- Email: [email protected]
-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture
Biochemical and Biophysical Research Communications xxx (2016) 1e7
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture Maliheh Davari a, Zahra-Soheila Soheili a, *, Shahram Samiei b, Zohreh Sharifi b, Ehsan Ranaei Pirmardan c a b c
National Institute of Genetic Engineering and Biotechnology, Tehran, Iran Blood Transfusion Research Center High Institute for Research and Education in Transfusion Medicine, Tehran, Iran Department of Molecular Genetic, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 November 2016 Accepted 9 December 2016 Available online xxx
miR-183 cluster, composed of miR-183/-96/-182 genes, is highly expressed in the adult retina, particularly in photoreceptors. It involves in development, maturation and normal function of neuroretina. Ectopic overexpression of miR-183/-96/-182 genes was performed to assess reprogramming of hRPE cells. They were amplified from genomic DNA and cloned independently or in tandem configuration into pAAV.MCS vector. hRPE cells were then transfected with the recombinant constructs. Real-Time PCR was performed to measure the expression levels of miR-183/-96/-182 and that of several retina-specific neuronal genes such as OTX2, NRL, PDC and DCT. The transfected cells also were immunocytochemically examined for retina-specific neuronal markers, including Rhodopsin, red opsin, CRX, Thy1, CD73, recoverin and PKCa, to determine the cellular fate of the transfected hRPE cells. Data showed that upon miR-183/-96/-182 overexpression in hRPE cultures, the expression of neuronal genes including OTX2, NRL, PDC and DCT was also upregulated. Moreover, miR-183 cluster-treated hRPE cells were immunoreactive for neuronal markers such as Rhodopsin, red opsin, CRX and Thy1. Both transcriptional and translational upregulation of neuronal genes in miR-183 cluster-treated hRPE cells suggests that in vitro overexpression of miR-183 cluster could trigger reprogramming of hRPE cells to retinal neuron fate. © 2016 Elsevier Inc. All rights reserved.
Keywords: microRNAs miR-183 cluster hRPE cells Retinal neurons
1. Introduction microRNAs (miRNAs) are a class of endogenous non-coding RNAs (~22 nucleotides in length) conserved in eukaryotic organisms from amoeba to humans. Since their discovery in 1993, miRNAs have been known as small regulatory molecules that repress the expression of their target genes through binding to complementary sequences in 30 -UTR of target mRNAs and either inhibiting translation or causing cleavage of them. In brief, miRNAs are transcribed by RNA polymerase II as primary transcripts (pri-miRNAs) that processed by the RNase III enzyme Drosha to form a stem-loop structure (~60e70 nt) known as pre-miRNA. Pre-miRNAs are then transported into the cytoplasm where they are chopped by Dicer, RNase III endonuclease, to form double-stranded mature miRNAs.
* Corresponding author. Ministry of Science, Research and Technology, National Institute of Genetic Engineering and Biotechnology, P.O.Box: 14965/161, Pajoohesh Boulevard, 17th Kilometers, Tehran-Karaj Highway, Tehran, Iran. E-mail addresses: [email protected], [email protected] (Z.-S. Soheili).
One strand of the mature miRNAs is incorporated into the RNAinduced silencing complex (RISC) wherein miRNAs recognize and bind to the targeted mRNAs and as a result inhibit the expression of their targets [1]. miRNAs are widely expressed in different tissues and cell types and involved in many biological processes including signaling [2], development [3], cell death and division [4,5], differentiation and reprogramming [6,7], homeostasis and malignancy [8,9]. However, some miRNAs show a common expression pattern among the different tissues, several miRNAs have been recognized to offer a tissue- or/and cell-specific expression, revealing critical roles of those miRNAs in tissue/cell development and maintenance [10]. Given their crucial roles, not surprisingly, it has been reported that any changes in expression profile of miRNAs might be significantly associated with pathogenesis of numerous diseases in different tissues [11]. For example, growing body of evidence is confessing the participation of miRNAs in cancer emergence and indicating differential miRNA expression pattern between normal and cancerous tissues, suggesting miRNA expression might be
http://dx.doi.org/10.1016/j.bbrc.2016.12.071 0006-291X/© 2016 Elsevier Inc. All rights reserved.
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
2
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
considered as signatures potential for identifying and more understanding of many pathological disorders [12,13]. Further, miRNAs with capability to modulate their own target genes involved in a variety of biological processes may be employed as potential tools in miRNA-based therapeutic approaches to alleviate some pathological conditions caused by miRNA expression disruption [14,15]. High-throughput analysis on miRNA profiling revealed that some miRNAs are specifically expressed in the adult retina [16]. Most miRNAs in retina follow a spatiotemporal expression pattern underlying they show an increasing expression with progression of developmental stages of retina, indicating specialized involvement of these retina-specific miRNAs in many aspects of retinal development, cell-fate determination, survival and diseases [16,17]. It has been shown that dysregulation of several retina-specific miRNAs is correlated with pathogenesis of retinal degenerations such as age-related macular degeneration (AMD) and retinitis pigmentosa (RP) [18]. An important family of miRNAs known as sensory organenriched miRNA cluster is microRNA-183 cluster including miR183, miR-96 and miR-182 which have demonstrated high expression in adult retina and other sensory organs [19]. In developing retina, all members of miR-183 cluster have shown to be upregulated that coincided with advent of late-born retinal neurons including rod photoreceptors and bipolar cells. It suggests that the miR-183 cluster may contribute in development and differentiation of the aforesaid neurons [20]. The members of miR-183 cluster are particularly expressed in photoreceptors and appear to have an effective presence in outer segments of photoreceptors and in their synapses to the bipolar cells [21e23]. Disruption of miR-183/-96/182 expression has been reported in several retinal diseases. In particular, studies demonstrated that downregulation of miR-183/96/-182 may result in photoreceptor death and light-induced retinal degeneration [24]. Therefore, restoring the expression of miR-183 cluster in models of retinal degeneration may have beneficial effects to reduce progression of retinal diseases like RP. With regards to critical functional roles of miR-183 cluster in retina, this study was performed to assess involvement of miR-183 cluster in hRPE cell fate. 2. Materials and methods 2.1. DNA constructs The miR-183, miR-96 and miR-182 precursor sequences and their flanking 300 bp sequences were obtained from NCBI (Gene ID: 406959, 407053 and 406958 for miR-183, -96 and -182, respectively). Genomic DNA was extracted from hRPE cells following the Maniatis standard protocol and then the sequences of miR-183/96/-182 genes along with their flanking sequences were amplified from genomic DNA by PCR using specific primers (Table 1) carrying restriction sites proportional to cloning pattern of miRNAs
(individually or as cluster). The purified PCR product related to each miRNA was digested with relevant restriction enzymes and inserted into pAAV-MCS (a human AAV-2 vector included in AAV HelperFree System designed by ©Agilent Technologies, USA). XL-10 strain of E.coli was transformed by ligation products and clones containing miR-183/-96/-182 individually or in tandem configuration were identified using colony PCR. IRES-EGFP fragment was amplified from a GFP-expressing plasmid (pcDNA-K-G) by PCR using forward 50 -GAACTCGAGCCGCCCCTCTCCCTC-30 and reverse 50 -GCCAGATCTCTTGTACAGCTCGTCCATG-30 primers and cloned into XhoIBglII sites of all four miRNA constructs. The sequence of three miR-183, miR-96, miR-182 and IRES-EGFP fragment in recombinant vectors was verified by sequencing. 2.2. hRPE cell culture and transfection hRPE cells were isolated from neonate human cadaver eyes as described at the previous study [25] and cultured in DMEM/F12 nutrient mixture (Gibco, Canyon, Australia) with 10% fetal bovine serum (FBS; Gibco, Canyon, Australia) and penicillin/streptomycin (64/100 mg/ml) until they were confluent. The day before transfection, hRPE cells were seeded in a 6-well plate until reaching to 70% confluency. On transfection day, hRPE cells were transfected according to calcium phosphate precipitation method. In brief, mixed solutions containing the calculated amounts of miRNA constructs, 2 M CaCl2 and sterile ddH2O were prepared. DNA/CaCl2 mixtures were immediately added drop-wise to an equal volume of 2X HBS (Hepes buffered saline) while vortexing. After incubating for 20 min at RT, DNA/CaCl2/HBS mixtures were spread over cells and incubated for 6 h at 37 C in a humidified CO2 incubator. Six hours later, medium was replaced with fresh DMEM/F12 with 10% FBS. The cells were incubated for an additional 72 h. 2.3. RNA preparation and RT-qPCR Total RNA was isolated from the transfected cells using Tripure isolation reagent (Roche, Germany). Detection of mature miRNAs was performed following stem-loop RT-qPCR procedure described by Kramer, 2011 [26]. The first-strand cDNAs of miR-183, miR-96, and miR-182 was synthesized using specific stem-loop primers and MMLV enzyme (Qiagen, Germany) as follows: 30 min at 16 C, 30 min at 40 C, 5 min at 85 C and final hold at 4 C. Real-time PCR was performed with SYBR Green master mix (Qiagen, Germany) with specific forward primer of each miRNA and a universal primer using Ampligold Taq polymerase (Roche, Germany) as follows: 10 min at 95 C as initial denaturation; 15 s at 95 C and 35 s at 60 C for 40 cycles. To evaluate changes in expression levels of retinaspecific neuronal genes in the transfected RPE cells, RNA samples first were gDNA eliminated using gDNA elimination buffer (Qiagen, Germany) at 42 C for 5 min and then reversely transcribed into cDNAs using RT primer mix (Qiagen, Germany) and reverse
Table 1 List of primers applied to amplification and cloning of miR-183 cluster fragments. Genes
Sequence 50 -30
Restriction sites
Cloning status
Amplicon length (bp)
miR-96
F: CTAGGGATCCACCGAAGGGCCATAAACAGA R: CTAGCTCGAGAGTGTAAGGCGATCTGGCTG F: CTAGTCTAGAACCGAAGGGCCATAAACAGA R: CTAGAAGCTTAGTGTAAGGCGATCTGGCTG F: CTAGGGATCCGTGATGTGGAGGGATGTGGG R: CTAGCTCGAGGTCTCTGGGGACACACTGGA F: CTAGGGATCCGTGATGTGGAGGGATGTGGG R: CTAGTCTAGAGTCTCTGGGGACACACTGGA F: CTAGAAGCTTTAGGGATGGTGTCTGCTC R: CTAGCTCGAGGCCCTGAAACCAAACATCC
BamHI XhoI XbaI HindIII BamHI XhoI BamHI XbaI HindIII XhoI
Single
424
Cluster
424
Single
532
Cluster
532
Single & Cluster
673
miR-183
miR-182
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
transcriptase (Qiagen, Germany) following 20 min incubation at 42 C, 3 min at 95 C and final hold at 4 C. Real-Time PCR was done with neuronal gene-specific primers (purchased from Qiagen) as described above. 2.4. Immunocytochemistry hRPE cells were seeded into 6-well plate at a density of 6 105 cells/well in 2 ml of DMEM/F12 supplemented with 10% FBS. Next day, cells were transfected with pAAV.miR-183 cluster.EGFP and pAAV-EGFP as control vector and after one week, immunocytochemistry (ICC) assay was performed as described below: The cells were washed with 1X TBS and fixed with 4% paraformaldehyde (PFA) for 10 min at RT. After washing with TBS twice, cells were permeabilized by incubating in 0.5% Triton X-100 in TBS for 4 min at RT. Rinsed with TBS, the cells were blocked with 5% BSA (Bovine Serum Albumin)/0.1% TBST (Triton X-100 in 1X TBS) (Sigma, Germany) for one hour at RT. Thereafter, the cells were incubated in primary antibodies (diluted 1:50 in 0.5% BSA (w/v)/ 0.1% TBST (v/v)) at 4 C, overnight. The primary antibodies included rabbit polyclonal anti-Rhodopsin, rabbit polyclonal anti-PKCa, rabbit polyclonal anti-Thy1, rabbit polyclonal anti-CRX, goat polyclonal anti-CD73, goat polyclonal anti-OPN1MW/MW2/LW, goat polyclonal anti-recoverin. Mouse anti-human cytokeratin 8/18 and rabbit polyclonal anti-ZO-I were also applied to verify RPE identity of non-transfected cultures. After washing with TBS for 5 min twice, the cells were incubated in secondary antibodies (diluted 1:100 in 0.5% BSA (w/v)/0.1% TBST (v/v)) in dark for one hour at RT. The secondary antibodies were goat anti-rabbit IgG-R (Rhodamine conjugated antibody), donkey anti-goat IgG-R and goat anti-mouse IgG-FITC conjugated antibody. All antibodies were purchased from Santa Cruz, USA. After washing with TBS twice, the cell nuclei were stained with 250 mg/ml of 40 , 6-diamidino-2-phenylindole, dihydrochloride (DAPI, Santa Cruz, USA) for 3 min in dark at RT. The cells were rinsed with TBS and finally visualized by an Axiophot Zeiss fluorescence microscope equipped with proper filters for DAPI, FITC and Rhodamine. 2.5. Statistical analysis Transfections of the recombinant constructs were performed more than three times (n > 3) in different days. RT-qPCR experiments were performed with three independent duplicated samples and the obtained data were expressed as means ± standard deviation (SD) and P values < 0.05 were regarded as meaningful. 3. Results 3.1. pAAV.miR-183/-96/-182 construction miR-183/-96/-182 genes with flanking sequences were successfully amplified from genomic DNA and cloned independently and in a tandem configuration into pAAV-MCS vector. IRES-EGFP fragment was also inserted at downstream of miR-183/-96/-182 genes in recombinant pAAV-MCS. Schematic linear maps of miR183 family constructs were displayed in Fig. 1. 3.2. Overexpression of miR-183 cluster members in transfected hRPE cells Stem-loop RT-qPCR results demonstrated that miR-96 had 1.5fold overexpression in hRPE cells transfected with pAAV.miR96.EGFP construct, whereas it was overexpressed 158-fold in hRPE cells that had been transfected with pAAV.miR-183 cluster.EGFP. miR-183 gene showed a 6- and 78-fold overexpression in
3
hRPE cells transfected with pAAV.miR-183.EGFP and pAAV.miR-183 cluster.EGFP constructs, respectively. Finally, expression of miR-182 was enhanced 43- and 64-fold in hRPE cells which had been transfected with pAAV.miR-182.EGFP and pAAV.miR-183 cluster.EGFP constructs, respectively (Fig. 2A). Overexpression of all three miR-183/-96/-182 genes in the transfected hRPE cells was calculated in comparison to hRPE cells transfected with pAAV.EGFP as control. 3.3. Expression of retina-specific neuronal genes in transfected hRPE cells The transfected hRPE cells showing overexpression of miR-183/96/-182 genes were considered to evaluate the expression of distinctive retina-specific neuronal genes including OTX2, NRL, PDC, POU4F2, DCT, RCV, CRX, NR2E3 and NGN1. Real-time PCR results showed that none of neuronal genes was upregulated in hRPE cells transfected with individually miRNA-containing constructs. While rise and fall in expression of the aforesaid neuronal genes were observed in hRPE cells that had been transfected with pAAV.miR183 cluster.EGFP construct. As Fig. 2B showed, the expression level of OTX2, NRL, PDC and DCT genes was significantly enhanced 2-, 2-, 7- and 2-fold compared to control. RPE65 as a specific marker for RPE cells also showed 2.5-fold upregulation. Data analysis demonstrated that all detected alternations in expression levels of neural genes, except for CRX, were statistically significant. 3.4. Identity verification of hRPE cells using RPE-specific markers hRPE identity of the using cells was immunocytochemically verified by some RPE-specific markers including ZO-1 and cytokeratin 8/18. ZO-1 (Zonula Occludens-1, as a tight junctionassociated protein) is considered as RPE-specific marker that was detected in a reasonable population of hRPE cultures. Cytokeratin 8/18 as a specific protein for epithelial cells was also clearly expressed in hRPE cultures (Fig. 3). 3.5. Exhibition of some characteristics of retinal neurons in hRPE cells expressing miR-183 cluster hRPE cultures transfected with pAAV.miR-183 cluster.EGFP and pAAV.EGFP constructs were immunocytochemically inspected for the presence of retinal neuron-specific proteins including Rhodopsin, CRX, Red Opsin, CD73, Recoverin, Thy1 and PKCa. Rhodopsin, CRX and Red Opsin proteins were found in a number of transfected cells with pAAV.miR-183 cluster.EGFP (Fig. 4). Those cells positive for photoreceptor-specific proteins also demonstrated some features resembled the morphological features of neurons (Fig. 4A,B,D, arrows). Furthermore, in cultures transfected with pAAV.miR-183 cluster.EGFP, a few cells were immunoreactive to Thy1 (Ganglion cell marker) something that was not found in controls. Other markers such as Recoverin, CD73 and PKC were not detected in treated cultures. 4. Discussion Currently, the importance of miR-183 cluster have been verified in development and normal functions of sensory organs [16]. In developing retina, the expression pattern of miR-183 cluster coincides with differentiation of late-born retinal neurons including rod photoreceptors and bipolar cells. In mature retina, high levels of miR-183 cluster family have been shown to offer a protective role in survival and proper functionality of the retinal neurons, particularly photoreceptors [20], and some kinds of abnormalities in expression of miR-183 cluster have been explored in pathological
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
4
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
Fig. 1. Schematic representation of miR-183 cluster constructs. Schematic linear map was designed to show the position of miR-183/-96/-182 and IRES-EGFP fragments that had been inserted into pAAV-MCS vector. (A) pAAV.miR-96.EGFP (6.4 kb) carrying miR-96 fragment and IRES-EGFP. (B) pAAV.miR-183.EGFP (6.4 kb) containing miR-183 and IRES-EGFP fragments. (C) pAAV.miR-182.EGFP (6.6 kb) carrying miR-182 and IRES-EGFP fragments. (D) pAAV.EGFP (5.9 kb) carrying IRES-EGFP fragment was served as control construct (mock). (E) pAAV.miR-183 cluster.EGFP (7.4 kb) containing all three miR-183, miR-96 and miR-182 fragments in a tandem configuration and IRES-EGFP sequence.
Fig. 2. Relative expression of miR-183 cluster members and retina-specific neuronal genes in transfected hRPE cells. (A) Stem-loop RT-qPCR results showed that miR-96 gene was overexpressed approximately 1.5- and 158-fold in hRPE cells that had been transfected with pAAV.miR-96.EGFP and pAAV.miR-183 cluster.EGFP constructs, respectively. miR183 gene showed 6- and 78-fold overexpression in hRPE cells transfected with pAAV.miR-183.EGFP and pAAV.miR-183 cluster.EGFP constructs, respectively. Expression of miR-182 was enhanced 43- and 64-fold in hRPE cells transfected with pAAV.miR-182.EGFP and pAAV.miR-183 cluster.EGFP constructs, respectively. (B) hRPE cells overexpressing miR-183 cluster were evaluated for possible changes in expression levels of several retina-specific neuronal genes. OTX2, NRL, PDC, DCT and RPE65 genes were significantly upregulated 2-, 2-, 7-, 2- and 2.5-fold compared to control. The expression levels of POU4F2, RCV, NR2E3 and NGN1 genes were significantly changed. Error bars represent means ± SD (n > 3), *, P < 0.05.
conditions such as retinal degenerations and malignancy [24,27]. Regarding to considerable roles of miR-183 cluster in neuroretina, the current study aimed to examine possible signatures of
overexpression of miR-183 cluster on reprogramming of hRPE cells. RPE cells have shown that possess high puissance of transdifferentiation into a variety of retinal cell types in vitro. Therefore
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
5
Fig. 3. Assessment of RPE identity of using cells through immunocytochemistry. ZO-1 (A) and Cytokeratin 8/18 (B) were observed in a considerable population of the using cell cultures, confirming that the investigated cells were certainly RPE. (a and b) cell nuclei were strained with DAPI.
they are considered as worthy candidates in reprogramming studies and cell therapy approaches [28e30]. Evaluation of expression levels of miR-183 cluster in transfected hRPE cultures with miR-183 cluster-containing recombinant constructs revealed that miR-96 and miR-183 showed lower overexpression when applied individually. While in a cluster fashion, the expression levels of all three miRNAs were significantly enhanced, suggesting that miR-183 cluster members acted in concert in a synergistic manner. In other words, miR-183, miR-96 and miR-182 might be able to reinforce their expression when they were transcribed as a polycistronic transcript. This observation is consistent with one study provided by Henri-Jacques Delecluse and colleagues (2011). They found that deletion of miR-BHRF1-3 in miRBHRF1 cluster reduced expression of other members of this cluster, demonstrating that the expression of one miRNA could promote the expression of the others in the same cluster [31]. Measurements of retina-specific neuronal genes showed that none of them exhibited upregulation in hRPE cells that had been transfected by individual miRNAs. While in hRPE cultures that had been treated by the integral miR-183 cluster, significant changes in expression levels of all retina-specific neuronal genes, along with overexpression of some ones were detected. These findings demonstrated that miR-183/-96/-182 genes arrayed in a cluster worked coordinately to influence not only their own expressions but also to impress the expression of target genes in cellular pathways which they oversee. Several studies have proved that miRNAs coordinately regulate their target genes. Guo-Chang Fan and colleagues showed that overexpression of miR-144/451 further augmented cardiomyocyte survival in response to simulated ischemia when compared to expression of individual miR-144 and -451 [32]. Xia Li, et al investigated the complex synergistic networks between miRNAs. They demonstrated that miRNAs regulating those proteins involved in common pathways or certain diseases showed more synergism and that clustered miRNAs jointly regulated the interacting proteins in cellular processes which
indicated high complexity of their functions in cellular context [33]. Significant overexpression of OTX2, NRL, PDC and DCT genes were detected and it might be resulted from probable alternations in expression profile of hRPE cells influenced by ectopic overexpression of miR-183 cluster. DCT (Dopachrome Tautomerase) gene is expressed in developing neurons and regulate progenitor cell proliferation [34]. Phosducin protein (as a photoreceptorspecific protein) encoded by PDC gene is a signaling protein located in the inner segment of rod photoreceptors [35]. Upregulation of DCT and PDC genes might be considered as the impact of miR-183 cluster overexpression. OTX2 is considered as a key regulator in retinal progenitors and acts as a start point for inducing expression of downstream retina-specific neuronal genes necessary for development and differentiation of retinal neurons, particularly photoreceptors. NRL is known as a critical factor that induces rod photoreceptor-specific genes, concomitant with other transcription factors such as CRX and NR2E3, and thereby promotes rod photoreceptor fate [36]. Coordinately enhancement of OTX2, NRL, PDC and DCT genes' expression along with significant alternations of expression levels for NR2E3, RCV and NGN1 genes in miR183 cluster-treated hRPE cells may propose that miR-183 cluster would be able to induce activation of some photoreceptor-specific genes, paving transdifferentiation path of hRPE cells toward photoreceptors and other retinal neurons. Along with retina-specific neuronal genes, RPE65 overexpression was also observed in miR183 cluster-expressing hRPE cultures. This overexpression might be related to OTX2 function in the development and survival of RPE cells in addition to the retinal neurons [36]. Therefore, overexpression of RPE65 gene can be considered as a secondary outcome of OTX2 upregulation in treated cultures. Consistent with Real-Time PCR data, our immunocytochemistry results demonstrated protein expression of photoreceptor-specific markers, including rhodopsin, red opsin and CRX as well as Thy1 (ganglion cell marker), in hRPE cells that had been transfected with pAAV.miR-183 cluster vector when compared to pAAV.EGFP
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
6
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
Fig. 4. hRPE cells that overexpressed miR-183 cluster members were led toward retinal neuron fate. A population of cells in hRPE cultures transfected with pAAV.miR-183 cluster.EGFP were found that (1) were immunoreactive to retina-specific neuronal markers including Rhodopsin, CRX and red opsin (A, B, C), and Thy1 (D) and (2) displayed morphological features resembled neurons (Arrows in A, B and D). Vice versa, cells transfected with pAAV.EGFP vector (controls) not developed signals for neuronal markers (E, F, G, and H). Arrows in C point to red opsin protein that appeared beaded. a, b, c, d, e, f, g and h: the cell nuclei were stained with DAPI. Scale bars are 25 mm.
control. These immunoreactive cells also displayed morphological features similar to neuron cells. These observations may imply the triggering of transdifferentiation in hRPE cells into photoreceptor fate through overexpression of miR-183 cluster. Two other photoreceptor markers CD73 and recoverin, and also PKCa (bipolar cell marker), were not detected in miR-183 cluster-treated hRPE cultures. As cell type-specific proteins exhibit temporal expression patterns in concert with developmental stages of those particular cells [37], it is not expected all specific markers of a certain cell begin to express at the same time. Recoverin is known as a specific marker for full-differentiated photoreceptors [38] and CD73 has been found as a reliable marker for rod photoreceptors [39]. So it appears that their expressions had not yet been induced in miR-183 cluster-treated hRPE cultures. Based on these results, we concluded that overexpression of miR-183 cluster could induce in vitro transdifferentiation of hRPE cells into retinal neuron-like cells. Undoubtedly vast studies are needed to identify the exact mechanisms beyond the functions of miR-183 cluster in development and differentiation of retinaspecific neurons to have functional retinal neurons with the potential for retinal regeneration applications in hand. Funding This research did not receive any specific grant from funding
agencies in the public, commercial, or not-for-profit sectors. Conflict of interest The authors have no conflict of interest in this work. Acknowledgments This work was supported by National Institute of Genetic Engineering and Biotechnology, Iran. We wish to acknowledge staff of Blood Transfusion Research Center, Iran Center particularly Zahra Ataei for contribution in this work. References [1] V.N. Kim, J. Han, M.C. Siomi, Biogenesis of small RNAs in animals, Nat. Rev. Mol. Cell Biol. 10 (2) (2009) 126e139. [2] J.W. Hagen, E.C. Lai, microRNA control of cell-cell signaling during development and disease, Cell cycle (Georget. Tex.) 7 (15) (2008) 2327e2332. [3] B.J. Reinhart, et al., The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans, Nature. 403 (6772) (2000) 901e906. [4] D.A. Greer Card, et al., Oct4/Sox2-Regulated miR-302 targets cyclin D1 in human embryonic stem cells, Mol. Cell. Biol. 28 (20) (2008) 6426e6438. [5] S.D. Hatfield, et al., Stem cell division is regulated by the microRNA pathway, Nature. 435 (7044) (2005) 974e978. [6] A.O. Ribeiro, et al., MicroRNAs: modulators of cell identity, and their applications in tissue engineering, Microrna (Shariqah, United Arab. Emir). 3 (1) (2014) 45e53.
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7 [7] S. Moradi, S. Asgari, H. Baharvand, Concise review: harmonies played by MicroRNAs in cell fate reprogramming, Stem Cells. 32 (1) (2014) 3e15. [8] J. Hayes, P.P. Peruzzi, S. Lawler, MicroRNAs in cancer: biomarkers, functions and therapy, Trends Mol. Med. (2014) 20. [9] K.B. Reddy, MicroRNA (miRNA) in cancer, Cancer Cell Int. 15 (1) (2015) 1e6. [10] D. Sayed, M. Abdellatif, MicroRNAs in development and disease, Physiol. Rev. 91 (3) (2011) 827e887. [11] P.B. Kwak, S. Iwasaki, Y. Tomari, The microRNA pathway and cancer, Cancer Sci. 101 (11) (2010) 2309e2315. [12] S. Sethi, et al., Clinical advances in molecular biomarkers for cancer diagnosis and therapy, Int. J. Mol. Sci. 14 (7) (2013) 14771e14784. [13] J.A. Deiuliis, MicroRNAs as regulators of metabolic disease: pathophysiologic significance and emerging role as biomarkers and therapeutics, Int. J. Obes. (2005) 40 (1) (2016) 88e101. [14] H. Gong, et al., The role of small RNAs in human diseases: potential troublemaker and therapeutic tools, Med. Res. Rev. 25 (3) (2005) 361e381. [15] P. Gandellini, et al., MicroRNAs as new therapeutic targets and tools in cancer, Expert Opin. Ther. Targets. 15 (3) (2011) 265e279. [16] S. Xu, microRNA expression in the eyes and their significance in relation to functions, Prog. Retin. Eye Res. 28 (2) (2009) 87e116. [17] K. Andreeva, N.G.F. Cooper, MicroRNAs in the neural retina, Int. J. Genomics 2014 (2014) 14. [18] C.J. Loscher, et al., Altered retinal microRNA expression profile in a mouse model of retinitis pigmentosa, Genome Biol. 8 (11) (2007) R248. [19] S. Dambal, et al., The microRNA-183 cluster: the family that plays together stays together, Nucleic Acids Res. 43 (15) (2015) 7173e7188. [20] S. Xu, et al., MicroRNA (miRNA) transcriptome of mouse retina and identification of a sensory organ-specific miRNA cluster, J. Biol. Chem. 282 (34) (2007) 25053e25066. [21] Stephen Lumayaga, et al., Inactivation of the microRNA-183/96/182 cluster results in syndromic retinal degeneration, PNAS. 110 (2013) 507e516. [22] V. Busskamp, et al., miRNAs 182 and 183 are necessary to maintain adult cone photoreceptor outer segments and visual function, Neuron. 83 (3) (2014) 586e600. [23] Kathryn B. Moore, Monica L. Vetter, MicroRNA maintenance of cone outer segments, Neuron. 83 (3) (2014) 510e512. [24] Q. Zhu, et al., Sponge Transgenic Mouse Model Reveals Important Roles for the MicroRNA-183 (miR-183)/96/182 Cluster in Postmitotic Photoreceptors of the Retina., vol. 286, ETATS-UNIS: American Society for Biochemistry and Molecular Biology, Bethesda, MD, 2011, 12.
7
[25] M. Davari, et al., Amniotic fluid promotes the appearance of neural retinal progenitors and neurons in human RPE cell cultures, Mol. Vis. 19 (2013) 2330e2342. [26] M.F. Kramer, STEM-LOOP RT-qPCR for miRNAS, in: Frederick M. Ausubel, …, et al. (Eds.), Current Protocols in Molecular Biology, 2011. CHAPTER: p. Unit15.10-Unit15.10. [27] Y. Ma, et al., Dysregulation and Functional Roles of miR-183-96-182 Cluster in Cancer Cell Proliferation, Invasion and Metastasis, 2016, 2016. [28] S. Jeon, I.-H. Oh, Regeneration of the retina: toward stem cell therapy for degenerative retinal diseases, BMB Rep. 48 (4) (2015) 193e199. [29] S. Fuhrmann, C. Zou, E.M. Levine, Retinal pigment epithelium development, plasticity, and tissue homeostasis (Invited review for Experimental Eye Research), Exp. Eye Res. 0 (2014) 141e150. [30] S.J. Saini, S. Temple, H.J. Stern, Human retinal pigment epithelium stem cell (RPESC), in: C. Bowes Rickman, et al. (Eds.), Retinal Degenerative Diseases: Mechanisms and Experimental Therapy, Springer International Publishing, Cham, 2016, pp. 557e562. [31] Regina Feederle, et al., The members of a viral miRNA cluster co-operate to transform B lymphocytes, J. Virol. 85 (19) (2011) 9801e9810. [32] X. Zhang, et al., Synergistic effects of the GATA-4-mediated miR-144/451 cluster in protection against simulated ischemia/reperfusion-induced cardiomyocyte death, J. Mol. Cell. Cardiol. 49 (5) (2010) 841e850. [33] J. Xu, et al., MiRNAemiRNA synergistic network: construction via coregulating functional modules and disease miRNA topological features, Nucleic Acids Res. 39 (3) (2011) 825e836. [34] Z. Jiao, et al., Dopachrome tautomerase (Dct) regulates neural progenitor cell proliferation, Dev. Biol. 296 (2) (2006) 396e408. [35] C.M. Krispel, et al., Phosducin regulates the expression of transducin bg subunits in rod photoreceptors and does not contribute to phototransduction adaptation, J. Gen. Physiol. 130 (3) (2007) 303e312. [36] A.K. Hennig, G.-H. Peng, S. Chen, Regulation of photoreceptor gene expression by Crx-associated transcription factor network, Brain Res. 1192 (2008) 114e133. [37] A. Swaroop, D. Kim, D. Forrest, Transcriptional regulation of photoreceptor development and homeostasis in the mammalian retina, Nat. Rev. Neurosci. 11 (8) (2010) 563e576. [38] W. Baehr, K. Palczewski, Photoreceptors and Calcium, Springer, US, 2012. [39] D. Eberle, et al., Increased integration of transplanted CD73-positive photoreceptor precursors into adult mouse retina, Investig. Ophthalmol. Vis. Sci. 52 (9) (2011) 6462e6471.
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture Maliheh Davari a, Zahra-Soheila Soheili a, *, Shahram Samiei b, Zohreh Sharifi b, Ehsan Ranaei Pirmardan c a b c
National Institute of Genetic Engineering and Biotechnology, Tehran, Iran Blood Transfusion Research Center High Institute for Research and Education in Transfusion Medicine, Tehran, Iran Department of Molecular Genetic, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 November 2016 Accepted 9 December 2016 Available online xxx
miR-183 cluster, composed of miR-183/-96/-182 genes, is highly expressed in the adult retina, particularly in photoreceptors. It involves in development, maturation and normal function of neuroretina. Ectopic overexpression of miR-183/-96/-182 genes was performed to assess reprogramming of hRPE cells. They were amplified from genomic DNA and cloned independently or in tandem configuration into pAAV.MCS vector. hRPE cells were then transfected with the recombinant constructs. Real-Time PCR was performed to measure the expression levels of miR-183/-96/-182 and that of several retina-specific neuronal genes such as OTX2, NRL, PDC and DCT. The transfected cells also were immunocytochemically examined for retina-specific neuronal markers, including Rhodopsin, red opsin, CRX, Thy1, CD73, recoverin and PKCa, to determine the cellular fate of the transfected hRPE cells. Data showed that upon miR-183/-96/-182 overexpression in hRPE cultures, the expression of neuronal genes including OTX2, NRL, PDC and DCT was also upregulated. Moreover, miR-183 cluster-treated hRPE cells were immunoreactive for neuronal markers such as Rhodopsin, red opsin, CRX and Thy1. Both transcriptional and translational upregulation of neuronal genes in miR-183 cluster-treated hRPE cells suggests that in vitro overexpression of miR-183 cluster could trigger reprogramming of hRPE cells to retinal neuron fate. © 2016 Elsevier Inc. All rights reserved.
Keywords: microRNAs miR-183 cluster hRPE cells Retinal neurons
1. Introduction microRNAs (miRNAs) are a class of endogenous non-coding RNAs (~22 nucleotides in length) conserved in eukaryotic organisms from amoeba to humans. Since their discovery in 1993, miRNAs have been known as small regulatory molecules that repress the expression of their target genes through binding to complementary sequences in 30 -UTR of target mRNAs and either inhibiting translation or causing cleavage of them. In brief, miRNAs are transcribed by RNA polymerase II as primary transcripts (pri-miRNAs) that processed by the RNase III enzyme Drosha to form a stem-loop structure (~60e70 nt) known as pre-miRNA. Pre-miRNAs are then transported into the cytoplasm where they are chopped by Dicer, RNase III endonuclease, to form double-stranded mature miRNAs.
* Corresponding author. Ministry of Science, Research and Technology, National Institute of Genetic Engineering and Biotechnology, P.O.Box: 14965/161, Pajoohesh Boulevard, 17th Kilometers, Tehran-Karaj Highway, Tehran, Iran. E-mail addresses: [email protected], [email protected] (Z.-S. Soheili).
One strand of the mature miRNAs is incorporated into the RNAinduced silencing complex (RISC) wherein miRNAs recognize and bind to the targeted mRNAs and as a result inhibit the expression of their targets [1]. miRNAs are widely expressed in different tissues and cell types and involved in many biological processes including signaling [2], development [3], cell death and division [4,5], differentiation and reprogramming [6,7], homeostasis and malignancy [8,9]. However, some miRNAs show a common expression pattern among the different tissues, several miRNAs have been recognized to offer a tissue- or/and cell-specific expression, revealing critical roles of those miRNAs in tissue/cell development and maintenance [10]. Given their crucial roles, not surprisingly, it has been reported that any changes in expression profile of miRNAs might be significantly associated with pathogenesis of numerous diseases in different tissues [11]. For example, growing body of evidence is confessing the participation of miRNAs in cancer emergence and indicating differential miRNA expression pattern between normal and cancerous tissues, suggesting miRNA expression might be
http://dx.doi.org/10.1016/j.bbrc.2016.12.071 0006-291X/© 2016 Elsevier Inc. All rights reserved.
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
2
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
considered as signatures potential for identifying and more understanding of many pathological disorders [12,13]. Further, miRNAs with capability to modulate their own target genes involved in a variety of biological processes may be employed as potential tools in miRNA-based therapeutic approaches to alleviate some pathological conditions caused by miRNA expression disruption [14,15]. High-throughput analysis on miRNA profiling revealed that some miRNAs are specifically expressed in the adult retina [16]. Most miRNAs in retina follow a spatiotemporal expression pattern underlying they show an increasing expression with progression of developmental stages of retina, indicating specialized involvement of these retina-specific miRNAs in many aspects of retinal development, cell-fate determination, survival and diseases [16,17]. It has been shown that dysregulation of several retina-specific miRNAs is correlated with pathogenesis of retinal degenerations such as age-related macular degeneration (AMD) and retinitis pigmentosa (RP) [18]. An important family of miRNAs known as sensory organenriched miRNA cluster is microRNA-183 cluster including miR183, miR-96 and miR-182 which have demonstrated high expression in adult retina and other sensory organs [19]. In developing retina, all members of miR-183 cluster have shown to be upregulated that coincided with advent of late-born retinal neurons including rod photoreceptors and bipolar cells. It suggests that the miR-183 cluster may contribute in development and differentiation of the aforesaid neurons [20]. The members of miR-183 cluster are particularly expressed in photoreceptors and appear to have an effective presence in outer segments of photoreceptors and in their synapses to the bipolar cells [21e23]. Disruption of miR-183/-96/182 expression has been reported in several retinal diseases. In particular, studies demonstrated that downregulation of miR-183/96/-182 may result in photoreceptor death and light-induced retinal degeneration [24]. Therefore, restoring the expression of miR-183 cluster in models of retinal degeneration may have beneficial effects to reduce progression of retinal diseases like RP. With regards to critical functional roles of miR-183 cluster in retina, this study was performed to assess involvement of miR-183 cluster in hRPE cell fate. 2. Materials and methods 2.1. DNA constructs The miR-183, miR-96 and miR-182 precursor sequences and their flanking 300 bp sequences were obtained from NCBI (Gene ID: 406959, 407053 and 406958 for miR-183, -96 and -182, respectively). Genomic DNA was extracted from hRPE cells following the Maniatis standard protocol and then the sequences of miR-183/96/-182 genes along with their flanking sequences were amplified from genomic DNA by PCR using specific primers (Table 1) carrying restriction sites proportional to cloning pattern of miRNAs
(individually or as cluster). The purified PCR product related to each miRNA was digested with relevant restriction enzymes and inserted into pAAV-MCS (a human AAV-2 vector included in AAV HelperFree System designed by ©Agilent Technologies, USA). XL-10 strain of E.coli was transformed by ligation products and clones containing miR-183/-96/-182 individually or in tandem configuration were identified using colony PCR. IRES-EGFP fragment was amplified from a GFP-expressing plasmid (pcDNA-K-G) by PCR using forward 50 -GAACTCGAGCCGCCCCTCTCCCTC-30 and reverse 50 -GCCAGATCTCTTGTACAGCTCGTCCATG-30 primers and cloned into XhoIBglII sites of all four miRNA constructs. The sequence of three miR-183, miR-96, miR-182 and IRES-EGFP fragment in recombinant vectors was verified by sequencing. 2.2. hRPE cell culture and transfection hRPE cells were isolated from neonate human cadaver eyes as described at the previous study [25] and cultured in DMEM/F12 nutrient mixture (Gibco, Canyon, Australia) with 10% fetal bovine serum (FBS; Gibco, Canyon, Australia) and penicillin/streptomycin (64/100 mg/ml) until they were confluent. The day before transfection, hRPE cells were seeded in a 6-well plate until reaching to 70% confluency. On transfection day, hRPE cells were transfected according to calcium phosphate precipitation method. In brief, mixed solutions containing the calculated amounts of miRNA constructs, 2 M CaCl2 and sterile ddH2O were prepared. DNA/CaCl2 mixtures were immediately added drop-wise to an equal volume of 2X HBS (Hepes buffered saline) while vortexing. After incubating for 20 min at RT, DNA/CaCl2/HBS mixtures were spread over cells and incubated for 6 h at 37 C in a humidified CO2 incubator. Six hours later, medium was replaced with fresh DMEM/F12 with 10% FBS. The cells were incubated for an additional 72 h. 2.3. RNA preparation and RT-qPCR Total RNA was isolated from the transfected cells using Tripure isolation reagent (Roche, Germany). Detection of mature miRNAs was performed following stem-loop RT-qPCR procedure described by Kramer, 2011 [26]. The first-strand cDNAs of miR-183, miR-96, and miR-182 was synthesized using specific stem-loop primers and MMLV enzyme (Qiagen, Germany) as follows: 30 min at 16 C, 30 min at 40 C, 5 min at 85 C and final hold at 4 C. Real-time PCR was performed with SYBR Green master mix (Qiagen, Germany) with specific forward primer of each miRNA and a universal primer using Ampligold Taq polymerase (Roche, Germany) as follows: 10 min at 95 C as initial denaturation; 15 s at 95 C and 35 s at 60 C for 40 cycles. To evaluate changes in expression levels of retinaspecific neuronal genes in the transfected RPE cells, RNA samples first were gDNA eliminated using gDNA elimination buffer (Qiagen, Germany) at 42 C for 5 min and then reversely transcribed into cDNAs using RT primer mix (Qiagen, Germany) and reverse
Table 1 List of primers applied to amplification and cloning of miR-183 cluster fragments. Genes
Sequence 50 -30
Restriction sites
Cloning status
Amplicon length (bp)
miR-96
F: CTAGGGATCCACCGAAGGGCCATAAACAGA R: CTAGCTCGAGAGTGTAAGGCGATCTGGCTG F: CTAGTCTAGAACCGAAGGGCCATAAACAGA R: CTAGAAGCTTAGTGTAAGGCGATCTGGCTG F: CTAGGGATCCGTGATGTGGAGGGATGTGGG R: CTAGCTCGAGGTCTCTGGGGACACACTGGA F: CTAGGGATCCGTGATGTGGAGGGATGTGGG R: CTAGTCTAGAGTCTCTGGGGACACACTGGA F: CTAGAAGCTTTAGGGATGGTGTCTGCTC R: CTAGCTCGAGGCCCTGAAACCAAACATCC
BamHI XhoI XbaI HindIII BamHI XhoI BamHI XbaI HindIII XhoI
Single
424
Cluster
424
Single
532
Cluster
532
Single & Cluster
673
miR-183
miR-182
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
transcriptase (Qiagen, Germany) following 20 min incubation at 42 C, 3 min at 95 C and final hold at 4 C. Real-Time PCR was done with neuronal gene-specific primers (purchased from Qiagen) as described above. 2.4. Immunocytochemistry hRPE cells were seeded into 6-well plate at a density of 6 105 cells/well in 2 ml of DMEM/F12 supplemented with 10% FBS. Next day, cells were transfected with pAAV.miR-183 cluster.EGFP and pAAV-EGFP as control vector and after one week, immunocytochemistry (ICC) assay was performed as described below: The cells were washed with 1X TBS and fixed with 4% paraformaldehyde (PFA) for 10 min at RT. After washing with TBS twice, cells were permeabilized by incubating in 0.5% Triton X-100 in TBS for 4 min at RT. Rinsed with TBS, the cells were blocked with 5% BSA (Bovine Serum Albumin)/0.1% TBST (Triton X-100 in 1X TBS) (Sigma, Germany) for one hour at RT. Thereafter, the cells were incubated in primary antibodies (diluted 1:50 in 0.5% BSA (w/v)/ 0.1% TBST (v/v)) at 4 C, overnight. The primary antibodies included rabbit polyclonal anti-Rhodopsin, rabbit polyclonal anti-PKCa, rabbit polyclonal anti-Thy1, rabbit polyclonal anti-CRX, goat polyclonal anti-CD73, goat polyclonal anti-OPN1MW/MW2/LW, goat polyclonal anti-recoverin. Mouse anti-human cytokeratin 8/18 and rabbit polyclonal anti-ZO-I were also applied to verify RPE identity of non-transfected cultures. After washing with TBS for 5 min twice, the cells were incubated in secondary antibodies (diluted 1:100 in 0.5% BSA (w/v)/0.1% TBST (v/v)) in dark for one hour at RT. The secondary antibodies were goat anti-rabbit IgG-R (Rhodamine conjugated antibody), donkey anti-goat IgG-R and goat anti-mouse IgG-FITC conjugated antibody. All antibodies were purchased from Santa Cruz, USA. After washing with TBS twice, the cell nuclei were stained with 250 mg/ml of 40 , 6-diamidino-2-phenylindole, dihydrochloride (DAPI, Santa Cruz, USA) for 3 min in dark at RT. The cells were rinsed with TBS and finally visualized by an Axiophot Zeiss fluorescence microscope equipped with proper filters for DAPI, FITC and Rhodamine. 2.5. Statistical analysis Transfections of the recombinant constructs were performed more than three times (n > 3) in different days. RT-qPCR experiments were performed with three independent duplicated samples and the obtained data were expressed as means ± standard deviation (SD) and P values < 0.05 were regarded as meaningful. 3. Results 3.1. pAAV.miR-183/-96/-182 construction miR-183/-96/-182 genes with flanking sequences were successfully amplified from genomic DNA and cloned independently and in a tandem configuration into pAAV-MCS vector. IRES-EGFP fragment was also inserted at downstream of miR-183/-96/-182 genes in recombinant pAAV-MCS. Schematic linear maps of miR183 family constructs were displayed in Fig. 1. 3.2. Overexpression of miR-183 cluster members in transfected hRPE cells Stem-loop RT-qPCR results demonstrated that miR-96 had 1.5fold overexpression in hRPE cells transfected with pAAV.miR96.EGFP construct, whereas it was overexpressed 158-fold in hRPE cells that had been transfected with pAAV.miR-183 cluster.EGFP. miR-183 gene showed a 6- and 78-fold overexpression in
3
hRPE cells transfected with pAAV.miR-183.EGFP and pAAV.miR-183 cluster.EGFP constructs, respectively. Finally, expression of miR-182 was enhanced 43- and 64-fold in hRPE cells which had been transfected with pAAV.miR-182.EGFP and pAAV.miR-183 cluster.EGFP constructs, respectively (Fig. 2A). Overexpression of all three miR-183/-96/-182 genes in the transfected hRPE cells was calculated in comparison to hRPE cells transfected with pAAV.EGFP as control. 3.3. Expression of retina-specific neuronal genes in transfected hRPE cells The transfected hRPE cells showing overexpression of miR-183/96/-182 genes were considered to evaluate the expression of distinctive retina-specific neuronal genes including OTX2, NRL, PDC, POU4F2, DCT, RCV, CRX, NR2E3 and NGN1. Real-time PCR results showed that none of neuronal genes was upregulated in hRPE cells transfected with individually miRNA-containing constructs. While rise and fall in expression of the aforesaid neuronal genes were observed in hRPE cells that had been transfected with pAAV.miR183 cluster.EGFP construct. As Fig. 2B showed, the expression level of OTX2, NRL, PDC and DCT genes was significantly enhanced 2-, 2-, 7- and 2-fold compared to control. RPE65 as a specific marker for RPE cells also showed 2.5-fold upregulation. Data analysis demonstrated that all detected alternations in expression levels of neural genes, except for CRX, were statistically significant. 3.4. Identity verification of hRPE cells using RPE-specific markers hRPE identity of the using cells was immunocytochemically verified by some RPE-specific markers including ZO-1 and cytokeratin 8/18. ZO-1 (Zonula Occludens-1, as a tight junctionassociated protein) is considered as RPE-specific marker that was detected in a reasonable population of hRPE cultures. Cytokeratin 8/18 as a specific protein for epithelial cells was also clearly expressed in hRPE cultures (Fig. 3). 3.5. Exhibition of some characteristics of retinal neurons in hRPE cells expressing miR-183 cluster hRPE cultures transfected with pAAV.miR-183 cluster.EGFP and pAAV.EGFP constructs were immunocytochemically inspected for the presence of retinal neuron-specific proteins including Rhodopsin, CRX, Red Opsin, CD73, Recoverin, Thy1 and PKCa. Rhodopsin, CRX and Red Opsin proteins were found in a number of transfected cells with pAAV.miR-183 cluster.EGFP (Fig. 4). Those cells positive for photoreceptor-specific proteins also demonstrated some features resembled the morphological features of neurons (Fig. 4A,B,D, arrows). Furthermore, in cultures transfected with pAAV.miR-183 cluster.EGFP, a few cells were immunoreactive to Thy1 (Ganglion cell marker) something that was not found in controls. Other markers such as Recoverin, CD73 and PKC were not detected in treated cultures. 4. Discussion Currently, the importance of miR-183 cluster have been verified in development and normal functions of sensory organs [16]. In developing retina, the expression pattern of miR-183 cluster coincides with differentiation of late-born retinal neurons including rod photoreceptors and bipolar cells. In mature retina, high levels of miR-183 cluster family have been shown to offer a protective role in survival and proper functionality of the retinal neurons, particularly photoreceptors [20], and some kinds of abnormalities in expression of miR-183 cluster have been explored in pathological
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
4
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
Fig. 1. Schematic representation of miR-183 cluster constructs. Schematic linear map was designed to show the position of miR-183/-96/-182 and IRES-EGFP fragments that had been inserted into pAAV-MCS vector. (A) pAAV.miR-96.EGFP (6.4 kb) carrying miR-96 fragment and IRES-EGFP. (B) pAAV.miR-183.EGFP (6.4 kb) containing miR-183 and IRES-EGFP fragments. (C) pAAV.miR-182.EGFP (6.6 kb) carrying miR-182 and IRES-EGFP fragments. (D) pAAV.EGFP (5.9 kb) carrying IRES-EGFP fragment was served as control construct (mock). (E) pAAV.miR-183 cluster.EGFP (7.4 kb) containing all three miR-183, miR-96 and miR-182 fragments in a tandem configuration and IRES-EGFP sequence.
Fig. 2. Relative expression of miR-183 cluster members and retina-specific neuronal genes in transfected hRPE cells. (A) Stem-loop RT-qPCR results showed that miR-96 gene was overexpressed approximately 1.5- and 158-fold in hRPE cells that had been transfected with pAAV.miR-96.EGFP and pAAV.miR-183 cluster.EGFP constructs, respectively. miR183 gene showed 6- and 78-fold overexpression in hRPE cells transfected with pAAV.miR-183.EGFP and pAAV.miR-183 cluster.EGFP constructs, respectively. Expression of miR-182 was enhanced 43- and 64-fold in hRPE cells transfected with pAAV.miR-182.EGFP and pAAV.miR-183 cluster.EGFP constructs, respectively. (B) hRPE cells overexpressing miR-183 cluster were evaluated for possible changes in expression levels of several retina-specific neuronal genes. OTX2, NRL, PDC, DCT and RPE65 genes were significantly upregulated 2-, 2-, 7-, 2- and 2.5-fold compared to control. The expression levels of POU4F2, RCV, NR2E3 and NGN1 genes were significantly changed. Error bars represent means ± SD (n > 3), *, P < 0.05.
conditions such as retinal degenerations and malignancy [24,27]. Regarding to considerable roles of miR-183 cluster in neuroretina, the current study aimed to examine possible signatures of
overexpression of miR-183 cluster on reprogramming of hRPE cells. RPE cells have shown that possess high puissance of transdifferentiation into a variety of retinal cell types in vitro. Therefore
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
5
Fig. 3. Assessment of RPE identity of using cells through immunocytochemistry. ZO-1 (A) and Cytokeratin 8/18 (B) were observed in a considerable population of the using cell cultures, confirming that the investigated cells were certainly RPE. (a and b) cell nuclei were strained with DAPI.
they are considered as worthy candidates in reprogramming studies and cell therapy approaches [28e30]. Evaluation of expression levels of miR-183 cluster in transfected hRPE cultures with miR-183 cluster-containing recombinant constructs revealed that miR-96 and miR-183 showed lower overexpression when applied individually. While in a cluster fashion, the expression levels of all three miRNAs were significantly enhanced, suggesting that miR-183 cluster members acted in concert in a synergistic manner. In other words, miR-183, miR-96 and miR-182 might be able to reinforce their expression when they were transcribed as a polycistronic transcript. This observation is consistent with one study provided by Henri-Jacques Delecluse and colleagues (2011). They found that deletion of miR-BHRF1-3 in miRBHRF1 cluster reduced expression of other members of this cluster, demonstrating that the expression of one miRNA could promote the expression of the others in the same cluster [31]. Measurements of retina-specific neuronal genes showed that none of them exhibited upregulation in hRPE cells that had been transfected by individual miRNAs. While in hRPE cultures that had been treated by the integral miR-183 cluster, significant changes in expression levels of all retina-specific neuronal genes, along with overexpression of some ones were detected. These findings demonstrated that miR-183/-96/-182 genes arrayed in a cluster worked coordinately to influence not only their own expressions but also to impress the expression of target genes in cellular pathways which they oversee. Several studies have proved that miRNAs coordinately regulate their target genes. Guo-Chang Fan and colleagues showed that overexpression of miR-144/451 further augmented cardiomyocyte survival in response to simulated ischemia when compared to expression of individual miR-144 and -451 [32]. Xia Li, et al investigated the complex synergistic networks between miRNAs. They demonstrated that miRNAs regulating those proteins involved in common pathways or certain diseases showed more synergism and that clustered miRNAs jointly regulated the interacting proteins in cellular processes which
indicated high complexity of their functions in cellular context [33]. Significant overexpression of OTX2, NRL, PDC and DCT genes were detected and it might be resulted from probable alternations in expression profile of hRPE cells influenced by ectopic overexpression of miR-183 cluster. DCT (Dopachrome Tautomerase) gene is expressed in developing neurons and regulate progenitor cell proliferation [34]. Phosducin protein (as a photoreceptorspecific protein) encoded by PDC gene is a signaling protein located in the inner segment of rod photoreceptors [35]. Upregulation of DCT and PDC genes might be considered as the impact of miR-183 cluster overexpression. OTX2 is considered as a key regulator in retinal progenitors and acts as a start point for inducing expression of downstream retina-specific neuronal genes necessary for development and differentiation of retinal neurons, particularly photoreceptors. NRL is known as a critical factor that induces rod photoreceptor-specific genes, concomitant with other transcription factors such as CRX and NR2E3, and thereby promotes rod photoreceptor fate [36]. Coordinately enhancement of OTX2, NRL, PDC and DCT genes' expression along with significant alternations of expression levels for NR2E3, RCV and NGN1 genes in miR183 cluster-treated hRPE cells may propose that miR-183 cluster would be able to induce activation of some photoreceptor-specific genes, paving transdifferentiation path of hRPE cells toward photoreceptors and other retinal neurons. Along with retina-specific neuronal genes, RPE65 overexpression was also observed in miR183 cluster-expressing hRPE cultures. This overexpression might be related to OTX2 function in the development and survival of RPE cells in addition to the retinal neurons [36]. Therefore, overexpression of RPE65 gene can be considered as a secondary outcome of OTX2 upregulation in treated cultures. Consistent with Real-Time PCR data, our immunocytochemistry results demonstrated protein expression of photoreceptor-specific markers, including rhodopsin, red opsin and CRX as well as Thy1 (ganglion cell marker), in hRPE cells that had been transfected with pAAV.miR-183 cluster vector when compared to pAAV.EGFP
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
6
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7
Fig. 4. hRPE cells that overexpressed miR-183 cluster members were led toward retinal neuron fate. A population of cells in hRPE cultures transfected with pAAV.miR-183 cluster.EGFP were found that (1) were immunoreactive to retina-specific neuronal markers including Rhodopsin, CRX and red opsin (A, B, C), and Thy1 (D) and (2) displayed morphological features resembled neurons (Arrows in A, B and D). Vice versa, cells transfected with pAAV.EGFP vector (controls) not developed signals for neuronal markers (E, F, G, and H). Arrows in C point to red opsin protein that appeared beaded. a, b, c, d, e, f, g and h: the cell nuclei were stained with DAPI. Scale bars are 25 mm.
control. These immunoreactive cells also displayed morphological features similar to neuron cells. These observations may imply the triggering of transdifferentiation in hRPE cells into photoreceptor fate through overexpression of miR-183 cluster. Two other photoreceptor markers CD73 and recoverin, and also PKCa (bipolar cell marker), were not detected in miR-183 cluster-treated hRPE cultures. As cell type-specific proteins exhibit temporal expression patterns in concert with developmental stages of those particular cells [37], it is not expected all specific markers of a certain cell begin to express at the same time. Recoverin is known as a specific marker for full-differentiated photoreceptors [38] and CD73 has been found as a reliable marker for rod photoreceptors [39]. So it appears that their expressions had not yet been induced in miR-183 cluster-treated hRPE cultures. Based on these results, we concluded that overexpression of miR-183 cluster could induce in vitro transdifferentiation of hRPE cells into retinal neuron-like cells. Undoubtedly vast studies are needed to identify the exact mechanisms beyond the functions of miR-183 cluster in development and differentiation of retinaspecific neurons to have functional retinal neurons with the potential for retinal regeneration applications in hand. Funding This research did not receive any specific grant from funding
agencies in the public, commercial, or not-for-profit sectors. Conflict of interest The authors have no conflict of interest in this work. Acknowledgments This work was supported by National Institute of Genetic Engineering and Biotechnology, Iran. We wish to acknowledge staff of Blood Transfusion Research Center, Iran Center particularly Zahra Ataei for contribution in this work. References [1] V.N. Kim, J. Han, M.C. Siomi, Biogenesis of small RNAs in animals, Nat. Rev. Mol. Cell Biol. 10 (2) (2009) 126e139. [2] J.W. Hagen, E.C. Lai, microRNA control of cell-cell signaling during development and disease, Cell cycle (Georget. Tex.) 7 (15) (2008) 2327e2332. [3] B.J. Reinhart, et al., The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans, Nature. 403 (6772) (2000) 901e906. [4] D.A. Greer Card, et al., Oct4/Sox2-Regulated miR-302 targets cyclin D1 in human embryonic stem cells, Mol. Cell. Biol. 28 (20) (2008) 6426e6438. [5] S.D. Hatfield, et al., Stem cell division is regulated by the microRNA pathway, Nature. 435 (7044) (2005) 974e978. [6] A.O. Ribeiro, et al., MicroRNAs: modulators of cell identity, and their applications in tissue engineering, Microrna (Shariqah, United Arab. Emir). 3 (1) (2014) 45e53.
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071
M. Davari et al. / Biochemical and Biophysical Research Communications xxx (2016) 1e7 [7] S. Moradi, S. Asgari, H. Baharvand, Concise review: harmonies played by MicroRNAs in cell fate reprogramming, Stem Cells. 32 (1) (2014) 3e15. [8] J. Hayes, P.P. Peruzzi, S. Lawler, MicroRNAs in cancer: biomarkers, functions and therapy, Trends Mol. Med. (2014) 20. [9] K.B. Reddy, MicroRNA (miRNA) in cancer, Cancer Cell Int. 15 (1) (2015) 1e6. [10] D. Sayed, M. Abdellatif, MicroRNAs in development and disease, Physiol. Rev. 91 (3) (2011) 827e887. [11] P.B. Kwak, S. Iwasaki, Y. Tomari, The microRNA pathway and cancer, Cancer Sci. 101 (11) (2010) 2309e2315. [12] S. Sethi, et al., Clinical advances in molecular biomarkers for cancer diagnosis and therapy, Int. J. Mol. Sci. 14 (7) (2013) 14771e14784. [13] J.A. Deiuliis, MicroRNAs as regulators of metabolic disease: pathophysiologic significance and emerging role as biomarkers and therapeutics, Int. J. Obes. (2005) 40 (1) (2016) 88e101. [14] H. Gong, et al., The role of small RNAs in human diseases: potential troublemaker and therapeutic tools, Med. Res. Rev. 25 (3) (2005) 361e381. [15] P. Gandellini, et al., MicroRNAs as new therapeutic targets and tools in cancer, Expert Opin. Ther. Targets. 15 (3) (2011) 265e279. [16] S. Xu, microRNA expression in the eyes and their significance in relation to functions, Prog. Retin. Eye Res. 28 (2) (2009) 87e116. [17] K. Andreeva, N.G.F. Cooper, MicroRNAs in the neural retina, Int. J. Genomics 2014 (2014) 14. [18] C.J. Loscher, et al., Altered retinal microRNA expression profile in a mouse model of retinitis pigmentosa, Genome Biol. 8 (11) (2007) R248. [19] S. Dambal, et al., The microRNA-183 cluster: the family that plays together stays together, Nucleic Acids Res. 43 (15) (2015) 7173e7188. [20] S. Xu, et al., MicroRNA (miRNA) transcriptome of mouse retina and identification of a sensory organ-specific miRNA cluster, J. Biol. Chem. 282 (34) (2007) 25053e25066. [21] Stephen Lumayaga, et al., Inactivation of the microRNA-183/96/182 cluster results in syndromic retinal degeneration, PNAS. 110 (2013) 507e516. [22] V. Busskamp, et al., miRNAs 182 and 183 are necessary to maintain adult cone photoreceptor outer segments and visual function, Neuron. 83 (3) (2014) 586e600. [23] Kathryn B. Moore, Monica L. Vetter, MicroRNA maintenance of cone outer segments, Neuron. 83 (3) (2014) 510e512. [24] Q. Zhu, et al., Sponge Transgenic Mouse Model Reveals Important Roles for the MicroRNA-183 (miR-183)/96/182 Cluster in Postmitotic Photoreceptors of the Retina., vol. 286, ETATS-UNIS: American Society for Biochemistry and Molecular Biology, Bethesda, MD, 2011, 12.
7
[25] M. Davari, et al., Amniotic fluid promotes the appearance of neural retinal progenitors and neurons in human RPE cell cultures, Mol. Vis. 19 (2013) 2330e2342. [26] M.F. Kramer, STEM-LOOP RT-qPCR for miRNAS, in: Frederick M. Ausubel, …, et al. (Eds.), Current Protocols in Molecular Biology, 2011. CHAPTER: p. Unit15.10-Unit15.10. [27] Y. Ma, et al., Dysregulation and Functional Roles of miR-183-96-182 Cluster in Cancer Cell Proliferation, Invasion and Metastasis, 2016, 2016. [28] S. Jeon, I.-H. Oh, Regeneration of the retina: toward stem cell therapy for degenerative retinal diseases, BMB Rep. 48 (4) (2015) 193e199. [29] S. Fuhrmann, C. Zou, E.M. Levine, Retinal pigment epithelium development, plasticity, and tissue homeostasis (Invited review for Experimental Eye Research), Exp. Eye Res. 0 (2014) 141e150. [30] S.J. Saini, S. Temple, H.J. Stern, Human retinal pigment epithelium stem cell (RPESC), in: C. Bowes Rickman, et al. (Eds.), Retinal Degenerative Diseases: Mechanisms and Experimental Therapy, Springer International Publishing, Cham, 2016, pp. 557e562. [31] Regina Feederle, et al., The members of a viral miRNA cluster co-operate to transform B lymphocytes, J. Virol. 85 (19) (2011) 9801e9810. [32] X. Zhang, et al., Synergistic effects of the GATA-4-mediated miR-144/451 cluster in protection against simulated ischemia/reperfusion-induced cardiomyocyte death, J. Mol. Cell. Cardiol. 49 (5) (2010) 841e850. [33] J. Xu, et al., MiRNAemiRNA synergistic network: construction via coregulating functional modules and disease miRNA topological features, Nucleic Acids Res. 39 (3) (2011) 825e836. [34] Z. Jiao, et al., Dopachrome tautomerase (Dct) regulates neural progenitor cell proliferation, Dev. Biol. 296 (2) (2006) 396e408. [35] C.M. Krispel, et al., Phosducin regulates the expression of transducin bg subunits in rod photoreceptors and does not contribute to phototransduction adaptation, J. Gen. Physiol. 130 (3) (2007) 303e312. [36] A.K. Hennig, G.-H. Peng, S. Chen, Regulation of photoreceptor gene expression by Crx-associated transcription factor network, Brain Res. 1192 (2008) 114e133. [37] A. Swaroop, D. Kim, D. Forrest, Transcriptional regulation of photoreceptor development and homeostasis in the mammalian retina, Nat. Rev. Neurosci. 11 (8) (2010) 563e576. [38] W. Baehr, K. Palczewski, Photoreceptors and Calcium, Springer, US, 2012. [39] D. Eberle, et al., Increased integration of transplanted CD73-positive photoreceptor precursors into adult mouse retina, Investig. Ophthalmol. Vis. Sci. 52 (9) (2011) 6462e6471.
Please cite this article in press as: M. Davari, et al., Overexpression of miR-183/-96/-182 triggers neuronal cell fate in Human Retinal Pigment Epithelial (hRPE) cells in culture, Biochemical and Biophysical Research Communications (2016), http://dx.doi.org/10.1016/j.bbrc.2016.12.071