase-8, and blank groups (all P > 0.05). Forty-eight hours after incubation, the proliferation rate of SHG44 cells in the FADD and Caspase-8 groups had significantly decreased compared with the blank group (all P < 0.0.5). No significant differences were detected between the FADD group and the Caspase-8 group (P > 0.05). The results obtained from the study highlighted that the overexpressions of FADD and Caspase-8 could inhibit the proliferation of SHG44 cells.
Table 2 Associations between the expressions of FADD and Caspase-8 with clinicopathological characteristics of patients with GBM. n Age (year) 40 >40 Gender Male Female Lesion site Frontal lobe Temporal lobe Other sites Clinical stage Stage I + II Stage III + IV
FADD
P
Caspase-8
>0.999 37 56
1.13 0.14 1.13 0.10
>0.999 0.49 0.07 0.49 0.07
0.099 43 50
1.15 0.13 1.11 0.11
41 32 20
1.15 0.13 1.13 0.11 1.10 0.11
61 32
1.15 0.12 1.10 0.11
P
3.4. Over-expressions of FADD and Caspase-8 arrest cell cycle of SHG44 cells in G0/G1 phase FCM (Fig. 3) revealed evidence relating to findings that cell cycles in the blank group and the NC group as being insignificant (P > 0.05). Compared with the blank group, the cells in the S phase in the FADD and Caspase-8 groups had reduced significantly. In contrast the cells in the G0/G1 phase had all increased (all P < 0.05), further indicating that over-expressions of FADD and Caspase-8 can suppress the cell transformation from the G0/G1 phase to the S phase. 3.5. Over-expressions of FADD and Caspase-8 promote apoptosis of SHG44 cells The FCM results indicate that the rate of apoptosis in the SHG44 cells of the blank group (12.29 3.12%) as not being significantly different from that of the NC group (13.96 3.43%). Compared with the blank group, the apoptosis rate of SHG44 cells in the FADD group (25.57 5.42%) and the Caspase-8 group (22.59 4.54%) had significantly increased (t = 3.678, P = 0.021; t = 3.239, P = 0.032) as seen in Fig. 4. 3.6. Comparisons of expressions of FADD, Caspase-8 and apoptosisrelated proteins among four groups Western blotting demonstrated that there was no significant difference in the expressions of FADD, Caspase-8, Bax and Bcl-2 between the blank and NC groups (all P > 0.05). In comparison with the blank group, the FADD group showed increased expressions of FADD, Caspase-8 and Bax whilst displaying decreased expressions of Bcl-2 (all P < 0.05). The Caspase-8 group showed increased expressions of Caspase-8 and Bax and decreased expression of Bcl2 (all P < 0.05). The expression of FADD showed no significant difference between the blank group and the Caspase-8 group (P > 0.05) as seen in Fig. 5. 4. Discussion
0.099 0.51 0.08 0.47 0.06
0.309
0.139 0.51 0.08 0.48 0.06 0.48 0.07
0.036
Fig. 2. Proliferation of GBM SHG44 cells in the blank, NC, FADD and Caspase-8 groups detected by CCK-8. Note: *, P < 0.05 compared with the blank group; CCK-8, cell count kit-8; GBM, glioblastoma; NC, negative control; FADD, fas-Associated protein with Death Domain; Caspase-8, cysteine-aspartic acid specific protease-8.
0.51 0.07 0.46 0.07
0.036
Note: GBM, glioblastoma; FADD, Fas-Associated protein with Death Domain; Caspase-8, cycstein-containing aspirate-specific protease-8; F, forward; R, reverse.
GBM is the most widespread primary brain tumor in adults. It is typically fatal [13]. Previous studies have demonstrated that patients with GBM had poor prognoses owing to therapeutic resistance and tumor recurrence after surgical removal of tumor [14]. This being said it is of the utmost importance that identification of new treatment approaches is applied for more effective treatment of GBM patients. Thus, the central objective of the study was to investigate the possible relationship between FADD and Caspase-8, as well as cell apoptosis in human GBM cells.
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7
5
Fig. 3. Cell cycle of GBM SHG44 cells in the blank, NC, FADD and Caspase-8 groups detected by FCM. Note: *, P < 0.05 compared with the blank group; GBM, glioblastoma; FCM, flow cytometry; NC, negative control; FADD, fas-Associated protein with Death Domain; Caspase-8, cysteine-aspartic acid specific protease-8.
Fig. 4. Apoptosis of GBM SHG44 cells in the blank, NC, FADD and Caspase-8 groups detected by FCM. Note: *, P < 0.05 compared with the blank group; GBM, glioblastoma; FCM, flow cytometry; NC, negative control; FADD, fas-Associated protein with Death Domain; Caspase-8, cysteine-aspartic acid specific protease-8.
Our results suggest that the over-expression of FADD and Caspase8 could suppress proliferation and promote apoptosis of GBM cells. GBM tissues and GBM cells exhibited reduced levels of expression in FADD and Caspase-8. This was further highlighted by the observation of GBM patients in stage III + IV. Patients in stage III + IV had relatively lower expressions of FADD and Caspase-8 than those in stage I + II. Furthermore, evidence suggests that
several key components in the extrinsic apoptotic pathway, including Fas, death receptor 5 (DR5), FADD and Caspase-8, may implicate the cell growth or metastasis in cancers [15]. Therefore, it is suspected that the reduced expression of FADD and Caspase-8 may provide a favorable microenvironment for the development of tumor cells. It has previously been reported that the apoptotic defects facilitate tumor cells with survival advantages [16]. In the
6
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7
Fig. 5. Protein expressions of FADD, Caspase-8, Bax and Bcl-2 in the blank, NC, FADD and Caspase-8 groups. Note: (A), Western blotting analysis of the protein expressions of FADD, Caspase-8, Bax and Bcl-2 in each group; (B), histogram showing the relative protein expressions of FADD, Caspase-8, Bax and Bcl-2 in each group; *, P < 0.05 compared with the blank group; NC, negative control; FADD, fas-Associated protein with Death Domain; Caspase-8, cysteine-aspartic acid specific protease-8; Bcl-2, B-cell lymphoma-2; Bax, BCL2-Associated X.
present case, deduced based on empirical that the decreased expression of FADD and Caspase-8 may be related to the cell apoptosis in GBM. Previous reported research has indicated that the loss of Caspase-8 in cells contributes to chronic inflammation, which results from enhanced signaling upon necrotic cell death, mediated by the protein kinases, RIPK1 and RIPK3 and cleaved by Caspase-8 [16]. The absence of FADD expression in synoviocytes has been reported by various studies as contributing to chronic inflammation mediated by Toll-like receptor 4 (TLR4) and type I interleukin-1 receptor (IL-1R1) [17]. Tourneur et al. postulated that the in thyroid follicular cells, silenced protein expression of FADD can result in increased cell proliferation and resistance to cell apoptosis mediated by various death receptors through Fas/FasL interaction [18]. Due to the oligomerization and the linkage between death receptors in plasma membrane and FADD molecules, the overexpression of FADD can stimulate cell apoptosis even with a lack of death receptor ligands [19]. In the progression of inducing tumor cell apoptosis, TRAIL initially combines with the death receptor (DR5) on the cell surface, and subsequently collects FADD and pro-Caspase-8 through the Death Effector Domain (DED) of FADD, thereby contributing to the assembly of death-inducing signaling complex (DISC) of DR5-FADD-Caspase-8 [20]. Once Caspase-8 is collected in DISC by FADD, two subunits, P10 and P18, are released after the two-step process of auto-protein hydroxylation, and Caspase-8 pathway is activated accordingly to transmit and intensify the apoptosis signals, inducing the apoptosis reaction of tumor cells whilst specifically killing the tumor cells [21,22]. At present, there is evidence supporting the idea that mutagenesis of FADD and functional reconstitution with its binding partners defines the interaction with the intracellular domain of CD95 and the prodomain of procaspase-8 [23]. Gene mutations hinder the transmission of apoptosis signals induced by TRAIL could be a plausible reason for TRAIL resistance in malignant tumor cells [24]. Thus it was accordingly hypothesized that low expression of FADD and Caspase-8 hinders the correct assembly of DISC. This also blocks the transmission of apoptosis signals induced by TRAIL and results in the generation of TRAIL resistance in cancer cells [10]. Yang et al. additionally highlighted that the methylation of Caspase-8 gene as being a key factor accounting for the low expression of Caspase-8, however these finding require further insight and confirmation through more study. [25]. Bax protein forms a heterodimer through a combination with Bcl-2, functions
as an apoptotic activator [26,27]. Consistent with previously reported findings, our results similarly revealed that groups with over-expressed FADD and Caspase-8, exhibit increased expression of Bax as well as reduced levels bcl-2 expression. Therefore, based on these findings, it was concluded that over-expression of FADD and Caspase-8 inhibits cell proliferation and induces cell apoptosis in GBM. 5. Conclusion In summary, the conducted study has provided evidence suggesting that GBM patient’s display reduced expression of FADD and Caspase-8. GBM patients additionally exhibit over-expression of FADD and Caspase-8. Based on the analysis of these altered levels of expression it has been postulated that these changes in expressions are capable of suppressing cell proliferation and accelerating cell apoptosis in GBM. Declare of interest None Acknowledgement The authors want to show their appreciation to reviewers for their helpful comments. References [1] A. Omuro, L.M. DeAngelis, Glioblastoma and other malignant gliomas: a clinical review, JAMA 310 (2013) 1842–1850. [2] Z.T. Bing, G.H. Yang, J. Xiong, L. Guo, L. Yang, Identify signature regulatory network for glioblastoma prognosis by integrative mRNA and miRNA coexpression analysis, IET Syst. Biol. 10 (2016) 244–251. [3] H. Sarin, Recent progress towards development of effective systemic chemotherapy for the treatment of malignant brain tumors, J. Transl. Med. 7 (2009) 77. [4] K.C. Johnson, E.A. Houseman, J.E. King, K.M. von Herrmann, C.E. Fadul, B.C. Christensen, 5-Hydroxymethylcytosine localizes to enhancer elements and is associated with survival in glioblastoma patients, Nat. Commun. 7 (2016) 13177. [5] P.K. Kim, A.S. Dutra, S.C. Chandrasekharappa, J.M. Puck, Genomic structure and mapping of human FADD, an intracellular mediator of lymphocyte apoptosis, J. Immunol. 157 (1996) 5461–5466. [6] C. Sandu, G. Morisawa, I. Wegorzewska, T. Huang, A.F. Arechiga, J.M. Hill, et al., FADD self-association is required for stable interaction with an activated death receptor, Cell Death Differ. 13 (2006) 2052–2061.
H.-B. Wang et al. / Biomedicine & Pharmacotherapy 93 (2017) 1–7 [7] R. Reuss, M. Mistarz, A. Mirau, J. Kraus, R.H. Bodeker, P. Oschmann, FADD is upregulated in relapsing remitting multiple sclerosis, Neuroimmunomodulation 21 (2014) 221–225. [8] J.L. Bodmer, N. Holler, S. Reynard, P. Vinciguerra, P. Schneider, P. Juo, et al., TRAIL receptor-2 signals apoptosis through FADD and caspase-8, Nat. Cell Biol. 2 (2000) 241–243. [9] S.R. Wiley, K. Schooley, P.J. Smolak, W.S. Din, C.P. Huang, J.K. Nicholl, et al., Identification and characterization of a new member of the TNF family that induces apoptosis, Immunity 3 (1995) 673–682. [10] C.P. Dillon, A. Oberst, R. Weinlich, L.J. Janke, T.B. Kang, T. Ben-Moshe, et al., Survival function of the FADD-CASPASE-8-cFLIP(L) complex, Cell Rep. 1 (2012) 401–407. [11] F.G. Gervais, R. Singaraja, S. Xanthoudakis, C.A. Gutekunst, B.R. Leavitt, M. Metzler, et al., Recruitment and activation of caspase-8 by the Huntingtininteracting protein Hip-1 and a novel partner Hippi, Nat. Cell Biol. 4 (2002) 95– 105. [12] A. Alcivar, S. Hu, J. Tang, X. Yang, DEDD and DEDD2 associate with caspase-8/10 and signal cell death, Oncogene 22 (2003) 291–297. [13] H. Radner, I. Blumcke, G. Reifenberger, O.D. Wiestler, The new WHO classification of tumors of the nervous system 2000. Pathology and genetics, Pathologe 23 (2002) 260–283. [14] J. Chen, Y. Li, T.S. Yu, R.M. McKay, D.K. Burns, S.G. Kernie, et al., A restricted cell population propagates glioblastoma growth after chemotherapy, Nature 488 (2012) 522–526. [15] S.Y. Sun, Understanding the role of the death receptor 5/FADD/caspase-8 death signaling in cancer metastasis, Mol. Cell. Pharmacol. 3 (2011) 31–34. [16] W. Hou, J. Han, C. Lu, L.A. Goldstein, H. Rabinowich, Autophagic degradation of active caspase-8: a crosstalk mechanism between autophagy and apoptosis, Autophagy 6 (2010) 891–900. [17] L. Tourneur, S. Mistou, V. Vilmont, AB0284 Local and systemic (ESPOIR cohort) human soluble fadd is a new inflammatory marker in rheumatoid arthritis, Ann. Rheum. Dis. 71 (2013) 653–654.
7
[18] L. Tourneur, S. Mistou, F.M. Michiels, V. Devauchelle, L. Renia, J. Feunteun, et al., Loss of FADD protein expression results in a biased Fas-signaling pathway and correlates with the development of tumoral status in thyroid follicular cells, Oncogene 22 (2003) 2795–2804. [19] M. Gomez-Angelats, J.A. Cidlowski, Molecular evidence for the nuclear localization of FADD, Cell Death Differ. 10 (2003) 791–797. [20] M.C. Tse, A.C. Bellail, J.H. Song, DR5-mediated DISC controls caspase-8 cleavage and initiation of apoptosis in human glioblastomas, J. Cell. Mol. Med. 14 (2010) 1303–1317. [21] M. Kumazaki, H. Shinohara, K. Taniguchi, H. Ueda, M. Nishi, A. Ryo, et al., Understanding of tolerance in TRAIL-induced apoptosis and cancelation of its machinery by alpha-mangostin, a xanthone derivative, Oncotarget 6 (2015) 25828–25842. [22] P. Gurung, P.K. Anand, R.K. Malireddi, L. Vande Walle, N. Van Opdenbosch, C.P. Dillon, et al., FADD and caspase-8 mediate priming and activation of the canonical and noncanonical Nlrp3 inflammasomes, J. Immunol. 192 (2014) 1835–1846. [23] P.E. Carrington, C. Sandu, Y. Wei, J.M. Hill, G. Morisawa, T. Huang, et al., The structure of FADD and its mode of interaction with procaspase-8, Mol. Cell 22 (2006) 599–610. [24] R.G. Verhaak, K.A. Hoadley, E. Purdom, V. Wang, Y. Qi, M.D. Wilkerson, et al., Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1, Cancer Cell 17 (2010) 98–110. [25] X. Yang, C.J. Thiele, Targeting the tumor necrosis factor-related apoptosisinducing ligand path in neuroblastoma, Cancer Lett. 197 (2003) 137–143. [26] D. Westphal, R.M. Kluck, G. Dewson, Building blocks of the apoptotic pore: how Bax and Bak are activated and oligomerize during apoptosis, Cell Death Differ. 21 (2014) 196–205. [27] J.M. Hardwick, L. Soane, Multiple functions of BCL-2 family proteins, Cold Spring Harbor Perspect. Biol. 5 (2013).