Overexpression of fucosyltransferase IV in A431 cell line increases cell proliferation

The International Journal of Biochemistry & Cell Biology 39 (2007) 1722–1730

Overexpression of fucosyltransferase IV in A431 cell line increases cell proliferation Xuesong Yang a , Zhenbo Zhang a , Shuang Jia a , Yuejian Liu a , Xiaoqi Wang b , Qiu Yan a,∗ a

b

Department of Biochemistry and Molecular Biology, Dalian Medical University, Liaoning Provincial Core Lab of Glycobiology and Glycoengineering, Dalian 116027, PR China Departments of Pediatrics and Dermatology, Northwestern University’s School of Medicine, Chicago, IL 60611, USA Received 7 February 2007; received in revised form 23 April 2007; accepted 23 April 2007 Available online 3 May 2007

Abstract Fucosyltransferase IV is an essential enzyme that catalyzes the synthesis of fucosylated oligosaccharides by transferring GDPfucose to the terminal N-acetylglucosamine with the ␣1,3-linkage. Lewis Y oligosaccharide has a terminal ␣1,3-linked fucose residue and elevation of Lewis Y level is seen in many epithelial cancers. The mechanism of Lewis Y elevation in neoplastic cells is still largely unknown. To study the impact of fucosyltransferase IV on Lewis Y expression and its role on neoplastic cell proliferation, a pEGFP-N1-FUT4 recombinant plasmid was developed and stably transfected into A431 cells. We found that fucosyltransferase IV overexpression promoted cell proliferation and increased the expression of proliferating cell nuclear antigen that correlated with Lewis Y augmentation. Cell cycle analysis demonstrated that fucosyltransferase IV overexpression facilitated cell cycle progression. In conclusion, fucosyltransferase IV overexpression augments Lewis Y expression to trigger neoplastic cell proliferation. These studies suggest that fucosyltransferase IV may serve as a potential therapeutic target for the treatment of Lewis Y-positive epithelial cancers. © 2007 Elsevier Ltd. All rights reserved. Keywords: Fucosyltransferase IV; Lewis antigen; Gene transfection; Proliferation; Cell cycle

1. Introduction The members of fucosyltransferase (FUT) gene family participate in the transferring of L-fucose from GDP-fucose to their acceptors in ␣1,2-, ␣1,3/4and ␣1,6-linkages. Six human ␣1,3-fucosyltransferases genes have been identified, including FUT3, 4, 5, 6, 7 and 9 genes (Christophe, Fabrice, Abderrahman, Raymond, & Jean-Michel, 2003; Daniel & John, 2003; Taniguchi,

∗ Corresponding author. Tel.: +86 411 84722083; fax: +86 411 84722083. E-mail address: [email protected] (Q. Yan).

1357-2725/$ – see front matter © 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.biocel.2007.04.024

Honke, & Fukuda, 2002). FUT4 is mainly expressed in leukocyte and some epithelial cells (Allahverdian, Wojcik, & Dorscheid, 2006). Increases in the expression of FUT4 level are seen in different cancers, e.g., gastric carcinoma (Petretti, Schulze, Schlag, & Kemmner, 1999), colorectal cancer (Kudo et al., 1998; Saito et al., 1997), pancreatic cancer (Taniguchi, Suga, & Matsumoto, 2000) and lung adnocarcinoma (MartinSatue, Marrugat, Cancelas, & Blanco, 1998). Lewis Y (LeY) is a difucosylated oligosaccharide with the chemical structure [Fuc␣1 → 2Gal␤1 → 4(Fuc␣1 → 3)GlcNAc␤1 → R] that belongs to A, B, H and Lewis blood group family. H type 2 antigen (Fuc␣1 → 2Gal␤1 → 4GlcNAc␤ → R) is a precursor of

X. Yang et al. / The International Journal of Biochemistry & Cell Biology 39 (2007) 1722–1730

LeY oligosaccharide (Dettke, Palfi, & Loibner, 2000; Yi, Anette, Uwe, & Reinhard, 2001). The ␣1,3 fucosylation of LeY is catalyzed by FUT4 (Ajit et al., 1999; Aubert et al., 2000; Escrevente et al., 2006; Taniguchi et al., 2002; Wang, Ge, Kong, Xin, & Zhu, 2001). Therefore, FUT4 is a critical enzyme that controls LeY oligosaccharide synthesis (Akiyoshi, Ryohei, & Kojiro, 2000; Cao, Merling, Karsten, & Schwartz-Albiez, 2001; Mollicone, Gibaud, Francois, Ratcliffe, & Oriol, 1990; Yago et al., 1999). LeY antigen carried by the glycoproteins and glycolipids on cell surface is predominately expressed during embryogenesis and limits to granulocytes and epithelial lining in adults. However, highly expressed LeY is found in the majority (70–90%) of human cancers of epithelial origin, e.g., breast (Madjd et al., 2005), ovarian (Takehara et al., 2002), hepatocarcinoma (Liu, Qi, & Chen, 2001), colon and gastrointestinal cancers (Baldus et al., 2006). LeY is able to facilitate neoplastic cell proliferation, invasion and metastasis. LeY expression is also related to clinical degree and progression (Arai & Nishida, 2003; Madjd et al., 2005). LeY has been recognized as a tumor-associated antigen in a variety of cancers particularly in breast and colorectal cancers (Baldus et al., 2006; Capelle, Brugger, & Arvinte, 2005; Farhan et al., 2006; Klinger et al., 2004; Madjd et al., 2005; Westwood et al., 2005). LeY antibodies showed effective inhibition on neoplastic cell proliferation (Clarke et al., 2000; Kristeleit, 2005; Lee et al., 2005; Szolar et al., 2006). The members of ␣1,3-fucosyltransferase family have been reported to positively regulate tumor growth, e.g., FUT7 stimulated the growth of hepatocarcinoma cells (Wang, Guo, Duan, Shen, & Chen, 2005); stable transfection of FUT3 gene increased tumor growth in prostate cancer cells (PC-3) (Inaba et al., 2003); antisense sequences of FUT3/6 inhibited the proliferation of colon carcinoma (Hiller et al., 2000). The role of FUT4 on tumor growth has not been fully studied. In this report, we investigated the impact of FUT4 (EC.2.4.1.152) on cell proliferation by stable overexpression of FUT4 using A431 cells. We found that FUT4 overexpression promoted A431 cell growth through augmentation the synthesis of LeY. These findings suggest that FUT4 may serve as a potential target for LeY-positive epithelial cancer therapy. 2. Materials and methods 2.1. Materials A431 cell line was obtained from American Type Culture Collection (Manassas, VA). Takara RNA PCR Kit

1723

(AMV) Ver 3.0 was from Takara. Trizol, DMEM/F12 (1:1), fetal bovine serum (FBS), LipofectamineTM Reagent and PlusTM Reagent were purchased from Invitrogen. G418, 3-(4, 5-dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide (MTT) and soft-agar were purchased from Sigma. Enhanced chemiluminescence (ECL) assay kit was purchased from Amersham. Goat anti human FUT4 antibody, PE-conjugated mouse anti-goat IgG, PE-conjugated rat anti-mouse IgM, avidin-biotin peroxidase complex kit and horseradish peroxidase (HRP)-conjugated anti-goat secondary antibody were purchased from Santa Cruz. HRP-conjugated mouse secondary antibody was purchased from New England Biolabs. Mouse anti-human proliferating cell nuclear antigen (PCNA) antibody was from Transduction Laboratories. Mouse anti-LeY antibody (BG-8) was purchased from Signet laboratories. 2.2. Cell culture A431 cells were cultured in DMEM/F12 (1:1) supplemented with 10% FBS, 100 U/ml penicillin and 50 ␮g/␮l streptomycin at 37 ◦ C under 5% CO2 in humidified air. 2.3. Construction of plasmid and generation of stably transfected cell lines Total RNA was isolated from healthy human uterine tissue specimens by Trizol reagent and the full-length cDNA of FUT4 (GenBank accession number: M58596) was amplified with Takara RNA PCR Kit. The primers were 5 -CCGCTCGAGATGGGGGCACCGTGGGGCTCGC-3 (forward) and 5 -CCGGAATTCAGTAGAGGATCAAAAAGCTGACAAC-3 (reverse), which provided with the XhoI and EcoRI restriction site (underlined), respectively. PCR products were sequenced and then cloned into pEGFP-N1 vector through XhoI and EcoRI restriction sites to obtain recombinant pEGFP-N1-FUT4 plasmid. Transfection of A431 cells with pEGFP-N1FUT4 and pEGFP-N1 plasmids was performed using LipofectamineTM Reagent and PlusTM Reagent according to the manufacturer’s instruction. After transfection, cells were incubated with 0.8 mg/ml of G418 for 3 weeks, and cells of the stable transfectants of FUT4 were collected. Two FUT4 overexpression A431 cell colonies (A431-FUT4-1 and A431-FUT4-2) and vectortransfected mock control clone (A431-vector) were screened and further identified by RT-PCR. Stable transfected A431 cells were maintained in the media with 0.2 mg/ml of G418.

1724

X. Yang et al. / The International Journal of Biochemistry & Cell Biology 39 (2007) 1722–1730

2.4. Semi-quantitative RT-PCR of FUT4 gene Total RNA was extracted from the transfected and control cells using Trizol reagent. The cDNA was synthesized using Takara RNA PCR Kit. The primers of FUT4 were 5 -CGGACGTCTTTGTGCCTTAT-3 (forward) and 5 -CGAGGAAAAGCAGGTACGAG3 (reverse). The PCR product is 456 bp. The primers of ␤-actin (an internal control) were 5 ATCTGGCACCACACCTTCTACAATGAGCTGCG3 (forward) and 5 -CGTCATACTCCTGCCTGCTGATCCACATCTGC-3 (reverse). The PCR product is 838 bp. PCR reactions were carried as follows: initial denaturation at 94 ◦ C for 4 min, 28 cycles of 94 ◦ C for 50 s, 55–57 ◦ C for 50 s, 72 ◦ C for 50 s and a final extension for 10 min at 72 ◦ C in a 50 ␮l reaction mixture containing 2 ␮l each cDNA, 0.2 ␮M each primer, 0.2 mM dNTP and 2 units of TaqDNA polymerase. After amplification, 5 ␮l of each reaction mixture was detected by 1% agarose gel electrophoresis, and the bands were then visualized by ethidium bromide staining, followed by analysis with Labworks 4.6. 2.5. Analysis of cell proliferation Cells (1 × 104 cells/well) were plated in 24-well plates. MTT assay was used to detect cell proliferation for consecutive 7 days. In brief, MTT was added to the culture medium to yield a final MTT concentration of 0.5 mg/ml and the incubation was continued for 4 h at 37 ◦ C. The cell lysates were dissolved with dimethyl sulfoxide (DMSO) at room temperature for 10 min. Results were obtained by measuring the absorbance at a wavelength of 490 nm. The test was repeated for three times. 2.6. Soft-agar colony forming assay Bottom agarose (0.7%) in DMEM/F12 (1:1) was cast on six-well plates. Cells (1 × 103 cells/well) were mixed in 0.3% agarose in DMEM/F12 (1:1) containing 10% FBS at 37 ◦ C and plated over the bottom agarose. The inoculated plates were incubated for 7 days and stained with Giemsa. The number of colonies was determined using BioImaging systems (UVP, LabworksTM, Ver 4.6) (Bennett, Mauer, & Strehler, 2007; Hosoi et al., 2006). 2.7. Western blot To prepare whole cell extracts, cells at 90% confluency were washed in phosphate-buffered saline (PBS) before incubation with lysis buffer (1% Triton X-100, 150 mM NaCl, 10 mM Tris, pH 7.4, 1 mM EDTA,

1 mM EGTA, pH 8.0, 0.2 mM Na3 VO4 , 0.2 mM phenylmethylsulfonyl fluoride, 0.5% Nonidet P-40) on ice for 10 min. The cell lysates were clarified by centrifugation at 9000 × g for 10 min, and the supernatants were collected. Protein concentration was determined with the Coomassie Protein Assay Reagent (Bio-Rad) using bovine serum albumin (BSA) as a standard. Cell lysate (50 ␮g) was separated by 10% SDS-PAGE min-gel. Samples were transferred electrophoretically (Bio-Rad) to nitrocellulose membranes, blocked with TTBS (50 mM Tris–HCl, pH 7.5, 0.15 M NaCl, 0.1% Tween-20) containing 5% fat-free dry milk for 2 h and incubated for 3 h with goat anti-human PCNA antibody (1:500) in TTBS. After incubation with a HRP-conjugated anti-goat secondary antibody (1:1000), immunoreactive proteins were visualized with ECL detection system. 2.8. Flow cytometric assay Cells were trypsinized gently, and the single cell suspension was centrifuged. After washing in PBS, the pellets were permeablized by 0.1% Triton-PBS for 10 min at 37 ◦ C and then mixed with goat anti-human FUT4 antibody (1:50). For analysis of LeY expression, the permeablizition process was omitted. The cells were mixed with mouse anti-LeY antibody (1:50) directly. Cells were centrifuged after incubation for 1 h at 4 ◦ C, then washed with PBS, and resuspended in PEconjugated mouse anti-goat IgG (1:200) for FUT4 and PE-conjugated rat anti-mouse IgM (1:200) for LeY for 45 min at room temperature. The mixture was detected with a FACScan flow cytometer. 2.9. Immunohistochemical staining and immuofluorenscence Cells were trypsinized and seeded on the cover slips and fixed in 4% paraformaldehyde for 15 min, then added 0.1% Triton-PBS for 10 min. After blocking with goat serum for 1 h at 37 ◦ C, the goat anti-human FUT4 antibody (1:100) and mouse anti-LeY antibody (1:100) were applied to detect FUT4 and LeY, respectively. LeY immunostaining was performed by avidin-biotin peroxidase complex kit and then photographed. FUT4 immunofluorenscence was photographed after 1 h incubation with PE-conjugated anti-goat IgG (1:500). 2.10. ELISA Protein samples (10 ␮g) were coated on the surface of each well of 96-well plates. After incubation at 37 ◦ C

X. Yang et al. / The International Journal of Biochemistry & Cell Biology 39 (2007) 1722–1730

for 1 h, uncoated protein in each well was removed and washed with 0.1% Tween-PBS and subsequently incubated with 5% BSA at 37 ◦ C for 1 h. Next, each well was incubated with goat anti-human PCNA antibody (1:1000) at 37 ◦ C for 1 h. After washing away the un-bound antibody, each well was incubated with a HRP-conjugated anti-goat secondary antibody (1:2000) at 37 ◦ C for 1 h. The color reaction was done with O-phenylenediamine (OPD) in the presence of 0.5% H2 O2 at room temperature for 15 min. After termination of the reaction by adding 2N H2 SO4 , results were obtained using Universal Microplate Spectrophotometer (Bio-Tek) at a wavelength of 490 nm.

1725

removed by gentle washing with PBS. Cells were trypsinized, collected and washed twice with PBS. Cell pellets were resuspended in 0.5 ml of PBS and fixed in 4.5 ml of 70% ethanol overnight. Cells were collected by centrifugation and the pellets were resuspended in 0.2 mg/ml of propidium iodide (PI) containing 0.1% Triton X-100 and 0.1 mg/ml RNase A. The cell suspension was incubated in the dark for 30 min at room temperature and subsequently analyzed on FACScan flow cytometer for DNA content. The percentage of cells in different phases of the cell cycle was sorted using a ModFit 5.2 computer program. 2.12. Statistics

2.11. Analysis of cell cycle Cells were cultured in six-well plates and allowed to grow to 75–80% confluency. Nonadherent cells were

Results are expressed as the mean ± the standard error of the mean (S.E.M.) of at least three independent experiments. Statistical significance of difference between test

Fig. 1. Generation of stable FUT4 overexpressing cells. Full length of FUT4 cDNA in the coding region was cloned and ligated into pEGFR-N1 vector as described in Section 2. After stable tansfection of the pEGFR-N1-FUT plasmid into A431 cells, FUT4 expression was confirmed with different techniques. (A) Expression of FUT4 gene in stable transfectants. FUT4 gene expression was analyzed using RT–PCR as described. The PCR products were resolved by 1% agarose gel electrophoresis and stained with ethidium bromide. Beta-actin was used as an internal control. M: DNA marker DL 2000. Lane 1: A431-vector cells; Lane 2: A431-FUT4-1; Lane 3: A431-FUT4-2. Relative density analysis of FUT4 gene expression: the intensity ratio of FUT4 to ␤-actin was showed in the bottom panel. * p < 0.01. (B) Flow cytometry analysis of the expression of FUT4. A431-vector cells, A431-FUT4-1 and A431-FUT4-2 cells were incubated with FUT4 antibidy followed by incubation with PF-conjugated anti-goat IgG. as described in Section 2. Results were obtained using FACScan flow cytometer. (C) Immunofluorescence analysis of the expression of FUT4. The expression of FUT4 protein level was also examined by immunofluoresence staining as described in Section 2. (a) A431-vector cells; (b) A431-FUT4-1; (c) A431-FUT4-2.

1726

X. Yang et al. / The International Journal of Biochemistry & Cell Biology 39 (2007) 1722–1730

groups was assessed by one-way ANOVA followed by Scheffe’s test (post hoc). Statistical significance was defined at p < 0.05.

intensity in A431-FUT4-1 and A431-FUT4-2 cells was much stronger than that in A431-vector cells. 3.2. FUT4 overexpression augments LeY synthesis

3. Results 3.1. Stable transfection of FUT4 cDNAs increased the expression of FUT4 at both gene and protein level After transfecting of A431 cells with pEGFP-N1FUT4 and pEGFP-N1 plasmids, two stable FUT4 overexpression cell colonies (A431-FUT4-1, A431FUT4-2) and one vector transfected mock control cell clone (A431-vector) were screened and selected. A semi-quantitative RT-PCR was adopted to analyze the expression of FUT4 mRNA. Results showed the expression of FUT4 gene increased about four-fold in A431-FUT4-1 and A431-FUT4-2 cells in comparison with that of A431-vector mock control cells (Fig. 1A, p < 0.01). The expression of FUT4 protein was also increased as detected by flow cytometry (Fig. 1B) and immunofluorescence analysis (Fig. 1C). Immunofluorescence analysis illustrated that FUT4 was mainly located in the cytoplasm (Fig. 1C). The fluorescence

Fig. 2. LeY expression in cells with overexpressed FUT4. (A) Immumohistochemical staining for LeY. The cells were incubated with anti-LeY antibody followed by being incubated with biotinylated antimouse IgM and HRP-conjugated streptavidin. Results were obtained using DAB as a substrate. (a) A431-vector cells; (b) A431-FUT4-1; (c) A431-FUT4-2. (B) Flow cytometry anslysis of the expression of LeY. The cells were incubated with LeY antibody followed by adding PE-conjugated anti-mouse IgM.

Immunohistochemical staining (Fig. 2A) revealed that the staining intensity in A431-FUT4-1 and A431-FUT4-2 cells was much stronger than that in A431-vector cells. The expression of LeY was mainly located on the cell surface. Flow cytometry presented a parallel tendency as immunohistochemical staining analysis (Fig. 2B). These results suggested that FUT4 overexpression prompted the synthesis of LeY. 3.3. FUT4 overexpression promotes cell proliferation FUT4 overexpression significantly increased cell proliferation after 3 days in culture as examined by MTT assay (Fig. 3, p < 0.05). The proliferation rate in A431-FUT4-1 clone is 64.51%, and 74.07% in A431FUT4-2 clone when compared to A431-vector cells on day 7 (Fig. 3, p < 0.01). Soft-agar colony forming test showed that A431-FUT4-1 and A431-FUT4-2 cells produced more colonies (131.7 ± 8.5 and 161.4 ± 12.1, respectively) in comparison with A431-vector cells (51.3 ± 3.4) (Fig. 4, p < 0.01). Data were generated from three independent experiments. To further assess the impact of FUT4 overexpression on cell proliferation, PCNA expression was detected by Western blot (Fig. 5A)

Fig. 3. Proliferation of FUT4 overexpressing cells. The cells were seeded in 24-well plate and allowed to grow for 1–7 days. Cell proliferation was determined by MTT as described in Section 2.

X. Yang et al. / The International Journal of Biochemistry & Cell Biology 39 (2007) 1722–1730

1727

Fig. 4. FUT4 overexpression stimulated the colony formation. The impact of FUT4 overexpression on cell growth was also examined by Soft-agar colony forming test. (A) The colony formation in Soft-agar. Soft-agar colony forming test was performed as described in Section 2. The formation of cell colonies was visualized using BioImaging system (B) The number of colonies formed in each group was calculated from three individual experiments.* p < 0.01.

and ELISA (Fig. 5B). Increases in PCNA expression were seen in both A431-FUT4-1 and A431-FUT4-2 clones (Fig. 5, p < 0.05). These results implicated that FUT4 overexpression induced cell proliferation.

ther emphasized the important role of FUT4 expression on cell proliferation.

3.4. FUT4 overexpression triggers cell cycle progression

The carbohydrate moieties of cell surface glycoconjugates play an important role in neoplastic cell proliferation, invasiveness and metastasis. Alteration of glycoconjugate components is seen in different cancer cells and is known to correlate with the carcinogenesis (Jiang et al., 2006). Cell surface LeY oligosaccharide augumentation is associated with the malignancy development in many epithelial derived cancers, e.g., the extent of LeY expression was associated with the clinical degree and the progression of endometrial uterine cancer (Arai & Nishida, 2003). Madj et al. reported that high expression of LeY antigen was associated with decreased survival in lymph node negative breast carcinomas (Madjd et al., 2005). Therefore, it is important to elucidate the mechanism of LeY antigen synthesis

The impact of FUT4 overexpression on cell proliferation was further determined by cell cycle progression analysis. Flow cytometry with PI-stained cells showed that A431-vector control cells were presented in G0/G1 (49.16 ± 2.76%), S (34.81 ± 1.58%) and G2/M (16.03 ± 0.57%) phases. While in A431FUT4-1 and A431-FUT4-2 cells, S phase fraction was increased (49.37 ± 1.63% for A431-FUT4-1 cells and 49.72 ± 1.53% for A431-FUT-2 cells, respectively, p < 0.01) and G0/G1 fraction was decreased (36.23 ± 2.12% for A431-FUT4-1 and 34.09 ± 1.38% for A431-FUT4-2, p < 0.01) (Fig. 6). These results fur-

4. Discussion

Fig. 5. PCNA expression in the FUT4 overexpression cells. (A) Western blotting to detect PCNA expression. Total protein from the whole cell lysate of A431-vector, A431-FUT4-1 and A431-FUT4-2 cells were subjected to Western blot analysis using PCNA antibody as described in Section 2. (B) ELISA to examine PCNA expression. The expression of PCNA was also determined by ELISA using anti-PCNA antibody and OPD substrate as described in Section 2. * p < 0.05.

1728

X. Yang et al. / The International Journal of Biochemistry & Cell Biology 39 (2007) 1722–1730

Fig. 6. Cell cycle analysis. A431-vector, A431-FUT4-1 and A431FUT4-2 cells were stained for DNA by PI, and stained cells were analyzed by a FACScan flow cytometer using a ModFit 5.2 computer program as described in Section 2.

for effectively developing a therapeutic approach to target LeY in cancer treatment. Up to date, the impact of FUT4 overexpression on LeY antigen elevation remains unclear. In this report, we developed two stable FUT4 overexpressed cell colonies (A431-FUT4-1 and A431FUT4-2) (Fig. 1). We found that FUT4 overexpression encouraged LeY expression in both A431-FUT4-1 and A431-FUT4-2 cells in comparison to that of A431-vector mock control cells (Fig. 2). The abnormal expression of FUT4 has been reported in different cancers. The mechanism related to role of FUT4 on cell growth is not being completely understood. Escrevente et al. have found that highly expressing LeY and LeX in ovarian cell lines (GG and m130 cells) correlated with FUT4 elevation and the progression of ovarian cancer (Escrevente et al., 2006). We have evaluated the role of FUT4 overexpression on cell proliferation using human epidermoid carcinoma A431 cells. Our results showed that overexpression of FUT4 significantly increased cell growth. Based on cell cycle analysis, overexpressing FUT4 enhanced the DNA synthesis and promoted the accumulation of cells in S phase. These data suggested that FUT4 played a critical role in cell growth. Genetic manipulating fucosyltransferases would provide a useful way to study the impact of glycoantigens that carrying the fucosyltransferase corresponding oligosaccharides on cancer growth and carcinogenesis. The overexpression of FUT4 by FUT4 gene transfection augumented LeY synthesis and increased cell growth was further demonstrated by our recent studies using FUT4 siRNA technique. We found knocking down FUT4 expression with its specific siRNAs inhibited the synthesis of LeY and prevented tumor growth in both in vivo and in vitro experimental models (unpublished data). The mechanism by which LeY regulating carcinogenesis is still unknown. We have previously showed that LeY was stage-specifically expressed during embryo development. Injection of anti-LeY antibody to the uterus of pregnant mouse or preincubation of the embryo with anti-LeY antibody impaired the implantation of embryo to the uterus and decreased the secretion and expression of matrix metalloproteinase MMP (Ge, Kong, Wang, & Zhu, 2002; Wang et al., 1998). Margaret et al. reported that treatment of endothelial cells (ECs) with TNF-␣ or thrombin rapidly up-regulated LeY expression and LeY was maintained at higher level in the angiogenesis-riched rheumatoid arthritis compared to the nonangiogenic osteoarthritis (Halloran et al., 2000). A431 cells not only express high level of LeY (>106 LeY/cell) but also enriched in EGFR (>107 EGFR/cell) (Lee et al., 2005). EGFR expression promotes cancer mitogenesis, metastasis, angiogenesis and inhibits

X. Yang et al. / The International Journal of Biochemistry & Cell Biology 39 (2007) 1722–1730

apoptosis (Arteaga, 2002; Mendelsohn, 2002). Studies have found that anti-LeY antibody (IGN311) blocked EGF-stimulated phosphorylation of mitogen-activated protein kinase (MAPK) through inhibiting EGFR signaling in A431 cells and prevented cell proliferation (Farhan et al., 2006; Klinger et al., 2004). Further studies showed eradicating EGFR activity by treatment of cells with AG1478 (an inhibitor for EGFR tyrosine kinase) enhanced the efficacy of radioimmunotherapy with anti-LeY antibody. These results indicate that antiLeY antibody abolished neoplastic cell proliferation through inhibiting EGFR activation. It revealed that LeY oligosaccharide was an important molecule to modulate cell proliferation. Based on these studies, we conclude that FUT4 up-regulates LeY synthesis and the elevated LeY triggers EGFR activation by which to promote cell growth. In summary, increased expression of FUT4 plays an important role in promoting cell cycle progression and cell proliferation through elevating LeY synthesis in A431 cell line. Inhibition of FUT4 expression may provide a new therapeutic approach for LeY positive epithelial cancers. Acknowledgments This work was supported by the National Natural Science Foundation of China (No.: 30270329, No.: 30670465, No.: 30672753) and Liaoning Provincial Core Lab of Glycobiology and Glycoengineering grant. We also thank the expert technical assistance of Dr. Ping Sun. References Ajit, V., Richard, C., Jeffrey, E., Hudson, F., Gerald, H., Jamey, M., et al. (1999). Essential of glycobiology. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press. Akiyoshi, T., Ryohei, S., & Kojiro, M. (2000). Expression and transcriptional regulation of the human a1,3-fucosyltransferase 4 (FUT4) gene in myeloid and colon adenocarcinoma cell lines. Biochemical and Biophysical Research Communications, 273, 370–376. Allahverdian, S., Wojcik, K. R., & Dorscheid, D. R. (2006). Airway epithelial wound repair: Role of carbohydrate sialyl Lewis x. American Journal of Physiology-Lung Cellular and Molecular Physiology, 291, 828–836. Arai, Y., & Nishida, M. (2003). Differential diagnosis between normal endometrium and endometrial hyperplasia with immunostaining cytology using anti-LeY monoclonal antibody. International Journal of Gynecological Cancer, 13, 42–46. Arteaga, C. L. (2002). Overview of epidermal growth factor receptor biology and its role as a therapeutic target in human neoplasia. Seminars in Oncology, 29, 3–9.

1729

Aubert, M., Panicot, L., Crotte, C., Gibier, P., Lombardo, D., Sadoulet, M. O., et al. (2000). Restoration of alpha(1,2) fucosyltransferase activity decreases adhesive and metastatic properties of human pancreatic cancer cells. Cancer Research, 60, 1449– 1456. Baldus, S. E., Monig, S. P., Zirbes, T. K., Thakran, J., Kothe, D., Koppel, M., et al. (2006). Lewis(Y) antigen (CD174) and apoptosis in gastric and colorectal carcinomas: Correlations with clinical and prognostic parameters. Histology and Histopathology, 21, 503–510. Bennett, R. D., Mauer, A. S., & Strehler, E. E. (2007). Calmodulin-like protein increases filopodia-dependent cell motility via upregulation of myosin-10. The Journal of Biological Chemistry, 282, 3205–3212. Cao, Y., Merling, A., Karsten, U., & Schwartz-Albiez, R. (2001). The fucosylated histo-blood group antigens H type 2 (blood group O, CD173) and Lewis Y (CD174) are expressed on CD34+ hematopoietic progenitors but absent on mature lymphocytes. Glycobiology, 11, 677–683. Capelle, M. A., Brugger, P., & Arvinte, T. (2005). Spectroscopic characterization of antibodies adsorbed to aluminium adjuvants: Correlation with antibody vaccine immunogenicity. Vaccine, 23, 1686–1694. Christophe, J., Fabrice, D., Abderrahman, M., Raymond, J., & JeanMichel, P. (2003). The fucosyltransferase gene family: An amazing summary of the underlying mechanisms of gene evolution. Genetica, 118, 157–170. Clarke, K., Lee, F. T., Brechbiel, M. W., Smyth, F. E., Old, L. J., & Scott, A. M. (2000). In vivo biodistribution of a humanized antiLewis Y monoclonal antibody (hu3S193) in MCF-7 xenografted BALB/c nude mice. Cancer Research, 60, 4804–4811. Daniel, J. B., & John, B. L. (2003). Fucose: Biosynthesis and biological function in mammals. Glycobiology, 13, 41–53. Dettke, M., Palfi, G., & Loibner, H. (2000). Activation-dependent expression of the blood group-related Lewis Y antigen on peripheral blood granulocytes. The Journal of Leukocyte Biology, 68, 511–514. Escrevente, C., Machado, E., Brito, C., Reis, C. A., Stoech, A., Runz, S., et al. (2006). Different expression levels of alpha3/4 fucosyltransferases and Lewis determinants in ovarian carcinoma tissues and cell lines. Int J Oncol, 29, 557–566. Farhan, H., Schuster, C., Klinger, M., Weisz, E., Waxenecker, G., Schuster, M., et al. (2006). Inhibition of xenograft tumor growth and downregulation of ErbB receptors by an antibody directed against Lewis-Y antigen. The Journal of Pharmacology and Experimental Therapeutics, 319, 1459–1466. Ge, C. H., Kong, Y., Wang, H., & Zhu, Z. M. (2002). Effects of blastocyst surface oligosaccharide LeY on secretion and expression of matrix metalloproteinase in vivo. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao (Shanghai), 34, 45–49. Halloran, M. M., Carley, W. W., Polverini, P. J., Haskell, C. J., Phan, S., Anderson, B. J., et al. (2000). Ley/H: An endothelial-selective, cytokine-inducible, angiogenic mediator. Journal of Immunology, 164, 4868–4877. Hiller, K. M., Mayben, J. P., Bendt, K. M., Manousos, G. A., Senger, K., Cameron, H. S., et al. (2000). Transfection of alpha (1,3) fucosyltransferase antisense sequences impairs the proliferative and tumorigenic ability of human colon carcinoma cells. Molecular Carcinogenesis, 27, 280–288. Hosoi, Y., Kapp, L. N., Murnane, J. P., Matsumoto, Y., Enomoto, A., Ono, T., et al. (2006). Suppression of anchorage-independent growth by expression of the ataxia-telangiectasia group D com-

1730

X. Yang et al. / The International Journal of Biochemistry & Cell Biology 39 (2007) 1722–1730

plementing gene, ATDC. Biochemical and Biophysical Research Communications, 348, 728–734. Inaba, Y., Ohyama, C., Kato, T., Satoh, M., Saito, H., Hagisawa, S., et al. (2003). Gene transfer of alpha1,3-fucosyltransferase increases tumor growth of the PC-3 human prostate cancer cell line through enhanced adhesion to prostatic stromal cells. International Journal of Cancer, 107, 949–957. Jiang, J., Chen, X., Shen, J., Wei, Y., Wu, T., Yang, Y., et al. (2006). Beta1,4-galactosyltransferase V functions as a positive growth regulator in glioma. The Journal of Biological Chemistry, 281, 9482–9489. Klinger, M., Farhan, H., Just, H., Drobny, H., Himmler, G., Loibner, H., et al. (2004). Antibodies directed against Lewis-Y antigen inhibit signaling of Lewis-Y modified ErbB receptors. Cancer Research, 64, 1087–1093. Kristeleit, H. (2005). IGN-311. Igeneon. Current Opinion Investigation Drug, 6, 1272–1279. Kudo, T., Ikehara, Y., Togayachi, A., Morozumi, K., Watanabe, M., Nakamura, M., et al. (1998). Up-regulation of a set of glycosyltransferase genes in human colorectal cancer. Laboratory Investigation, 78, 797–811. Lee, F. T., Mountain, A. J., Kelly, M. P., Hall, C., Rigopoulos, A., Johns, T. G., et al. (2005). Enhanced efficacy of radioimmunotherapy with 90Y-CHX-A”-DTPA-hu3S193 by inhibition of epidermal growth factor receptor (EGFR) signaling with EGFR tyrosine kinase inhibitor AG1478. Clinical Cancer Research, 11, 7080–7086. Liu, F., Qi, H. L., & Chen, H. L. (2001). Regulation of differentiation- and proliferation-inducers on Lewis antigens, alpha-fucosyltransferase and metastatic potential in hepatocarcinoma cells. British Journal of Cancer, 84, 1556–1563. Madjd, Z., Parsons, T., Watson, N. F., Spendlove, I., Ellis, I., & Durrant, L. G. (2005). High expression of Lewis y/b antigens is associated with decreased survival in lymph node negative breast carcinomas. Breast Cancer Research and Treatment, 7, 780–787. Martin-Satue, M., Marrugat, R., Cancelas, J. A., & Blanco, J. (1998). Enhanced expression of ␣1,3-fucosyltransferase genes correlates with E-selectin-mediated adhesion and metastastic potential of human lung adnocarcinoma cells. Cancer Research, 58, 1544–1550. Mendelsohn, J. (2002). Targeting the epidermal growth factor receptor for cancer therapy. The Journal of Clinical Oncology, 20, 1–13. Mollicone, R., Gibaud, A., Francois, A., Ratcliffe, M., & Oriol, R. (1990). Acceptor specificity and tissue distribution of three human alpha-3-fucosyltransferases. European Journal of Biochemistry, 191, 169–176. Petretti, T., Schulze, B., Schlag, P. M., & Kemmner, W. (1999). Altered mRNA expression of glycosyltransferases in human gastric carcinomas. Biochimica et Biophysica Acta, 1428, 209–218.

Saito, H., Hiraiwa, N., Sawada-Kasugai, M., Akamatsu, S., Tachikawa, T., Kasai, Y., et al. (1997). Altered mRNA expression of specific molecular species of fucosyl- and sialyl-transferases in human colorectal cancer tissues. International Journal of Cancer, 71, 556–564. Szolar, O. H., Stranner, S., Zinoecker, I., Mudde, G. C., Himmler, G., Waxenecker, G., et al. (2006). Qualification and application of a surface plasmon resonance-based assay for monitoring potential HAHA responses induced after passive administration of a humanized anti Lewis-Y antibody. The Journal of Pharmaceutical and Biomedical Analysis, 41, 1347–1353. Takehara, K., Kubushiro, K., Kiguchi, K., Ishiwata, I., Tsukazaki, K., Nozawa, S., et al. (2002). Expression of glycolipids bearing Lewis phenotypes in tissues and cultured cells of human gynecological cancers. Japanese Journal of Cancer Research, 93, 1129–1137. Taniguchi, N., Honke, K., & Fukuda, M. (2002). Glycosyltransferases and related genes. Tokyo: Springer-Verlag., pp. 205–266 Taniguchi, A., Suga, R., & Matsumoto, K. (2000). Expression and transcriptional regulation of the human alpha1,3-fucosyltransferase 4 (FUT4) gene in myeloid and colon adenocarcinoma cell lines. Biochemical and Biophysical Research Communications, 273, 370–376. Wang, H., Ge, C. H., Kong, Y., Xin, Y., & Zhu, Z. M. (2001). Ovary hormonal control of Le(Y) oligosaccharide expression during periimplantation of mouse endometrium. Sheng Wu Hua Xue Yu Sheng Wu Wu Li Xue Bao, 33, 542–546. Wang, Q. Y., Guo, P., Duan, L. L., Shen, Z. H., & Chen, H. L. (2005). alpha-1,3-Fucosyltransferase-VII stimulates the growth of hepatocarcinoma cells via the cyclin-dependent kinase inhibitor p27Kip1. Cellular and Molecular life sciences, 62, 171–178. Wang, X. Q., Zhu, Z. M., Fenderson, B. A., Zeng, G. Q., Cao, Y. J., & Jiang, G. (1998). Effects of monoclonal antibody directed to LeY on implantation in the mouse. Molecular Human Reproduction, 4, 295–300. Westwood, J. A., Smyth, M. J., Teng, M. W., Moeller, M., Trapani, J. A., Scott, A. M., et al. (2005). Adoptive transfer of T cells modified with a humanized chimeric receptor gene inhibits growth of LewisY-expressing tumors in mice. Proceedings of the National Academy of Sciences of the United States of America, 102, 19051–19056. Yago, K., Zenita, K., Ginya, H., Sawada, M., Ohmori, K., Okuma, M., et al. (1999). Expression of alpha-(1,3)-fucosyltransferases which synthesize sialyl Le(X) and sialyl Le(A), the carbohydrate ligands for E- and P-selectins, in human malignant cell lines. Cancer Research, 15, 5559–5565. Yi, C., Anette, M., Uwe, K., & Reinhard, S. A. (2001). The fucosylated histo-blood group antigens H type 2 (blood group O, CD173) and Lewis Y (CD174) are expressed on CD34+ hematopoietic progenitors but absent on mature lymphocytes. Glycobiology, 11, 8677–8683.