Overexpression of NAD(P)H:quinone oxidoreductase 1 (NQO1) and genomic gain of the NQO1 locus modulates breast cancer cell sensitivity to quinones

Life Sciences 145 (2016) 57–65

Contents lists available at ScienceDirect

Life Sciences journal homepage: www.elsevier.com/locate/lifescie

Overexpression of NAD(P)H:quinone oxidoreductase 1 (NQO1) and genomic gain of the NQO1 locus modulates breast cancer cell sensitivity to quinones Christophe Glorieux a, Juan Marcelo Sandoval a, Nicolas Dejeans a,1, Geneviève Ameye b, Hélène Antoine Poirel b, Julien Verrax a, Pedro Buc Calderon a,c,⁎ a b c

Université catholique de Louvain, Louvain Drug Research Institute, Toxicology and Cancer Biology Research Group, Brussels, Belgium Centre de Génétique Humaine, Cliniques Universitaires Saint-Luc & de Duve Institute, Université catholique de Louvain, Brussels, Belgium Facultad de Ciencias de la Salud, Universidad Arturo Prat, Iquique, Chile

a r t i c l e

i n f o

Article history: Received 30 July 2015 Received in revised form 4 November 2015 Accepted 7 December 2015 Available online 10 December 2015 Keywords: NQO1 Breast cancer cells Genomic gain Menadione β-Lapachone Redox alterations

a b s t r a c t Aims: Alterations in the expression of antioxidant enzymes are associated with changes in cancer cell sensitivity to chemotherapeutic drugs (menadione and β-lapachone). Mechanisms of acquisition of resistance to prooxidant drugs were investigated using a model of oxidative stress-resistant MCF-7 breast cancer cells (Resox cells). Main methods: FISH experiments were performed in tumor biopsy and breast cancer cells to characterize the pattern of the NQO1 gene. SNP-arrays were conducted to detect chromosomal imbalances. Finally, the importance of NQO1 overexpression in the putative acquisition of either drug resistance or an increased sensitivity to quinones by cancer cells was investigated by immunoblotting and cytotoxicity assays. Key findings: Genomic gain of the chromosomal band 16q22 was detected in Resox cells compared to parental breast cancer MCF-7 cells and normal human mammary epithelial 250MK cells. This genomic gain was associated with amplification of the NQO1 gene in one tumor biopsy as well as in breast cancer cell lines. Using different breast cell models, we found that NQO1 overexpression was a main determinant for a potential chemotherapy resistance or an increased sensitivity to quinone-bearing compounds. Significance: Because NQO1 is frequently modified in tumors at genomic and transcriptomic levels, the impact of NQO1 modulation on breast cancer cell sensitivity places NQO1 as a potential link between cancer redox alterations and resistance to chemotherapy. Thus, the NQO1 gene copy number and NQO1 activity should be considered when quinone-bearing molecules are being utilized as potential drugs against breast tumors. © 2015 Elsevier Inc. All rights reserved.

Chemical compounds β-Lapachone (PubChem CID:3885) Menadione (PubChem CID: 23665888) Dicumarol (PubChem CID: 54676038) 1. Introduction Quinones are widely found in nature serving as scaffold for several antitumor drugs such as mitomycin C, doxorubicin, geldanamycin, βlapachone and several other drugs [1,2]. Most of them, as well as azo

⁎ Corresponding author at: Avenue E. Mounier 73, 1200 Brussels, Belgium. E-mail address: [email protected] (P.B. Calderon). 1 Current address: Université Bordeaux-Segalen, Inserm U1053, Bordeaux, France.

http://dx.doi.org/10.1016/j.lfs.2015.12.017 0024-3205/© 2015 Elsevier Inc. All rights reserved.

dyes and aromatic nitro-compounds, are reduced by the cytosolic enzyme NAD(P)H:quinone oxidoreductase 1 (NQO1), formerly known as DT-diaphorase, that uses NADH and NADPH as cofactors [3,4]. For example, menadione reduction by NQO1 forms a stable hydroquinone that can be conjugated to UDP-glucuronic acid to form glucuronoconjugates, which are easily excreted from the cell [5]. In addition, NQO1-mediated two-electron reduction prevents the futile redox-cycle that occurs when menadione is reduced by one electron via NADPH cytochrome P450 reductase or by reducing agents such as ascorbate [6,7]. Indeed, one-electron quinone reduction leads to the formation of a semiquinone free radical which, in the presence of oxygen, is oxidized back to quinone generating reactive oxygen species (ROS) [8]. Detoxification of metabolic precursors and quinone intermediates or other carcinogens explains the protective effects of NQO1 against mutagenicity and carcinogenicity [9,10]. Also of note, NQO1 may generate unstable hydroquinones, which sometimes produces the opposite effect, i.e., increased ROS generation or formation of DNA adducts [11].

58

C. Glorieux et al. / Life Sciences 145 (2016) 57–65

NQO1 is widely and differentially expressed at high levels in adipocytes, vascular endothelium and epithelial cells, but at low levels in human hepatocytes [12,13]. NQO1 is frequently overexpressed in a variety of tumors, including colon, breast, pancreas and lung cancers [14–16]. This particularity has been exploited therapeutically using bioactive quinones, because their toxic intermediates are activated by NQO1. Indeed, clinical studies have demonstrated a good correlation between NQO1 protein levels in tumors and their sensitivity to mitomycin C and β-lapachone [17,18]. Tumors and normal tissues have different NQO1 expression patterns (protein levels and enzyme activity), partially due to loss of heterozygosity or a gain in the chromosome arm 16q, both of which are frequently observed in breast tumors [19]. In this context, we recently showed that some antioxidant enzymes, including NQO1, were overexpressed in a model of oxidative stress-resistant MCF-7 breast cancer cells (namely Resox cells), compared to the MCF-7 parental cell line [20]. The aim of this work was to investigate the molecular mechanisms that could explain the overexpression of NQO1 and its consequence in these resistant cells. To this end, a comparative study of NQO1 expression was conducted using human mammary tumors. FISH (fluorescence in situ hybridization) experiments were performed in tumor biopsy, tumor and non-tumor mammary cells (250MK, Resox and MCF-7 cells) to characterize the pattern of the NQO1 locus. To detect chromosomal imbalances in the whole genome, SNP (single nucleotide polymorphism) arrays were conducted in both cancer cell types (Resox and MCF-7 cells). Finally, the importance of NQO1 overexpression in the putative acquisition of either drug resistance or an increased sensitivity to quinones by NQO1-null MDA-MB-231 cancer cells was investigated.

the bioethic agreement (2013/15JUL/395) received from our university ethics committee.

2. Materials and methods

NQO1 (DT-diaphorase) activity was determined by measuring cytochrome C reduction in the presence of NADH as previously described [24]. In a 100 mm-culture dish, 2 × 106 cells were seeded in 7 ml of medium. At confluence, cells were washed twice with ice-cold PBS and then suspended in 500 μl of lysis buffer (PBS with 1% Triton X-100) in the presence of protease (Protease Inhibitor Cocktail, Sigma, St Louis, MO, USA) and phosphatase inhibitors (Phosphatase Inhibitor Cocktail, Millipore, Merck KGaA, Darmstadt, Germany). Samples were kept on ice for 5 min and then sonicated on ice at 100 W for 5 s with a Labsonic U sonicator (B Braun Biotech International, Melsungen, Germany). For each condition, 1 ml of a mixture (cytochrome C 77 μM, NADH 200 μM, menadione 10 μM, BSA 0.14%, Tris–HCl 50 mM pH 7.5) was prepared and duplicated (one sample with and one without the NQO1 inhibitor, dicumarol 10 μM). This mixture was incubated for 20 min at 37 °C and then 5 μl of the tested sample was added. The reduction of cytochrome C was immediately assessed with a spectrophotometer at 550 nm for 2 min. A ΔOD/min was obtained and results with dicumarol removed from the results without dicumarol in order to measure specific NQO1 activity. Results are expressed in nmol of cytochrome C reduced per minute per mg of protein. An extinction coefficient for cytochrome C of 21.1 mM/cm was used in the calculations. Protein concentration was determined using a BCA protein kit (Thermo Scientific, Rockford, IL, USA). All reagents were purchased from Sigma (St Louis, MO, USA).

2.1. Chemicals β-Lapachone (3,4-Dihydro-2,2-dimethyl-2H-naphtho[1,2-b]pyran5,6-dione), menadione (2-methyl-1,4-naphthoquinone) and dicumarol (3,3′-methylene-bis[4-hydroxycoumarin]) were purchased from Sigma (St Louis, MO, USA). All other chemicals were of ACS reagent grade. 2.2. Cell lines, cell culture MCF-7 breast cancer cell line was purchased from ATCC (Manassas, USA). The Resox cell line was derived from MCF-7 cells [20], which were rendered resistant by chronic exposure to an H2O2-generating system made by mixing a redox cycler (menadione) with a reducing agent such as ascorbate [7,21]. MDA-MB-231 cells were a kind gift from Pr. Akeila Bellahcène (Metastasis Research Laboratory, Giga Cancer, Liège, Belgium). Cells were maintained in DMEM supplemented with 10% fetal calf serum, in the presence of penicillin (100 U/ml) and streptomycin (100 μg/ml) from Gibco (Grand Island, NY, USA). Human mammary epithelial (HMEC) 250MK cells were kindly provided by Dr. Martha Stampfer (Lawrence Berkeley National Laboratory, Berkeley, USA). They were originally isolated from aspirated milk fluids and express a luminal phenotype [22]. They were maintained in an M87A medium supplemented with cholera toxin and oxytocin [22]. Cells between passages 8 and 10 were used. Cultures were maintained at 5 × 104 cells/cm2 and the medium was changed at 48–72 h intervals. All the cultures were maintained at 37 °C in 95% air/5% CO2 with 100% humidity. 2.3. Tumor samples Ten invasive mammary ductal carcinoma samples and their normal adjacent tissues to tumor were provided by the BioBank of the Institut Roi Albert II of the Cliniques Universitaires Saint-Luc, Brussels, Belgium, project CDCUCLR18-2013. All materials were reviewed by an expert pathologist. All procedures were conducted in accordance with

2.4. Stable transfection pKK233-2 plasmid containing human NQO1 cDNA was kindly provided by Dr. David Ross [11]. The cDNA was amplified by PCR using the following primers: Forward 5′-ccgaagcttgccatggtcggcagaagagc-3′ and Reverse 5′-ccgggtacctcattttctagctttgatct-3′ (Sigma, St Louis, MO, USA), cut by restriction enzymes HindIII and KpnI (Fermentas, Vilnius, Lithuania) and further cloned into pcDNA3.1 plasmid from Invitrogen (Grand Island, NY, USA). MDA-MB-231 cells were transfected with plasmids pcDNA3.1 (empty vector and coding NQO1) and then selected for 4 weeks in the presence of 1 mg/ml neomycin (Invivogen, San Diego, CA, USA). Stable transfecting clones were characterized based on NQO1 enzyme activity and protein levels. 2.5. Immunoblotting The procedures for protein sample preparation, protein quantification, immunoblotting and data analyses were performed as previously described [23]. Mouse antibody against β-actin diluted 1/10000 (ab6276) was from Abcam (Cambridge, UK) and mouse antibody against NQO1 diluted 1/500 (sc-32793) was from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Protein bands obtained were quantified using ImageJ software (http://rsb.info.nih.gov/ij/). NQO1 protein expression was normalized to that of β-actin. 2.6. NQO1 activity

2.7. Real-time PCR Total RNA was extracted with the TriPure reagent from Roche Applied Science Diagnostics (Mannheim, Germany). Reverse transcription was performed using SuperScript II RNase H-reverse transcriptase and random hexamer primers were purchased from Invitrogen (Grand Island, NY, USA). Sybr Green Supermix from Bio-Rad (Hercules, CA, USA) was used for qRT-PCR. Primer sequences are provided in the table below and were designed by Sigma (St Louis, MO, USA). Samples were incubated for 5 min at 95 °C, then for 40 cycles of 10 s at 95 °C and 30 s at 60 °C followed by a melting curve. The fluorescence in the samples was measured after each cycle in a Bio-Rad IQ5 thermocycler.

C. Glorieux et al. / Life Sciences 145 (2016) 57–65

EF1 (Elongation factor 1) was chosen as the reference gene. Results were calculated using the following equation: 2−(Ct NQO1 − Ct EF1) and compared to control cells (MCF-7 cells). Gene

Primer sequences (forward/reverse)

Tm

Efficiency

Product size

Mean CT

NQO1

caaatcctggaaggatggaa aagtgatggcccacagaaag cttcactgctcaggtgat gccgtgtggcaatccaat

59.86 60.11 64.62 62.43

98%

173

~25

99%

96

~22

EF1

2.8. Conventional cytogenetic analysis Metaphase chromosomes were obtained according to standard protocols from the different cell lines [25]. Briefly, cultured cells in exponential growth phase were treated for 4 h with 0.02 μg/ml of Colcemid (Invitrogen). Harvested cells from the flasks after trypsinization were incubated for 30 min at 37 °C in hypotonic 0.055 M KCl and fixed with 3:1 methanol:glacial acetic acid. Chromosome harvesting and metaphase slide preparation were performed according to standard procedures [25–27]. Twenty Reverse Trypsin Wright (RTW) banded metaphases were analyzed and karyotypes were reported in accordance with the 2013 International System for Human Cytogenetic Nomenclature (ISCN 2013). 2.9. Fluorescence in situ hybridization (FISH) Specific BAC RP11-779G13 (NQO1/16q22.1) and RP11-1029C14 (control/16p13.3) probes from the UCSC (genome.ucsc.edu) databases

59

were obtained from the BACPAC Resources Center at the Children's Hospital Oakland Research Institute (Oakland, CA, USA). DNA extractions, labeling and hybridizations were performed as previously reported [26–28]. The FISH assay was carried out on nuclei and metaphases from fixed pellets of cell lines and on 5 μm thick formalin-fixed paraffinembedded (FFPE) tissue sections of 10 breast tumors in accordance with the manufacturer's instructions. Briefly, the tissue sections were deparaffinized (1 h at 60 °C followed by toluene immersion) and dehydrated. The sections were then treated with a pretreatment reagent followed by pepsin digestion (DAKO, Heverlee, Belgium). All hybridized metaphases were captured on a Zeiss Axioplan 2 microscope (Zeiss, Zaventem, Belgium) and analyzed using the Isis software (Metasystems, Altlussheim, Germany). 2.10. Single nucleotide polymorphism (SNP) arrays DNA samples from cell lines were analyzed using the GeneChip Human Mapping 250K NspI (Affymetrix Inc., Santa Clara, CA, USA) in accordance with the manufacturer's instructions as previously described [29]. Data acquisition was performed using the Genotyping Console version 4.1 (Affymetrix). 2.11. Cell survival assays The potential to inhibit cell proliferation (clonogenicity assay) was evaluated using the method of Franken et al. [30]. Cells (500) were treated for 2 h with menadione and β-lapachone. They were then washed twice with warm PBS and fresh medium was added. After 10–12 days, cells were stained with crystal violet and colony

Fig. 1. NQO1 protein levels and NQO1 gene copy number were measured in breast tumors. (A) NQO1 protein levels were analyzed in 10 mammary tumors using immunoblotting and compared to normal neighboring tissues. (B) NQO1 protein levels were quantified and normalized to β-actin in normal and tumor tissues. (C) Amplification of NQO1 gene copies in one breast tumor (#346) was analyzed using FISH. The probes RP11-779G13 (16q22.1) were labeled with Cy-3 (NQO1: Red spots) and RP11-1029C24 (16p13.3) were labeled with FITC (Control: green spots). A typical result from one of three independent experiments is shown (original magnification ×1000). Data are means ± SEM from three separate experiments, *p-value b 0.05, **p-value b 0.01, ***p-value b 0.001 compared to values obtained in the normal tissues neighboring the tumor.

60

C. Glorieux et al. / Life Sciences 145 (2016) 57–65

Table 1 Clinical data and basal status of NQO1 protein levels. ID biobank

No. of sample

Grade of tumor

Age at biopsy

Drug treatment after biopsy

Survival outcome

NQO1 fold-increase

11-343 12-195

343 195

II II

71 67

Alive Alive

3.5 9.5

11-346 10-254 11-120 11-293 10-103 12-140 11-142 10-380

346 254 120 293 103 140 142 380

II III III III II II III III

80 68 51 84 49 89 43 81

Chemotherapy, radiotherapy, hormone therapy Radiotherapy, hormone therapy. Liver metastasis in 2014: partial hepatectomy and chemotherapy in January 2015 Hormone therapy Chemotherapy, radiotherapy, hormone therapy Chemotherapy, herceptin, radiotherapy, hormone therapy Hormone therapy Hormone therapy Radiotherapy and hormone therapy Chemotherapy, herceptin, radiotherapy, hormone therapy Radiotherapy, hormone therapy

Deceased 2.1 Unknown (last visit in 2011) 1.8 Alive 1.7 Unknown (last visit in 2013) 1.9 Alive 0.95 Deceased 0.7 Unknown (last visit in January 2014) 0.8 Alive 0.6

Samples were prepared as described in the Section 2 and NQO1 expression was detected by immunoblotting. Protein levels were normalized to β-actin. NQO1 increase was calculated by using NQO1 protein levels in tumor and normal tissues.

forming units (CFU) with more than 50 cells were counted. The number of CFU corresponding to control untreated cells was set at 100%, so to calculate the ability of cells to proliferate we used the following formula: Cell proliferation = CFU (treated) / CFU (control) × 100. Cellular viability was assessed using the Trypan blue exclusion assay. Cells (2 × 105 cells in 6-well plates) were treated with the different drugs for 24 h. After trypsin treatment, cells were detached, homogenized and washed with PBS solution. Thereafter, they were suspended in PBS and 10 μl of cell suspension was mixed with 10 μl of trypan blue isotonic solution (0.4%) and cell viability was determined using an automated cell counter (TC10, Bio-Rad, Hercules, CA, USA). Loss of membrane integrity can be measured by using exclusion dyes that cannot enter living healthy cells but that are taken up by dying cells with permeabilized plasma membranes. Although this assay does not discriminate between different forms of cell death, the loss of plasma membrane integrity is considered a point of no return, whereas occurrence of other biochemical events does not necessarily mean that cell death will ensue [31]. Cell metabolic status was assessed by following the reduction of MTT \(3-(4,5-dimethylthia-zolyl-2)-2,5-diphenyltetrazolium bromide) to blue formazan as previously described [32,33]. Briefly, 1 × 104 cells/well were plated onto 96-well plates and, after confluence, were exposed to the respective treatments for 24 h. Cells were then washed twice with PBS and incubated for 2 h with MTT

(0.5 mg/ml). Formazan crystals were solubilized by adding DMSO (100 μl/well) and the colored solutions were read at 550 nm. The measured absorbance for untreated control cells was taken as 100%. 2.12. Data analyses All experiments were performed at least three times. Data were analyzed using an unpaired t-test, using GraphPad Prism software (GraphPad Software, San Diego, CA, USA). The level of significance was set at p b 0.05. 3. Results 3.1. NQO1 protein levels and NQO1 gene copy number in human breast tumors Because of the general consensus that NQO1 is overexpressed in tumor cells, NQO1 protein levels were measured in 10 human mammary cancer biopsies. Indeed, high levels of NQO1 gene expression have been found in liver, lung, colon and breast tumors compared to normal tissues of the same origin [34]. The NQO1 protein level was increased in 6 out of 10 tumor samples compared to levels in tissue surrounding the tumor (Fig. 1A–B). NQO1 expression was enhanced about 2-fold in tumors compared to in normal tissues of the same origin, and a large

Fig. 2. Gain of NQO1 gene copies in mammary cell lines. FISH analyses to check the NQO1 gene copy number in the different cell lines. The probes RP11-779G13 (16q22.1) were labeled with Cy-3 (NQO1: Red spots) and RP11-1029C24 (16p13.3) were labeled with FITC (Control: green spots). Probes were hybridized on metaphases in 250MK, MCF-7 and Resox cells. A typical result from one of three independent experiments is shown (original magnification ×630). (a–c) means that the three chromosomes of the C category are not similar.

C. Glorieux et al. / Life Sciences 145 (2016) 57–65

increase was observed in samples #343 and #195, namely a 3.5-fold and 9.5-fold increase, respectively (Table 1). In the rest of the tumor samples, 3/10 cases showed decreased NQO1 expression (~ 30%) and one tumor (#103) showed no difference in expression compared to normal tissue (Fig. 1A–B, Table 1). Of note, NQO1 expression was not affected either by the grade of the tumor, the age of the patient or any other parameter reported in Table 1. Chromosomal imbalances, such as deletion or amplification of chromosomal band 16q22 (where the NQO1 gene locus is located), have been reported in breast tumors [19,35–40]. We hypothesized whether NQO1 locus genomic gains or amplifications could be associated with the detected NQO1 overexpression. To answer this question, we looked for NQO1 locus copy number in tumor biopsies by performing a FISH assay with a BAC probe encompassing the NQO1 locus associated with a control probe on the short arm of chromosome 16. Only one out of the ten analyzed primary breast tumor tissues (code number #346) was informative for FISH analysis. A genomic amplification of the BAC probe consisting in six to eight additional copies was detected in this tumor sample (Fig. 1C), suggesting that in this case, a genomic amplification of the NQO1 locus could favor the increased NQO1 protein level (Fig. 1A-B).

3.2. NQO1 gene copies and basal levels of NQO1 expression and activity in breast cancer cell lines Given that an increased NQO1 protein level correlated with a genomic amplification the NQO1 locus in the only informative tumor biopsy, we decided to investigate for a potential gene dosage effect in additional breast cancer cell lines. To this end, karyotypes, FISH analyses and SNParrays were performed in the MCF-7 breast cancer cell line and Resox cells, an MCF-7-derived cell line rendered resistant by chronic exposure to oxidative stress [20]. Since Nrf2, the pleiotropic transcription factor that regulates NQO1 gene transcription [41], was equally activated in both cancer cell types (Fig. S1), its putative role was not further explored. The karyotypes of MCF-7 and Resox cells have been previously shown [20]. They were complex with multiple structural and numeric chromosomal aberrations, especially of chromosome 16. They were

61

Table 3 Basal levels of NQO1 expression and activity in breast cancer cell lines. Parameter

MCF-7 cells

Resox cells

Relative fold-increase (Resox/MCF-7)

NQO1 mRNA levela NQO1 protein levelb NQO1 activityc

1.00 ± 0.06 1.00 ± 0.06 933 ± 85

1.50 ± 0.11⁎ 1.39 ± 0.10⁎ 1672 ± 270⁎

1.50 1.39 1.79

a NQO1 mRNA level was measured using qRT-PCR. Data were generated using the Δ ΔCT method comparing NQO1 and Elongation Factor 1 (EF1) as housekeeping gene. b The expression of NQO1 was detected by immunoblotting and its protein levels were normalized to β-actin. c NQO1 activities in cell homogenates were determined using kinetic assays, as described in the Section 2. Results are expressed as nmol of cytochrome C reduced per minute per mg of protein. Data are means ± SEM from three separate experiments. ⁎ p-Value b 0.05 as compared to values obtained in MCF-7 cells.

compared to human mammary epithelial 250MK cells harboring a normal karyotype (Fig. S2). FISH experiments with probes — one covering the NQO1 locus associated with a control probe on the short arm of chromosome 16 — were performed to further characterize the pattern of the NQO1 locus imbalances in the different cell lines (Fig. 2). FISH assays detected extra copies of the NQO1 locus in the MCF-7 cells (four copies) as well as in the Resox cells (four to six copies depending on cell subclones), compared to the two expected copies on two apparently normal chromosomes 16 in 250MK cells (used as a control) (Fig. 2). Correlation with the karyotype of each cell lines [20] allowed the following chromosomal localization of the additional copies. The NQO1 probes hybridized only on two normal chromosomes 16 in 250MK cells (used as a control), but they hybridized on additional chromosomes in MCF-7 and Resox cells. In MCF-7 cells, an NQO1 locus was found at the expected location on the long arm of one apparently normal chromosome 16, on the short arms of chromosome 6 and chromosome 17 and on an uncharacterized chromosome of the C category. In Resox cells, NQO1 gene copies were found on the long

Table 2 Chromosomal gains and losses in Resox cells compared to parental MCF-7 cells following the SNP-array experiment. Type

Chromosome

Gain Gain Gain Gain Gain Gain Gain Gain Gain Gain Gain Gain Gain Loss Loss Loss Loss Loss Loss Loss Loss Loss

1 1 7 9 3 20 16 15 10 14 4 21 12 9 X 2 8 15 13 13 16 1

Start

Stop

Copy number (MCF-7-Resox)

Size (bp)

106739476 196359639 32477866 71517082 41650339 30651570 54189238 42281341 46943377 75416000 176828175 39452670 65600374 100843660 3489155 205411806 21318151 96983509 19062319 48251736 10057591 110552099

152349078 233881123 57238635 94621395 64717522 53396897 74967819 62975041 63134943 91375060 190592195 47792874 68513684 141027939 24676293 218869542 29633694 101821609 22763034 51249260 12932528 111585379

2-3 2-3 3-4 2-3 2-3 1-2 3-4 2-3 2-3 2-3 2-3 2-3 2-3 2-1 2-1 2-1 2-1 2-1 2-1 2-1 2-1 2-1

45.609.602 37.521.484 24.760.769 23.104.313 23.067.183 22.745.327 20.778.581 20.693.700 16.191.566 15.959.060 13.764.020 8.340.204 2.913.310 40.184.279 21.187.138 13.457.736 8.315.543 4.838.100 3.700.715 2.997.524 2.874.937 1.033.280

The table shows the type of modification (gain or loss), the start and stop in the chromosomal sequence, the gene copy number and the size, expressed in bp, of the gain/loss.

Fig. 3. Resox cells sensitivity to menadione and β-lapachone. Resox cells were treated for 24 h with different concentrations of menadione and β-lapachone either in the absence or in the presence of dicumarol (25 μM). Cytotoxicity was analyzed using MTT. Data are means ± SEM from three separate experiments. *p-value b 0.05 compared to values obtained in the absence of dicumarol.

62

C. Glorieux et al. / Life Sciences 145 (2016) 57–65

arm of a normal chromosome 16, on the short arm of a chromosome 6 and on the long arm of an uncharacterized chromosome of the B category (named Bq +). Subclonal additional copies were identified on the short arm of a derivative chromosome 1 and/or on two different uncharacterized chromosomes of the C category. Using high resolution whole-genome SNP-arrays confirmed the detection of a 16q22 gain of 20.8 megabases in Resox cells compared to parental MCF-7 cells (Table 2). Such a genomic gain in Resox cells results was associated with a higher NQO1 expression and enzyme activity. Indeed, they had a 1.5 fold increase in NQO1 mRNA (Table 3) and, in agreement with our previous results [17], their protein levels and NQO1 activity were also enhanced by 1.4- and 1.8-fold, respectively, compared to parental MCF-7 cells. Taken together, these results suggest that the gain of chromosomal band 16q22, including the NQO1 locus, may induce the increase in mRNA and protein NQO1 levels in the breast cancer cells.

calculated: for menadione, 23.3 ± 3.1 and 30.0 ± 2.9 μM in MCF-7 and Resox cells respectively. For β-lapachone, 0.65 ± 0.02 and 0.48 ± 0.01 μM in MCF-7 and Resox cells respectively. In addition, Fig. 3 shows the dose-dependent responses of Resox cells to different concentrations of menadione and β-lapachone in the absence or in the presence of dicumarol, a well-known NQO1 inhibitor [42]. Expectedly, the inhibition of NQO1 by dicumarol markedly increases the sensitivity of these cells to menadione while sensitivity against β-lapachone was slightly decreased. Most likely due to the high amount of NQO1 in Resox cells as compared to MCF-7 parental cells (Table 3), it may be concluded that Resox cells were more resistant to menadione but sensitive to βlapachone.

3.3. Breast cancer cells sensitivity towards quinone-bearing molecules

Since changes in IC50 values for both quinones were in the range of 30–35% between MCF-7 and Resox cells, to best characterize the importance of NQO1 expression on breast cancer cell sensitivity, NQO1 was overexpressed in NQO1-null MDA-MB-231 cells [43]. The high NQO1 protein level (Fig. 4A–B) correlated with a 100-fold higher enzyme activity in NQO1-overexpressing cells than in cells transfected with pcDNA3.1 empty vector (Fig. 4C). These newly generated cell lines were then exposed to menadione and β-lapachone. Using an MTT test (Fig. 4D), a clonogenic survival

Given that quinones are preferred substrates of NQO1 [3,4], its higher expression in Resox cells compared to MCF-7 cells raised the question about an enhanced or a decreased sensitivity to quinonecontaining molecules. To this end, MCF-7 and Resox cells were incubated in the presence of different concentrations of menadione and βlapachone and cytotoxicity was assessed by the MTT reduction assay. From the dose-dependent responses, the following IC50 values were

3.4. Impact of NQO1 overexpression on the sensitivity of breast cancer cells to quinone-based molecules

Fig. 4. Influence of NQO1 expression on cell cytotoxicity by quinone-bearing molecules. MDA-MB-231 cells overexpressing NQO1 were generated as reported under Section 2. (A) NQO1 expression was detected by immunoblotting. (B) NQO1 protein levels were quantified and normalized to β-actin. The NQO1 and β-actin immunoblots show two independent replicates for each cell line. (C) NQO1 enzymatic activity was measured by kinetic spectrophotometric assay. Results are expressed in nmol of cytochrome C reduced per minute per mg of protein. MDA-MB-231 cells transfected with empty vector (pcDNA3.1) and expressing NQO1 were treated for 2 h (clonogenic assay) or 24 h (MTT and Blue Trypan assays) with menadione (Men) and β-lapachone (Lap). (D) Cytotoxicity was analyzed using MTT. (E) Cell proliferation was analyzed by clonogenic survival. (F) Cell survival was assessed using Trypan blue exclusion assays. Data are means ± SEM from three separate experiments. *p-value b 0.05, **p-value b 0.01.

C. Glorieux et al. / Life Sciences 145 (2016) 57–65

assay (Fig. 4E) and trypan blue cell counting (Fig. 4F), NQO1 expression was shown to be an important determinant of cancer cell resistance against menadione. Moreover, these data confirmed that NQO1 expression was intrinsically related to cell sensitivity towards β-lapachone because its bioactivation rendered cells sensitive to this orthoquinone [18]. 4. Discussion NQO1, the enzyme that reduces quinone to hydroquinone [9], is often increased in tumors compared to healthy tissues [14–16]. In this study, the NQO1 protein levels were increased in 6 out of 10 invasive mammary ductal carcinoma samples compared to levels in tissue surrounding the tumor (Fig. 1A–B) and decreased in 3 samples. The increase or decrease of NQO1 protein levels in cancer cells could be dependent on different potentially cooperative mechanisms: corresponding genomic imbalances of the NQO1 locus located at chromosomal band 16q22, activation of Nrf2 pathway and/or the presence of NQO1 polymorphisms [11,44]. NQO1 therefore emerges as an attractive target for cancer therapy, because it bioactivates compounds such as β-lapachone, leading to selective cancer cell toxicity [18,45–47]. Conversely, NQO1 may also be involved in cell resistance to drug chemotherapy. For example, Resox cells were resistant to cisplatin and doxorubicin compared to an MCF-7 parental cell line, but not to paclitaxel and 5-fluorouracil [20]. Exploring the reasons behind this cellular resistance, we found increased NQO1 expression in Resox cells, which appeared to be correlated with genomic gain of the NQO1 gene locus. The genomic gain of the 16q22/NQO1 locus was observed in breast cancer cell lines as suggested by karyotype (additional derivative chromosome 16) [20] and confirmed by FISH and SNP-arrays. Interestingly, this chromosomal region is frequently deleted in breast tumors as in other types of cancer [48]. A loss of chromosomal band 16q22 is a better prognostic factor for patients and is the second most frequent target of loss of heterozygosity

63

in breast cancers [19,37–39]. In addition, patients with high-level NQO1 expression cervical squamous cell carcinoma and colorectal cancer had significantly lower survival rates than those with low-level NQO1 expression tumors [49,50]. The gain of NQO1 gene locus in breast cancer cell lines was also observed in one tumor biopsy (#346) that correlated with high NQO1 protein levels, suggesting that this event may potentially occur in patients. The sensitivity of breast cancer cells to quinone-based compounds was evaluated by modulating NQO1 expression. To this end, low expression of NQO1 was achieved by pharmacological inhibition using dicumarol. Conversely, high NQO1 expression was achieved first by exposing cells to a selection procedure against oxidative stress involving a genomic gain of NQO1 locus cells (Resox cells), and, second, by its stable transfection in NQO1-null MDA-MB-231 cells. These NQO1 overexpressing cells were more resistant to menadione compared to the cell lines of origin, namely MCF-7 cells and MDA-MB-231cells transfected with the empty vector (pcDNA3.1) although they were sensitive to βlapachone. These results are in agreement with the impact of NQO1 activity on the two compounds, with their metabolism by NQO1 leading to dramatically opposite effects: β-lapachone, which is bioactivated by NQO1 [11], and menadione, which is detoxified by the enzyme [9,10]. NQO1 expression and activity thus appear to be major components of cell survival when cells are exposed to quinone-bearing compounds. Regarding cellular resistance to menadione, the situation is rather complex given that its cytotoxicity is mediated not only by redox cycling (ROS generation), but also by covalent binding (arylation) leading to the formation of protein adducts [51,52]. However, NQO1 overexpressing cells were more resistant to menadione than was the parental cell line. In addition, a marked enhanced sensitivity to menadione was observed in Resox cells incubated in the presence of dicumarol. It may be argued that such a strong decreased cellular viability might be an experimental artifact due to the inclusion of dicumarol in the MTT assay [53]. However, under our experimental settings this is unlikely because the viability of the same Resox cells was only slightly affected when β-

Fig. 5. The metabolism of menadione and β-lapachone by NQO1. NQO1 contributes to either drug cytotoxicity or drug elimination influencing on the sensitivity of cancer cells to quinonebased molecules. The metabolism of quinones by NQO1 leads to bioactivation of β-lapachone and to detoxification of menadione.

64

C. Glorieux et al. / Life Sciences 145 (2016) 57–65

lapachone was tested in the presence of dicumarol (Fig. 3). These results show that responses of Resox cells were mainly due to either menadione or β-lapachone. Finally, in addition to NQO1 expression to explain cellular sensitivity towards β-lapachone, other mechanisms of bioactivation have been proposed. For example, increased ROS formation, as a result of a genetic invalidation of peroxiredoxin 1 in HeLa cells and MAPK induction [54] or a regioselective glucuronidation of reduced β-lapachone by different UGT isoforms [55], affects cellular sensitivity to this quinone. However, this is unlikely in Resox cells because although they have more antioxidant capacities than MCF-7 cells they were more sensitive to βlapachone. 5. Conclusions NQO1 contributes to either drug cytotoxicity or drug elimination making the cellular response to quinone-bearing compounds a complex process. The data suggest that, in addition to the expression of NQO1 per se, NQO1 activity has a major influence on the sensitivity of cancer cells to quinone-based molecules as depicted in Fig. 5. Thus, it is tempting to suggest that determining NQO1 activity and the number of copies of the chromosomal band 16q22, more specifically of NQO1 gene copies, may be useful when considering the use of quinone-based antitumor drugs in a given chemotherapy. Abbreviations BCA bicinchoninic acid assay BSA bovine serum albumin CFU colony forming units DMEM Dulbecco's Modified Eagle Medium DMSO dimethyl sulfoxide DTT dithiothreitol ECL electrochemiluminescence EF1 elongation factor 1 FFPE formalin-fixed paraffin-embedded FISH fluorescence in situ hybridization HMEC human mammary epithelial cells HRP horseradish peroxidase MTT 3-(4,5-dimethylthia-zolyl-2)-2,5-diphenyltetrazolium bromide NQO1 NAD(P)H:quinone oxidoreductase 1 PBS phosphate buffer saline PCR polymerase chain reaction PMSF phenylmethanesulfonyl fluoride ROS reactive oxygen species SDS sodium dodecylsulphate SNP single nucleotide polymorphism Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.lfs.2015.12.017. Conflict of interest statement The authors declare that there are no conflicts of interest. Acknowledgments This project was funded by FNRS-Télévie Grant (Grant no. 7.4575.12F). The authors are grateful to Pr. David Ross and Dr. Jadwiga Kepa for providing the plasmid construct containing human NQO1 cDNA and Dr. Julie Stockis for plasmid sequencing. The authors are grateful to Sandrine Nonckreman, Khadija Bahloula, Elisabeth Wyns and their colleagues at the human genetic center of Saint-Luc hospital in Brussels for their help in establishing karyotypes, SNP arrays and FISH analyses. We thank also Pr. Christine Galant for providing the paraffin-embedded tumor samples.

References [1] K. Maruyama, Y. Naruta, Syntheses of alpha- and beta-lapachones and their homologues by way of photochemical side chain introduction to quinone, Chem. Lett. 8 (1977) 847–850. [2] R.H. Thompson, Naturally occurring quinones III, recent advances, Chapman & Hall, London, U.K., 1987 [3] P.L. Chesis, D.E. Levin, M.T. Smith, L. Ernster, B.N. Ames, Mutagenicity of quinones: pathways of metabolic activation and detoxification, Proc. Natl. Acad. Sci. U. S. A. 81 (1984) 1696–1700. [4] H.G. Williams-Ashman, C. Huggins, Oxydation of reduced pyridine nucleotides in mammary gland and adipose tissue following treatment with polynuclear hydrocarbons, Med. Exp. Int. J. Exp. Med. 4 (1961) 223–226. [5] C. Lind, Formation of benzo[a]pyrene-3,6-quinol mono- and diglucuronides in rat liver microsomes, Arch. Biochem. Biophys. 240 (1985) 226–235. [6] V.A. Roginsky, T.K. Barsukova, H.B. Stegmann, Kinetics of redox interaction between substituted quinones and ascorbate under aerobic conditions, Chem. Biol. Interact. 121 (1999) 177–197. [7] J. Verrax, M. Delvaux, N. Beghein, H. Taper, B. Gallez, et al., Enhancement of quinone redox cycling by ascorbate induces a caspase-3 independent cell death in human leukaemia cells. An in vitro comparative study, Free Radic. Res. 39 (2005) 649–657. [8] P. Hochstein, Futile redox cycling: implications for oxygen radical toxicity, Fundam. Appl. Toxicol. 3 (1983) 215–217. [9] C. Lind, P. Hochstein, L. Ernster, DT-diaphorase as a quinone reductase: a cellular control device against semiquinone and superoxide radical formation, Arch. Biochem. Biophys. 216 (1982) 178–185. [10] H. Morrison, B. Jernstrom, M. Nordenskjold, H. Thor, S. Orrenius, Induction of DNA damage by menadione (2-methyl-1,4-naphthoquinone) in primary cultures of rat hepatocytes, Biochem. Pharmacol. 33 (1984) 1763–1769. [11] D. Siegel, C. Yan, D. Ross, NAD(P)H:quinone oxidoreductase 1 (NQO1) in the sensitivity and resistance to antitumor quinones, Biochem. Pharmacol. 83 (2012) 1033–1040. [12] D. Siegel, D. Ross, Immunodetection of NAD(P)H:quinone oxidoreductase 1 (NQO1) in human tissues, Free Radic. Biol. Med. 29 (2000) 246–253. [13] A. Strassburg, C.P. Strassburg, M.P. Manns, R.H. Tukey, Differential gene expression of NAD(P)H:quinone oxidoreductase and NRH:quinone oxidoreductase in human hepatocellular and biliary tissue, Mol. Pharmacol. 61 (2002) 320–325. [14] T. Cresteil, A.K. Jaiswal, High levels of expression of the NAD(P)H:quinone oxidoreductase (NQO1) gene in tumor cells compared to normal cells of the same origin, Biochem. Pharmacol. 42 (1991) 1021–1027. [15] J.J. Schlager, G. Powis, Cytosolic NAD(P)H:(quinone-acceptor)oxidoreductase in human normal and tumor tissue: effects of cigarette smoking and alcohol, Int. J. Cancer 45 (1990) 403–409. [16] D. Siegel, W.A. Franklin, D. Ross, Immunohistochemical detection of NAD(P)H: quinone oxidoreductase in human lung and lung tumors, Clin. Cancer Res. 4 (1998) 2065–2070. [17] R.A. Fleming, J. Drees, B.W. Loggie, G.B. Russell, K.R. Geisinger, et al., Clinical significance of a NAD(P)H: quinone oxidoreductase 1 polymorphism in patients with disseminated peritoneal cancer receiving intraperitoneal hyperthermic chemotherapy with mitomycin C, Pharmacogenetics 12 (2002) 31–37. [18] M. Ough, A. Lewis, E.A. Bey, J. Gao, J.M. Ritchie, et al., Efficacy of beta-lapachone in pancreatic cancer treatment: exploiting the novel, therapeutic target NQO1, Cancer Biol. Ther. 4 (2005) 95–102. [19] D. Hungermann, H. Schmidt, R. Natrajan, N. Tidow, K. Poos, et al., Influence of whole arm loss of chromosome 16q on gene expression patterns in oestrogen receptorpositive, invasive breast cancer, J. Pathol. 224 (2011) 517–528. [20] N. Dejeans, C. Glorieux, S. Guenin, R. Beck, B. Sid, et al., Overexpression of GRP94 in breast cancer cells resistant to oxidative stress promotes high levels of cancer cell proliferation and migration: implications for tumor recurrence, Free Radic. Biol. Med. 52 (2012) 993–1002. [21] J. Verrax, S. Vanbever, J. Stockis, H. Taper, P.B. Calderon, Role of glycolysis inhibition and poly(ADP-ribose) polymerase activation in necrotic-like cell death caused by ascorbate/menadione-induced oxidative stress in K562 human chronic myelogenous leukemic cells, Int. J. Cancer 120 (2007) 1192–1197. [22] J.C. Garbe, S. Bhattacharya, B. Merchant, E. Bassett, K. Swisshelm, et al., Molecular distinctions between stasis and telomere attrition senescence barriers shown by long-term culture of normal human mammary epithelial cells, Cancer Res. 69 (2009) 7557–7568. [23] C. Glorieux, J. Auquier, N. Dejeans, B. Sid, J.B. Demoulin, et al., Catalase expression in MCF-7 breast cancer cells is mainly controlled by PI3K/Akt/mTor signaling pathway, Biochem. Pharmacol. 89 (2014) 217–223. [24] S.A. Fitzsimmons, P. Workman, M. Grever, K. Paull, R. Camalier, et al., Reductase enzyme expression across the National Cancer Institute Tumor cell line panel: correlation with sensitivity to mitomycin C and EO9, J. Natl. Cancer Inst. 88 (1996) 259–269. [25] J.J. Lee, D. Warburton, E.J. Robertson, Cytogenetic methods for the mouse: preparation of chromosomes, karyotyping, and in situ hybridization, Anal. Biochem. 189 (1990) 1–17. [26] F.P. Duhoux, G. Ameye, C.P. Montano-Almendras, K. Bahloula, M.J. Mozziconacci, et al., PRDM16 (1p36) translocations define a distinct entity of myeloid malignancies with poor prognosis but may also occur in lymphoid malignancies, Br. J. Haematol. 156 (2012) 76–88. [27] B. Marquez, G. Ameye, C.M. Vallet, P.M. Tulkens, H.A. Poirel, et al., Characterization of Abcc4 gene amplification in stepwise-selected mouse J774 macrophages resistant to the topoisomerase II inhibitor ciprofloxacin, PLoS One 6 (2011) e28368.

C. Glorieux et al. / Life Sciences 145 (2016) 57–65 [28] S. Medves, F.P. Duhoux, A. Ferrant, F. Toffalini, G. Ameye, et al., KANK1, a candidate tumor suppressor gene, is fused to PDGFRB in an imatinib-responsive myeloid neoplasm with severe thrombocythemia, Leukemia 24 (2010) 1052–1055. [29] F.P. Duhoux, G. Ameye, V. Lambot, C. Herens, F. Lambert, et al., Refinement of 1p36 alterations not involving PRDM16 in myeloid and lymphoid malignancies, PLoS One 6 (2011) e26311. [30] N.A. Franken, H.M. Rodermond, J. Stap, J. Haveman, C. van Bree, Clonogenic assay of cells in vitro, Nat. Protoc. 1 (2006) 2315–2319. [31] G. Kroemer, L. Galluzzi, P. Vandenabeele, J. Abrams, E.S. Alnemri, et al., Classification of cell death: recommendations of the Nomenclature Committee on Cell Death 2009, Cell Death Differ. 16 (2009) 3–11. [32] C. Glorieux, N. Dejeans, B. Sid, R. Beck, P.B. Calderon, et al., Catalase overexpression in mammary cancer cells leads to a less aggressive phenotype and an altered response to chemotherapy, Biochem. Pharmacol. 82 (2011) 1384–1390. [33] T. Mosmann, Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays, J. Immunol. Methods 65 (1983) 55–63. [34] M. Belinsky, A.K. Jaiswal, NAD(P)H:quinone oxidoreductase1 (DT-diaphorase) expression in normal and tumor tissues, Cancer Metastasis Rev. 12 (1993) 103–117. [35] A.M. Cleton-Jansen, R. van Eijk, M. Lombaerts, M.K. Schmidt, L.J. Van't Veer, et al., ATBF1 and NQO1 as candidate targets for allelic loss at chromosome arm 16q in breast cancer: absence of somatic ATBF1 mutations and no role for the C609T NQO1 polymorphism, BMC Cancer 8 (2008) 105. [36] T.E. Downing, M.H. Oktay, M.J. Fazzari, C. Montagna, Prognostic and predictive value of 16p12.1 and 16q22.1 copy number changes in human breast cancer, Cancer Genet. Cytogenet. 198 (2010) 52–61. [37] S.H. Nordgard, F.E. Johansen, G.I. Alnaes, E. Bucher, A.C. Syvanen, et al., Genomewide analysis identifies 16q deletion associated with survival, molecular subtypes, mRNA expression, and germline haplotypes in breast cancer patients, Genes Chromosom. Cancer 47 (2008) 680–696. [38] S.A. Shaposhnikov, S.B. Akopov, I.P. Chernov, P.D. Thomsen, C. Joergensen, et al., A map of nuclear matrix attachment regions within the breast cancer loss-ofheterozygosity region on human chromosome 16q22.1, Genomics 89 (2007) 354–361. [39] T. van Wezel, M. Lombaerts, E.H. van Roon, K. Philippo, H.J. Baelde, et al., Expression analysis of candidate breast tumour suppressor genes on chromosome 16q, Breast Cancer Res. 7 (2005) R998–1004. [40] L.M. Voeghtly, K. Mamula, J.L. Campbell, C.D. Shriver, R.E. Ellsworth, Molecular alterations associated with breast cancer mortality, PLoS One 7 (2012) e46814. [41] R. Venugopal, A.K. Jaiswal, Nrf1 and Nrf2 positively and c-Fos and Fra1 negatively regulate the human antioxidant response element-mediated expression of NAD(P)H:quinone oxidoreductase1 gene, Proc. Natl. Acad. Sci. U. S. A. 93 (1996) 14960–14965.

65

[42] Y.H. Edwards, J. Potter, D.A. Hopkinson, Human FAD-dependent NAD(P)H diaphorase, Biochem. J. 187 (1980) 429–436. [43] E. Blanco, E.A. Bey, Y. Dong, B.D. Weinberg, D.M. Sutton, et al., Beta-lapachonecontaining PEG-PLA polymer micelles as novel nanotherapeutics against NQO1overexpressing tumor cells, J. Control. Release 122 (2007) 365–374. [44] Y. Onodera, H. Motohashi, K. Takagi, Y. Miki, Y. Shibahara, et al., NRF2 immunolocalization in human breast cancer patients as a prognostic factor, Endocr. Relat. Cancer 21 (2014) 241–252. [45] M.S. Bentle, K.E. Reinicke, Y. Dong, E.A. Bey, D.A. Boothman, Nonhomologous end joining is essential for cellular resistance to the novel antitumor agent, betalapachone, Cancer Res. 67 (2007) 6936–6945. [46] L.S. Li, E.A. Bey, Y. Dong, J. Meng, B. Patra, et al., Modulating endogenous NQO1 levels identifies key regulatory mechanisms of action of beta-lapachone for pancreatic cancer therapy, Clin. Cancer Res. 17 (2011) 275–285. [47] K.E. Reinicke, E.A. Bey, M.S. Bentle, J.J. Pink, S.T. Ingalls, et al., Development of betalapachone prodrugs for therapy against human cancer cells with elevated NAD(P)H: quinone oxidoreductase 1 levels, Clin. Cancer Res. 11 (2005) 3055–3064. [48] S. Knuutila, Y. Aalto, K. Autio, A.M. Bjorkqvist, W. El-Rifai, et al., DNA copy number losses in human neoplasms, Am. J. Pathol. 155 (1999) 683–694. [49] L. Ji, Y. Wei, T. Jiang, S. Wang, Correlation of Nrf2, NQO1, MRP1, cmyc and p53 in colorectal cancer and their relationships to clinicopathologic features and survival, Int. J. Clin. Exp. Pathol. 7 (2014) 1124–1131. [50] Y. Ma, J. Kong, G. Yan, X. Ren, D. Jin, et al., NQO1 overexpression is associated with poor prognosis in squamous cell carcinoma of the uterine cervix, BMC Cancer 14 (2014) 414. [51] D. Di Monte, D. Ross, G. Bellomo, L. Eklow, S. Orrenius, Alterations in intracellular thiol homeostasis during the metabolism of menadione by isolated rat hepatocytes, Arch. Biochem. Biophys. 235 (1984) 334–342. [52] T.W. Gant, D.N. Rao, R.P. Mason, G.M. Cohen, Redox cycling and sulphydryl arylation; their relative importance in the mechanism of quinone cytotoxicity to isolated hepatocytes, Chem. Biol. Interact. 65 (1988) 157–173. [53] A.C. Collier, C.A. Pritsos, The mitochondrial uncoupler dicumarol disrupts the MTT assay, Biochem. Pharmacol. 66 (2003) 281–287. [54] T. He, A. Banach-Latapy, L. Vernis, M. Dardalhon, R. Chanet, et al., Peroxiredoxin 1 knockdown potentiates beta-lapachone cytotoxicity through modulation of reactive oxygen species and mitogen-activated protein kinase signals, Carcinogenesis 34 (2013) 760–769. [55] X. Cheng, F. Liu, T. Yan, X. Zhou, L. Wu, et al., Metabolic profile, enzyme kinetics, and reaction phenotyping of beta-lapachone metabolism in human liver and intestine in vitro, Mol. Pharm. 9 (2012) 3476–3485.