Overexpression of neuronal Sec1 enhances axonal branching in hippocampal neurons

PII: S 0 3 0 6 - 4 5 2 2 ( 0 2 ) 0 0 2 2 5 - 7

Neuroscience Vol. 113, No. 4, pp. 893^905, 2002 A 2002 IBRO. Published by Elsevier Science Ltd All rights reserved. Printed in Great Britain 0306-4522 / 02 $22.00+0.00

www.neuroscience-ibro.com

OVEREXPRESSION OF NEURONAL SEC1 ENHANCES AXONAL BRANCHING IN HIPPOCAMPAL NEURONS P. STEINER,a;b J.-C. F. SARRIA,a;b B. HUNI,a R. MARSAULT,a S. CATSICASb and H. HIRLINGa;b a b

Faculte¤ des Sciences de la Vie, Ecole Polytechnique Fe¤de¤rale de Lausanne, 1015 Lausanne, Switzerland

Institut de Biologie Cellulaire et de Morphologie (IBCM), Rue du Bugnon 9, 1005 Lausanne, Switzerland

Abstract3The soluble N-ethylmaleimide-sensitive factor-attached protein receptor (SNARE) proteins syntaxin 1 and synaptosomal-associated protein-25 have been implicated in axonal outgrowth. Neuronal Sec1 (nSec1), also called murine unc18a (Munc18a), is a syntaxin 1-binding protein involved in the regulation of SNARE complex formation in synaptic vesicle membrane fusion. Here we analysed whether nSec1/Munc18a is involved in neurite formation. nSec1/Munc18a expressed under the control of an inducible promoter in di¡erentiated PC12 cells as well as in hippocampal neurons appears ¢rst in the cell body, and at later times after induction along neurites and in growth cones. It is localised to distinct tubular and punctated structures. In addition, exogenous nSec1/Munc18a inhibited regulated secretion in PC12 cells. Overexpression in PC12 cells of nSec1/Munc18a or its homologue Munc18b, reduced the total length of neurites. This e¡ect was enhanced with nSec1-T574A, a mutant that lacks a cyclin-dependent kinase 5 phosphorylation site and displays an increased binding to syntaxin 1. In contrast, in hippocampal neurons the total length of all primary neurites and branches was increased upon transfection of nSec1/Munc18a. Detailed morphometric analysis revealed that this was a consequence of an increased number of axonal side branches, while the average lengths in primary neurites and of side branches were not a¡ected. From these results we suggest that nSec1/Munc18a is involved in the regulation of SNARE complex-dependent membrane fusion events implicated in the rami¢cation of axonal processes in neurons. A 2002 IBRO. Published by Elsevier Science Ltd. All rights reserved. Key words: neurite elongation, sprouting, SNARE, membrane expansion.

yet fully understood, the accessibility of these SNARE proteins to bind to each other seems to be a critical step for vesicle fusion to proceed. A candidate to regulate the availability of syntaxin 1 to interact with its binding partners is neuronal Sec1 (nSec1)/murine unc18a (Munc18a)/rbsec1 (Garcia et al., 1994; Hata et al., 1993; Hodel et al., 1994; Pevsner et al., 1994b). This 68-kDa hydrophilic protein is only detected in brain and belongs to a group of mammalian homologues of yeast sec1p (Hata and Sudhof, 1995; Katagiri et al., 1995; Tellam et al., 1995). SEC1 is an essential gene for secretion in yeast, and its mutation causes Golgi-to-plasma membrane vesicles to accumulate without fusion (Aalto et al., 1991; Novick et al., 1980) suggesting a positive function in secretion. In Caenorhabditis elegans, mutation in the sec1-homologous gene UNC18 causes a block in neurotransmission supporting the essential role in neurotransmitter secretion (Hosono et al., 1992). The Drosophila homologue rop has been shown to bind in vivo to syntaxin (Wu et al., 1998). Depending on the level of expression, rop can have positive or inhibitory e¡ects on neurotransmitter secretion (Schulze et al., 1994; Wu et al., 1998). In mammalian cells, nSec1/Munc18a binds to syntaxin 1, as well as to other proteins like mint 1 and 2 (Okamoto and Sudhof, 1997) and Doc-2 proteins (Verhage et al., 1997). Syntaxin 1 binds to nSec1/Munc18a in a closed conformation, while interaction with SNAP-25 and VAMP

Synaptic transmission involves the fusion of neurotransmitter-¢lled synaptic vesicles with the active zone of the presynaptic plasma membrane. The SNARE (soluble N-ethylmaleimide-sensitive factor-attached protein receptor) proteins, syntaxin 1 and synaptosomal-associated protein (SNAP)-25, on the plasma membrane, and vesicle-associated membrane protein (VAMP)-1 and -2 on synaptic vesicles play a central role in the docking and fusion of synaptic vesicles (Jahn and Sudhof, 1999; Scheller, 1995). These proteins form a complex which is believed to be an important intermediate in the process of vesicle docking and fusion (Bennett et al., 1992; Sollner et al., 1993; Sutton et al., 1998). Although the exact function and sequence of these interactions is not

*Corresponding author. Tel.: +41-21-6935363; fax: +41-216935369. E-mail address: harald.hirling@ep£.ch (H. Hirling). Abbreviations : AP, alkaline phosphatase ; DMEM, Dulbecco’s modi¢ed Eagle’s medium; GFP, green £uorescent protein ; GST, glutathione S-transferase; HEPES, N-(2-hydroxyethyl)piperazine-NP-(2-ethane sulphonic acid) ; hGH, human growth hormone; IVT, in vitro translation; Munc18a, murine unc18a; NGF, nerve growth factor; nSec1, neuronal Sec1; PCR, polymerase chain reaction ; SDS, sodium dodecyl sulphate; SNAP-25, synaptosomal-associated protein; SNARE, soluble N-ethylmaleimidesensitive factor-attached protein receptor ; VAMP, vesicle-associated membrane protein; wt, wildtype. 893

NSC 5668 5-8-02

894

P. Steiner et al.

requires a di¡erent structure (Dulubova et al., 1999; Misura et al., 2000; Yang et al., 2000), which renders the complexes syntaxin 1/nSec1 and syntaxin 1/SNAP25/VAMP mutually exclusive (Pevsner et al., 1994a; Yang et al., 2000). The binding of nSec1/Munc18a to syntaxin 1 is inhibited when threonine 574 is phosphorylated by cyclin-dependent kinase 5 (Fletcher et al., 1999). This gives nSec1/Munc18a a putative regulatory role in SNARE complex formation. Moreover, in mice lacking a functional gene for nSec1/Munc18a, evoked synaptic response is completely abolished although embryonic development of the brain appears to be normal (Verhage et al., 2000). Microinjection of the squid homologue of nSec1/Munc18a into the squid giant synapse inhibited evoked neurotransmitter release (Dresbach et al., 1998), although overexpression of nSec1/Munc18a in PC12 cells had no e¡ect on secretion (Graham et al., 1997). Several SNARE proteins, including syntaxin 1, have been proposed to mediate membrane expansion in growth cones during axonal outgrowth (Ahnert-Hilger et al., 1996; Hirling et al., 2000; Igarashi et al., 1996, 1997; Osen-Sand et al., 1993, 1996). Cleavage of syntaxin 1 by botulinum toxin C1 led to a rapid retraction of axons and formation of intracellular vacuoles in primary neuronal cultures (Igarashi et al., 1996; Osen-Sand et al., 1996). Moreover, overexpression of syntaxin 1 inhibited PC12 cell di¡erentiation (Hirling et al., 2000; Zhou et al., 2000). Therefore, we hypothesised that nSec1/ Munc18a might regulate neurite formation. We tested this hypothesis by overexpression of nSec1/Munc18a and of Munc18b in PC12 cells followed by nerve growth factor (NGF)-di¡erentiation and in primary hippocampal neurons. In the latter cell system we carried out a detailed morphological analysis of the average lengths and numbers of primary neurites and side branches. We also analysed the e¡ect of nSec1/Munc18a transfection on regulated secretion in PC12 cells. Moreover, we investigated the localisation of nSec1/Munc18a, expressed under the control of an inducible promoter, in PC12 cells and primary neurons.

EXPERIMENTAL PROCEDURES

Expression constructs The coding region of the nSec1/Munc18a cDNA (gift of Dr. R.H. Scheller, Stanford, USA) was subcloned in frame into the EcoRI and XbaI sites of the mammalian expression vector pcDNA3.1/Myc-His.A (Invitrogen, Carlsbad, USA) by polymerase chain reaction (PCR) to obtain carboxy-terminally myc-tagged nSec1/Munc18a. This plasmid was digested by EcoRI/PmeI in order to release the nSec1/Munc18a-myc-coding cDNA which was subcloned into the EcoRI/EcoRV sites of the mammalian inducible expression vector pIND (Invitrogen). To obtain plasmids expressing an nSec1-green £uorescent protein (GFP) fusion protein, the coding sequences of nSec1 and of the GFP mutant S65T (gift of Dr. J. Pozzan, Padua, Italy) were ampli¢ed by PCR. In a ¢rst step, the PCR fragments containing the nSec1 and GFP-S65T cDNAs were separately subcloned into the SmaI site of pBluescript KS(+) plasmids (Stratagene, Cambridge, USA). In a second step, GFP-S65T (released EcoRI/EcoRI) was ligated into an EcoRI site down-

stream of the nSec1 cDNA in pBluescript. In a third step, this nSec1-GFP cDNA was cloned XbaI/ApaI into pIND. The mutant nSec1-T574A was generated using the QuickChange Site-Directed Mutagenesis Kit (Stratagene) with a sense-oligonucleotide and anti-sense-oligonucleotide changing the triplet ACC into GCC. The mutagenesis reaction was carried out on the plasmid pIND-nSec1-myc. The mutated cDNA was veri¢ed by sequencing. The cDNAs of Munc18b and Munc18c (Tellam et al., 1995; kindly provided by Dr. D. James, St. Lucia, Australia), were subcloned between EcoRI and XhoI into pcDNA3B-EE. This vector, derived from pcDNA3.1/myc-his.B, harbours a sequence GAGTACATGCCCATGGAGTGA between XbaI and PmeI which codes for the EE-tag EYMPMEstop (Grussenmeyer et al., 1985) instead of the myc-his tags. The cDNA encoding placental alkaline phosphatase (AP) was transferred by EcoRI/XhoI digestion from pSEAP-control vector (Clontech, Palo Alto, USA) to pcDNA3. Cell culture and immunocytochemistry PC12ES cells (Ip et al., 1993), which will be referred to as PC12 cells in this manuscript, were grown in Dulbecco’s modi¢ed Eagle’s medium (DMEM)/6% foetal calf serum (FCS)/6% horse serum on polystyrene dishes (Becton-Dickinson, Lincoln Park, USA) without collagen coating. PC12 cells were di¡erentiated in DMEM/1% horse serum/50 ng/ml NGF. HIT-T15 cells (Santerre et al., 1981) were grown in RPMI 1640/10% FCS/ 2.05 mM L-glutamine/32.5 WM glutathione/10 mM selenic acid. Transfection of PC12 and HIT-T15 cells was carried out by electroporation at 0.26 kV and 925 WF (Bio-Rad Gene Pulser system). COS-7 cells were grown in DMEM/10% FCS and transfected by the DNA/calcium phosphate precipitate technique. Hippocampal neurons were prepared from postnatal day 0 rats as follows: hippocampi without dentate gyri were dissociated with papain and triturated using a glass pipette. After centrifugation for 2 min at 400Ug, cells were plated at 150 000 cells per 35-mm dish containing poly-D-lysin/laminincoated borosilicate coverslips in MEM/10% FCS. For neurite outgrowth studies, medium was changed after 3 h to Neurobasal medium. After 30 min, neurons were transfected according to Xia et al. (1996) by the calcium-phosphate technique. In brief, plasmid DNA encoding the indicated proteins (4 Wg) in 60 Wl CaCl2 was mixed with 60 Wl 2UHEPES-bu¡ered saline pH 7.0 and added to 1 neuron culture dish (35 mm) for 30 min, followed by glycerol shock (1 min), and medium change to Neurobasal/B27. For analysis of nSec1/Munc18a localisation in PC12 cells and hippocampal neurons, we used an ecdysone (as well as its analogue ponasterone A)-inducible expression system (Invitrogen) in transient transfections. In brief, cells were cotransfected with a plasmid pVgRXR which expresses constitutively the two subunits of the ecdysone receptor, and either pIND-nSec1-GFP (PC12) or pIND-nSec1-myc (neurons). pIND directs expression under the control of the ecdysone-inducible promoter. Cotransfected PC12 cells were di¡erentiated by 50 ng/ml NGF in the absence of hormone during 7 days on glass coverslips. Expression was induced by the addition of 0.5 WM ponasterone A for 6 h. At the times indicated, cells were ¢xed in 4% formaldehyde for 30 min and processed further for immunocytochemistry. Hippocampal neurons were cotransfected at day 1 of culture, followed by induction for 6 h with ponasterone on day 3, before ¢xation in 4% paraformaldehyde/4% sucrose at the indicated time points. Cells were incubated for 2 h with primary antibodies in 100 mM Tris^HCl pH 7.4, 66 mM NaCl, 5% horse serum, 5% normal goat serum, 3% bovine serum albumin (BSA), and 0.33% Triton X-100. After washing, cells were incubated for 30 min with the secondary antibody and then washed again. Antisera were used at the following dilutions: rabbit anti-GFP, 1:400 (Clontech, Palo Alto, USA); monoclonal anti-myc 9E10 hybridoma supernatant, 1:20; secondary CY3-labelled anti-rabbit IgG, 1:200 (Jackson ImmunoResearch, West Grove, USA). Immunostained cells were analysed on a Leica TCSNT confocal microscope (Heidelberg, Germany).

NSC 5668 5-8-02

nSec1/Munc18a in neurite formation

In vitro binding assay and western blotting Recombinant glutathione S-transferase (GST)-syntaxin 1A (plasmid was a gift of Dr. R.H. Scheller, Stanford University, USA), GST-syntaxin 13, and GST alone were expressed in bacteria and immobilised on glutathione^agarose beads (Pevsner et al., 1994a). The syntaxin 13 cDNA (Hirling et al., 2000) was subcloned into the EcoRI site of the plasmid pGex-KG. The beads were resuspended in binding bu¡er (20 mM HEPES, 150 mM KCl 5% glycerol, 1 mM dithiothreitol, 0.05% Tween, and 1 mg/ml BSA). NSec1-myc and nSec1-GFP were synthesised by in vitro transcription/translation (IVT) using a kit according to the manufacturer’s instructions (Promega, Madison, USA) in the presence of [35 S]methionine in 20-Wl reactions. For each binding reaction, 100 ng of GST-fusion protein beads were incubated with 5 Wl of each IVT reaction in a ¢nal volume of 20 Wl. After 2 h at 4‡C, beads were washed six times with 500 Wl of binding bu¡er. Beads were resuspended in sample bu¡er and loaded on a 12% sodium dodecyl sulphate (SDS)^polyacrylamide gel electrophoresis. After migration, the gel was stained with Coomassie Brilliant Blue, destained, and treated with Amplify (Amersham, Buckinghamshire, UK) to enhance the radioactive signals. The dried gel was exposed to X-ray ¢lm. For western blot analysis, post-nuclear supernatant from adult rat brain was prepared as previously described (Hirling et al., 2000). PC12 cells and HIT-T15 cells were lysed in phosphate-bu¡ered saline/0.5% Triton X-100/phenylmethylsulfonyl £uoride. Protein concentrations were determined using the Bradford technique (Bio-Rad), and 30 Wg of each extract was separated on a 10% SDS^polyacrylamide gel. Proteins were blotted onto Protran BA 83 nitrocellulose (Schleicher and Schuell, Dassel, Germany), and probed with the polyclonal anti-GFP antibody at 1:2000, a polyclonal anti-nSec1 antibody (Calbiochem, La Jolla, USA) and a monoclonal anti-actin antibody (Roche), both at 1:2000. Quanti¢cation of neurite morphology The analysis of neurite outgrowth in PC12 cells was carried out as previously described (Hirling et al., 2000). In some experiments (Fig. 4A) the ponasterone-inducible expression system was applied to increase transfection e⁄ciency. In brief, PC12 cells were cotransfected by electroporation with pVgRXR and either pIND-nSec1-myc, or pIND-nSec1-T574A-myc. Control cells were cotransfected with pIND and pcDNA3-GFP. Cells were ¢xed after 2 days in the presence of 50 ng/ml NGF (and 1 WM ponasterone in the case of Fig. 4A) and immunostained with monoclonal anti-myc 9E10 hybridoma supernatant, and a secondary CY3-coupled £uorescent antibody. Morphological classes were de¢ned as cells with neurites of 0^0.5, 0.5^1 and longer than one cell body diameter. One hundred and seventy transfected cells on average were counted for each transfection, and grouped in the di¡erent classes according to the length of their neurites. A 40U objective on a Zeiss Axiophot £uorescence microscope was used for visual inspection. Independent countings of coverslips from three independent experiments (with on average 170 analysed cells per transfection) were performed by three di¡erent observers. For experiments comparing nSec1/ Munc18a and Munc18b PC12 cells were transfected with pcDNA3-nSec1-myc, pcDNA3-Munc18b-EE or GFP as control. For immunocytochemistry anti-myc, anti-EE-tag hybridoma supernatant (Grussenmeyer et al., 1985) (IF, 1:30), or no antibody were used. Cumulated results were analysed for di¡erences between control and nSec1/Munc18 constructs by a Student t-test. Double asterisks in Fig. 2 indicate signi¢cance at P 6 0.01, and single asterisks indicate signi¢cance at P 6 0.02. For morphological analysis in hippocampal neurons, cells were transfected 3 h after plating with either pcDNA3-nSec1myc, or pcDNA3-Munc18b-EE, or pcDNA3-GFP, or pcDNA3AP. Neurons were ¢xed 4 days later and immunostained for the transfected proteins (in the case of GFP, its intrinsic £uorescence was used). Fluorescence images of cells were taken using a 10U objective and a Leica DC100 digital camera. The illumination was overexposed in order to control for the visualisation

895

of all neurites and branches up to their tip. To distinguish transfected neurons from contaminating glial cells, colabeling using a polyclonal anti-SNAP25 antibody (Osen-Sand et al., 1993) was included. Quanti¢cation of the indicated morphological parameters was carried out on 42 cells (nSec1/Munc18a), 47 cells (Munc18b), 42 cells (GFP), or 32 cells (AP). Processes were traced and analysed in the morphometry module of NIH image (Object Image). For the analysis of axonal morphology the subgroup of cells was selected which possessed a single long neurite which was on average 6.2 times longer than the second longest neurite (nSec1/Munc18a, n = 20; Munc18b, n = 16; GFP, n = 16; AP, n = 16). Di¡erences between controls (GFP or AP) and nSec1/Munc18a/Munc18b constructs were determined by a Student t-test. The signi¢cance level was P 6 0.004 in Fig. 6, P 6 0.003 for AP in Fig. 7A, P 6 0.03 for GFP in Fig. 7A, and P 6 0.03 in Fig. 7B. All error bars indicate standard error of the means (S.E.M.). Human growth hormone (hGH) secretion Secretion assays from PC12 cells were carried out according to Holz et al. (1994) with modi¢cations. Since the overall transfection e⁄ciency with the inducible pIND vectors is higher than with the constitutive pcDNA3 vectors, this system was also applied on transfections for secretion assays. Cells were cotransfected by electroporation with 10 Wg of pcDNA3-hGH, 20 Wg of pVgRXR, and either 20 Wg of pIND alone or of pIND-nSec1myc. Cells were plated into six separate wells. Expression of nSec1-myc was induced after 24 h and after 48 h by the addition of 1 WM ponasterone. Three days after transfections cells were preincubated for 30 min in bu¡er (20 mM HEPES pH 7.4, 128 mM NaCl, 5 mM KCl, 2.7 mM CaCl2 , 10 mM glucose, and 1 mM MgCl2 ). Then the solution was changed in wells 1^3 to bu¡er containing 53 mM NaCl and 80 mM KCl (stimulated secretion) and in wells 4^6 to bu¡er as above (basal secretion). After 10 min, aliquots of each well were taken and the hGH content was measured by an enzyme-linked immunosorbent assay system (Roche, Basel, Switzerland). Stimulation was calculated by averaging the three basal values (corresponds to 100%) and the three stimulated values. The values from three independent experiments were cumulated and analysed by a Student t-test for signi¢cant di¡erences between control and nSec1/Munc18a transfections. The signi¢cance level in Fig. 2 is P 6 0.03.

RESULTS

To study the e¡ect of nSec1/Munc18a on neurite outgrowth and its localisation in PC12 cells, we constructed plasmids encoding carboxy-terminally myc-tagged nSec1/ Munc18a as well as a fusion protein between nSec1/ Munc18a and GFP. In order to verify whether these fusion proteins can still bind to syntaxin 1A, we performed IVT and GST-binding assays. Translated nSec1-myc (Fig. 1A) bound speci¢cally to GST-syntaxin 1A, but not to GST alone (Fig. 1B). It has been shown that phosphorylation of threonine 574 by cyclin-dependent kinase 5 inhibits the interaction of nSec1/Munc18a with syntaxin 1A (Fletcher et al., 1999). To analyse in detail an e¡ect of nSec1/Munc18a in neurite formation (see below), we exchanged the threonine by an alanine (n-T574A) in nSec1-myc (Fletcher et al., 1999). Like wildtype (wt) nSec1/Munc18a (nSec1-wt), this mutant bound speci¢cally to GST-syntaxin 1A, but not to GST (Fig. 1B). Quanti¢cation of radioactive bands in the translation reaction (Fig. 1A) and after binding to GST-syntaxin 1A-beads (Fig. 1B) indicated a 2.6-fold

NSC 5668 5-8-02

896

P. Steiner et al.

protein (Fig. 1C). Aliquots of the translation reactions were incubated with GST-syntaxin 1A, GST-syntaxin 13, or GST, immobilised on glutathione^agarose beads. Both nSec1 and nSec1-GFP bound to GST-syntaxin 1A, but not to GST alone (Fig. 1D). The slightly faster migrating band of nSec1 after binding is probably a degradation product produced during the incubation with the beads. The nSec1 constructs did not bind speci¢cally to syntaxin 13, a syntaxin-isoform implicated in early endosomal tra⁄cking (Hirling et al., 2000; Prekeris et al., 1998). The faint binding to syntaxin 13 is most probably non-speci¢c since it is equal to the binding to GST alone. This result suggests that the GFP-fusion protein is still functional in binding to syntaxin 1. For some experiments of this study we expressed

Fig. 1. Binding of nSec1-myc and nSec1-GFP to syntaxin 1A. (A) wt nSec1-myc (wt) and nSec1-T574A (T574A) were expressed by IVT. (B) Aliquots of the reactions were incubated with GSTsyntaxin 1A (GST-syx1) or GST alone (GST) immobilised on glutathione-agarose beads (binding). (C) NSec1 (n) and nSec1-GFP (n-GFP) were expressed by IVT. (D) Aliquots were incubated with GST-syntaxin 1A (GST-syx1), GST-syntaxin 13 (GST-syx13), or GST alone immobilised on glutathione-agarose beads. After washing, beads were loaded on SDS^polyacrylamide gels. The dried gels were exposed to X-ray ¢lm. (E) Time-course of induced nSec1 expression. COS-7 cells were cotransfected with pVgRXR and pIND-nSec1-GFP. Expression was induced at 0 h by 0.5 WM ponasterone during 6 h. Cells were lysed at di¡erent times and extracts analysed by western blotting using an anti-GFP antibody.

stronger binding of n-T574A than of nSec1-wt. For the fusion protein between nSec1/Munc18a and GFP we used S65T (named GFP in this manuscript) which has a six times stronger £uorescence than wt GFP (Cubitt et al., 1995). The e⁄ciency of IVT for nSec1-GFP (n-GFP) was signi¢cantly lower than for nSec1/Munc18a (n), presumably due to the increased size (98 kDa) of the fusion

Fig. 2. Overexpression of nSec1 inhibits regulated secretion in PC12 cells. (A) Western blot analysis using 30 Wg of post-nuclear supernatant from adult rat brain (brain), PC12 cells (PC12), or HIT-T15 cells (HIT) demonstrating expression levels of endogenous nSec1. The membrane was probed using an anti-nSec1 (nSec1) or an anti-actin (actin) antibody. (B) PC12 cells were cotransfected with hGH and either empty vector or nSec1-myc (nSec1) using the ponasterone-inducible system, and plated into six separate wells. After 3 days basal secretion and potassiuminduced secretion were measured. Non-induced basal secretion corresponds to 1. The average stimulations from three independent experiments are shown. There was a signi¢cant inhibition upon nSec1 transfection (P 6 0.03). Error bars indicate S.E.M. (C) A typical experiment as in B, but using the pancreatic L-cell line HIT-T15.

NSC 5668 5-8-02

nSec1/Munc18a in neurite formation

nSec1/Munc18a under the control of an ecdysone-inducible promoter in transient transfections. Fig. 1E shows the time-course of nSec1-GFP expression in COS-7 cells upon an induction pulse during the ¢rst 6 h, indicating maximal expression of the protein after around 1 day. Overexpression of nSec1/Munc18a inhibits regulated secretion in PC12 cells Since nSec1/Munc18a a¡ected evoked release in the squid giant synapse (Dresbach et al., 1998) as well as in Drosophila (Wu et al., 1998), we decided to analyse a possible e¡ect of nSec1/Munc18a on secretion in our PC12 cells. Western blots were performed to analyse endogenous nSec1/Munc18a levels in post-nuclear supernatants from PC12 cells, as well as in HIT-T15 cells, a hamster insulin-secreting pancreatic cell line (Santerre et al., 1981), and adult rat brain for comparison (Fig. 2A). NSec1/Munc18a could be detected in both cell lines, but at much lower levels than in brain. Densitometric scanning of the ¢lms suggested a ratio of about 1:23 between the cell lines and brain. Equal loading of total protein amounts was veri¢ed by probing with an anti-actin antibody. For secretion assays, cells were transfected with nSec1myc and hGH. Overall transfection e⁄ciency of the nSec1/Munc18a cDNA cloned into the constitutive pcDNA3 plasmids was very low. Therefore, we applied the ecdysone-inducible system in these assays. Cells were triple transfections with hGH, pVgRXR (carrying the ecdysone receptor), and nSec1-myc at a DNA ratio of 1:2:2, which was necessary to ensure cotransfection of both hGH and nSec1-myc in most cells. Stimulated secretion was measured in the medium after potassium depolarisation and compared to non-stimulated cells (basal secretion). In PC12 cells, expression of nSec1/ Munc18a reduced regulated secretion by 34% compared to the cotransfection with vector alone (Fig. 2B). This decrease, obtained from three independent experiments, is statistically signi¢cant (P 6 0.03). Similar results were obtained in hGH-secretion experiments using HIT-T15 cells (Fig. 2C), and when nSec1-GFP was expressed instead of nSec1-myc in PC12 cells (data not shown). This suggests that in these two cell lines overexpression of nSec1/Munc18a decreases regulated secretion. Localisation of newly expressed nSec1/Munc18a in di¡erentiated PC12 cells To analyse whether nSec1/Munc18a is localised to growth cones of neurites in PC12 cells, we expressed it under the control of the ecdysone-inducible promoter in transient transfections. We investigated the localisation of nSec1-GFP by immuno£uorescence. After transfection, PC12 cells were di¡erentiated with NGF to induce neurite outgrowth during 7 days. Then the expression of nSec1/Munc18a was turned on (corresponds to 0 h) by the addition of the ecdysone-homologue ponasterone during a 6-h pulse, followed by addition of fresh medium. Cells were ¢xed after di¡erent incubation times and immunostained using an anti-GFP antibody

897

to visualise transfected nSec1/Munc18a (Fig. 3, left panel). Earliest appearance of nSec1/Munc18a was detected 10 h after addition of ponasterone in the perinuclear region. Labeling in the cell body did not yet reach the distal parts of the neurites which are visible on the adjacent phase contrast image (Fig. 3, right panel). After 12 h, labeling was more intense in the cell body with its highest level still in the Golgi region. A still faint labeling along neurites and in growth cones could already be observed. At 18 h nSec1-GFP started to be strong in growth cones, while labeling in neurites did not increase (Fig. 3). Thirty hours after induction the signal along neurites has almost disappeared. In contrast, growth cones are strongly labelled. At later times after induction labeling in the growth cones started to cease, while labeling of the cell body remained (not shown). These results show that exogenous nSec1/Munc18a is localised to growth cones of PC12 cells. Exogenous nSec1/Munc18a and Munc18b reduce total neurite length in PC12 cells Due to the localisation of newly expressed nSec1/ Munc18a in neurites and growth cones of PC12 cells, the protein might play a role in the establishment of neurites. Therefore, we analysed whether overexpression of nSec1/Munc18a and Munc18b has an e¡ect on the total length of neuritic processes after 2 days of NGF di¡erentiation. The presented data (Fig. 4A) are obtained in three experiments with a total of 1534 analysed cells (170 on average per transfection), examined by three independent observers. By visual inspection cells were grouped into the following morphological categories: (i) very short neurites ( 6 0.5 cell body diameter), (ii) neurites of intermediate length (0.5^1 cell body diameter), (iii) long neurites ( s 1 cell body diameter). In cells transfected with nSec1/Munc18a (Fig. 4A, dotted bars), we observed a signi¢cant decrease in the long neurite group (17.4% versus 43.7%, P 6 0.001), while the number of cells with short neurites increased (32.5 versus 17%, P 6 0.01) compared to GFP-transfected cells (black bars). To investigate further whether this inhibitory e¡ect of nSec1/Munc18a on neurite length could be mediated by its interaction with syntaxin 1, we used nSec1-T574Amyc which contains a point mutation at threonine 574. Phosphorylation of this site by cyclin-dependent-kinase 5 (cdk 5) inhibits interaction with syntaxin 1 (Fletcher et al., 1999). If the observed e¡ect by nSec1/Munc18a wt involves its interaction with syntaxin 1, transfection of the mutant should show a stronger inhibition. Indeed, we found that the reduction of total neurite length by nSec1T574A is even stronger than the one of the wt protein (Fig. 4A, grey bars). There are only 6.8% of cells with long neurites. This is a signi¢cant decrease compared to GFP-transfected cells (43.7%, P 6 0.001; black bars) or to cells transfected with nSec1-wt (17.4%, P 6 0.001; striped bars). The opposite was found for cells with very short neurites. This suggests that transfection of nSec1-T574A increased further the fraction of nSec1/ Munc18a complexed to syntaxin 1A, and indicates that this e¡ect implicated its binding to syntaxin 1.

NSC 5668 5-8-02

898

P. Steiner et al.

Fig. 3.

NSC 5668 5-8-02

nSec1/Munc18a in neurite formation

899

a¡ects neurite length, we performed four equivalent experiments as in Fig. 4A transfecting tagged nSec1/ Munc18a, Munc18b, Munc18c or GFP as control (Fig. 4B). As in the previous set of experiments, there were signi¢cantly fewer cells with long neurites ( s 1 cell body diameter) upon nSec1/Munc18a transfection (17.235) compared to control cells (46.8%; P 6 0.001). Transfection of Munc18b decreased neurite length with the same e⁄ciency as nSec1/Munc18a (16.57%; P 6 0.001; striped bars). We observed that all Munc18c-transfected PC12 cells became rounded after 2 days of NGF-di¡erentiation, and at 3^4 days detached from the coverslip (data not shown). Due to this general e¡ect, we abandoned a quantitative analysis of Munc18c. Localisation of newly expressed nSec1/Munc18a in hippocampal neurons

Fig. 4. NSec1/Munc18a or Munc18b expression decreases total neurite length in PC12 cells. (A) PC12 cells were cotransfected with GFP and either vector (black bars), or nSec1-myc wt (dotted bars), or nSec1-myc-T574A (grey bars). After di¡erentiation with NGF during 2 days to induce neurite outgrowth, cells were ¢xed and immunostained for SNAP-25. Transfected cells were visually examined and grouped into the indicated categories (qcb, cell body diameter). There are signi¢cantly less nSec1 wt-transfected cells than vector-transfected cells with neurites longer than three cell body diameter (P 6 0.001), while the opposite was observed for cells with neurites shorter than one cell body diameter (P 6 0.01). Neurite length is signi¢cantly further inhibited by the mutant nSec1-T574A (P 6 0.002 for s 1 cell body diameter and P 6 0.02 for 6 0.5 cell body diameter). The means from three independent experiments (with on average 170 cells analysed per transfection in each experiment) counted by three observers are shown. Double asterisks indicate signi¢cant di¡erences at P 6 0.01, and single asterisk at P 6 0.02 between vector and nSec1 wt, and nSec1 wt and T574A. (B) Experiment as in A, but on PC12 cells transfected with GFP (black bars), nSec1-myc wt (dotted bars) or Munc18b-EE (striped bars). There are signi¢cantly fewer cells with neurites s 1 cell body diameter upon transfection of nSec1/ Munc18a or Munc18b than in control cells (P 6 0.001). Error bars indicate S.E.M.

Munc18b and Munc18c, two homologues of nSec1/ Munc18a, have recently been cloned (Hata and Sudhof, 1995; Katagiri et al., 1995; Tellam et al., 1995). In order to test whether overexpression of these proteins also

Next we wanted to extend our analysis to primary neurons. We transfected hippocampal neurons after 1 day in culture with nSec1/Munc18a-myc under the control of the inducible ecdysone-promoter. Expression was induced 2 days later by a 6-h ponasterone pulse, and cells were immunolabelled at di¡erent times (0 h corresponds to addition of ponasterone). At 5 h nSec1/Munc18a appeared in the perinuclear region in the cell body in a punctated to tubular pattern (Fig. 5; middle and right row, with corresponding phase images on the left row). At 8 h the labeling started to enter the proximal shaft of a neurite, while at 12 h staining is visible all along processes. At 18 h, labeling is concentrated in the tips of neurites, and at 30 h (24 h after removal of ponasterone) overall labeling is strongly reduced. The labeling was not di¡use, but there were distinct punctated structures along the neurites, as visible on the enlarged areas in images on the right row at 12 and 18 h. These results suggested that exogenous nSec1/Munc18a is transported into neurites of primary dissociated neurons in culture, and that at least part of it is not cytosolic, but associated to organellar or cytoskeleton structures. Transfection of nSec1/Munc18a into primary neurons stimulates axonal branching In order to analyse whether exogenous expression of nSec1/Munc18a or Munc18b a¡ects the morphology of neuronal processes, we used transfection into primary hippocampal neurons. Cultures were transfected 3 h after plating with either nSec1/Munc18a, or Munc18b, or, as controls, GFP or AP. After 4 days neurons were ¢xed, immunolabelled, and morphometrically analysed using the NIH Object image software. The data from three independent experiments were cumulated. We

Fig. 3. Targeted localisation of nSec1-GFP in an inducible expression system in PC12 cells. Cells were transfected with pVgRxR and pIND-nSec1-GFP and di¡erentiated for 7 days in the presence of NGF. Expression was induced by the addition of 0.5 WM ponasterone during 6 h. Incubation was continued in fresh medium and cells were ¢xed at the indicated times (0 h corresponds to addition of ponasterone) and processed for immunocytochemistry using an anti-GFP antibody. Left row, nSec1-GFP ; right row, phase contrast images. Scale bar = 10 Wm.

NSC 5668 5-8-02

900

P. Steiner et al.

Fig. 5.

NSC 5668 5-8-02

nSec1/Munc18a in neurite formation

found that, in contrast to PC12 cells, the total length of primary processes and side branches per cell was signi¢cantly increased upon transfection of nSec1/Munc18a (Fig. 6A; dotted bar; n = 42; P 6 0.004) compared to GFP-transfected (black bar; n = 42; 1.6-fold) or APtransfected (grey bar; n = 32; 1.8-fold) cells. There was no signi¢cant di¡erence in the case of Munc18b (striped bar; n = 47). Next we asked whether the primary neurites or the side branches changed their length in nSec1/ Munc18a-transfected cells. Interestingly, tracing of all neuronal processes revealed that the average lengths of neither a primary neurite (Fig. 6B) nor a side branch (Fig. 6C) were di¡erent in GFP-, AP-, or nSec1/ Munc18a-transfected cells. This suggested that nSec1/ Munc18 overexpression rather acted on the number of processes than on their length. Therefore, we veri¢ed the number of primary neurites per cell (Fig. 6D) and the number of side branches per cell (Fig. 6E). While the number of primary neurites was unchanged, the number of branches was increased by a factor of about two in nSec1/Munc18a-transfected cells (Fig. 6E; P 6 0.002). These results indicated that increased levels of nSec1 enhanced sprouting of side branches in primary neuronal neurites. We then wondered whether this e¡ect is speci¢c to axons or dendrites, since immunolabelings with axonal (Tau, SNAP25) and dendritic microtubule-associated protein (MAP2) markers indicated that exogenous nSec1/Munc18a is targeted into both processes (data not shown). To do so, we selected the cells which possessed a single thin primary neurite on average 6.2 times longer (at least twice as long) than the second longest neurite (nSec1/Munc18a, n = 20; Munc18b, n = 16; GFP, n = 16; AP, n = 16). When the total length per cell of the axon was calculated (primary process and its branches), we detected again an about 1.7-fold increase in nSec1/ Munc18a-transfected neurons compared to controltransfected cells (GFP, P 6 0.03; AP, P 6 0.003), while Munc18b had no e¡ect (Fig. 7A). When comparing the average lengths of an axonal branch (Fig. 7B) and the number per cell of axonal branches Fig. 7C), we found no di¡erence in length, while the number of branches was 2.4-fold higher in nSec1/Munc18a-transfected neurons than in GFP-transfected neurons. There was no di¡erence in the total length of all the shorter, i.e. dendritic, processes in this group of neurons. Therefore, these results suggest that overexpression of nSec1/ Munc18a induces branching of axons in cultured hippocampal neurons.

901

Fig. 6. Exogenous nSec1/Munc18a stimulates branching of neurites in primary hippocampal neurons. Neurons were transfected 3 h after plating with GFP (black bars), AP (grey bars), Munc18b (striped bar) or nSec1/Munc18a (dotted bars), and immunostained 4 days later. Neurite morphology was analysed by the NIH Object image software on images of transfected cells (GFP, n = 42; AP, n = 32; Munc18b, n = 47; nSec1/Munc18a, n = 42). There was a signi¢cant increase between nSec1/Munc18a- and GFP-transfected cells for total neurite length (A) and the number of side branches (E), while number of neurites (D), and average neurite length (B) and side branch length (C) were not a¡ected. Double asterisks indicate signi¢cant di¡erences at P 6 0.004. Error bars indicate S.E.M.

Fig. 5. Targeted localisation of nSec1-myc in an inducible expression system in hippocampal neurons. One day old hippocampal neuron cultures were cotransfected with pVgRxR and pIND-nSec1-myc. Expression was induced 2 days later by ponasterone (0.5 WM) during 6 h. Cells were ¢xed and immunolabelled using an anti-myc antibody at the indicated times (B, E, H, K, N, enlargements of indicated areas are shown in C, F, I, L, O, respectively). Corresponding phase contrast images are shown on the left panel (A, D, G, J, M). 0 h corresponds to addition of ponasterone. Scale bar = 20 Wm.

NSC 5668 5-8-02

902

P. Steiner et al.

Fig. 7. nSec1/Munc18a transfection increases the number of axonal branches. Among the transfected cells presented in Fig. 6, the group of cells possessing a single axonal process at least 2 times longer (on average 6.2-fold) than the other neurites was selected, and this longest process was morphometrically analysed. Comparison between nSec1/Munc18a-transfected cell and control cells showed a signi¢cant increase in total axon length (A; P 6 0.03 for GFP, P 6 0.003 for AP) and the number of axonal branches (C; P 6 0.03 for GFP), while average length of axonal branches was not a¡ected (B). Error bars indicate SEM.

DISCUSSION

Application of clostridial toxins and anti-sense oligonucleotides have shown that the SNARE proteins syntaxin 1 and SNAP-25 are essential for axonal elongation (Ahnert-Hilger et al., 1996; Igarashi et al., 1996; OsenSand et al., 1993, 1996). We, therefore, tested whether nSec1/Munc18a, a syntaxin 1-binding protein which might regulate SNARE complex formation, could a¡ect neurite morphology. In the presented study, we demonstrated that overexpression of nSec1/Munc18a decreased total neurite length in PC12 cells, while in primary neurons the length of a given process is not altered, but the number of side branches is signi¢cantly increased. We also found that secretion in our PC12 cells was inhibited upon nSec1/Munc18a transfection. Using immuno£uorescence in combination with an inducible expression system in PC12 cells as well as in hippocampal neurons, we found that exogenous nSec1/Munc18a is transported into neurites on punctated structures, and that it becomes enriched in growth cones. We used nSec1/Munc18a constructs which have been tagged with either GFP or myc. In both cases the addition of the tag did not abolish the binding in vitro to syntaxin 1 suggesting that these fusion proteins are still

functional. We did not observe a speci¢c binding of nSec1/Munc18a to syntaxin 13, a syntaxin-isoform involved in the early endosomal recycling pathway (Hirling et al., 2000; Prekeris et al., 1998). This is noteworthy since nSec1/Munc18a also binds to syntaxin 2 and 3, but not syntaxin 4 (Pevsner et al., 1994a) which are also localised to the plasma membrane. In our experiments we ¢nd an inhibition of regulated secretion upon overexpression of nSec1/Munc18a in the neuroendocrine cell clone PC12 ES (Ip et al., 1993). Bourgoyne et al. did not ¢nd an e¡ect on stimulated secretion neither by the addition of bacterially expressed nSec1/Munc18a to permeabilised chroma⁄n cells and PC12 cells, nor in PC12 cells overexpressing nSec1/ Munc18a (Graham et al., 1997). An explanation for this apparent discrepancy could be that these authors used a PC12 clone which contains higher amounts of endogenous nSec1/Munc18a. Graham et al. (1997) indicate that chroma⁄n cells have about four-fold lower amounts of nSec1/Munc18a than brain, while semi-quantitative analysis by scanning of our western blot experiments (see Fig. 3) suggests that the cell lines in our study express nSec1/Munc18a at levels at least 20 times lower than in total brain extracts. Detecting an inhibitory e¡ect on regulated exocytosis only in cells with low endogenous nSec1/Munc18a levels is in agreement with a recent report in Drosophila (Wu et al., 1998). In di¡erent transgenic £ies overexpressing the Drosophila Sec1-homologue rop, inhibition of neurotransmitter secretion depended strictly on the level of transgenic expression of rop. Moreover, microinjection of the squid homologue of nSec1/Munc18a into the squid giant synapse inhibited evoked neurotransmitter release (Dresbach et al., 1998). In agreement with a negative role of nSec1/Munc18a in regulated exocytosis, addition of a nSec1/Munc18a peptide or anti-nSec1 anti-serum to permeabilised pancreatic HIT-T15 L-cells increased insulin secretion (Zhang et al., 2000). Following the time-course of nSec1/Munc18a localisation in NGF-di¡erentiated PC12 cells and hippocampal neurons after induction of expression, we detected the protein ¢rst in the perinuclear region, and at later times in neurites and in growth cones. This localisation could be either passive di¡usion of the exogenous, hydrophilic nSec1/Munc18a, or it represents a directed transport into neurites and growth cones, possibly in a complex with other proteins. In yeast it has recently been shown that Sec1p is targeted to sites of vesicle fusion on the plasma membrane (Carr et al., 1999). In addition, when exogenous syntaxin 1 is expressed in a secretionde¢cient PC12 cell clone which contains no detectable syntaxin 1, the protein becomes mislocalised, while cotransfection of nSec1/Munc18a restores correct targeting of syntaxin 1 through the Golgi complex and to the plasma membrane (Rowe et al., 1999). A recent report proposes a similar targeting for SNAP-25 complexed to syntaxin 1 to its ¢nal destination on the plasma membrane (Vogel et al., 2000). Our localisation data revealed a rather distinct tubular/vesicular pattern of nSec1/ Munc18a at early times after induction in the cell body as well as at later times in neurites and in growth cones.

NSC 5668 5-8-02

nSec1/Munc18a in neurite formation

This speaks in favour of nSec1/Munc18a being complexed to other protein or membranous structures which are speci¢cally targeted into neurites. The observed e¡ect on total neurite length in PC12 cells implicates most likely an interaction between the exogenously expressed nSec1/Munc18a and syntaxin 1, since we found a stronger inhibitory e¡ect with the mutant T574A. It has been reported that a portion of nSec1/ Munc18a is present in situ as a phospho-protein (Shuang et al., 1998) and that it can be phosphorylated by protein kinase C (Fujita et al., 1996) as well as cdk5 on threonine 574 (Fletcher et al., 1999; Shuang et al., 1998), both leading to a decrease in syntaxin 1 binding. Therefore, transfection of the mutant T574A should produce an unphosphorylated form of nSec1/Munc18a with increased capacity to bind to syntaxin 1. We found that this mutant inhibits stronger total neurite length compared to the wt protein which presumably becomes partially phosphorylated as shown for endogenous nSec1/ Munc18a (Shuang et al., 1998). An attempt to get a reverse e¡ect with a mutant nSec1-T574D was not successful since this mutant still bound e⁄ciently to nSec1/ Munc18a (data not shown). In contrast to PC12 cells, nSec1/Munc18a overexpression increased total neurite length in primary neurons, due to an augmented number of side branches. These di¡erences might be related to di¡erent levels of overexpression as well as to di¡erent levels of putative binding partners in PC12 cells and primary neurons. Depending on the studied system and species, positive or negative roles of the nSec1/Munc18a homologues in vesicle fusion have been postulated (Halachmi and Lev, 1996; Pevsner, 1996). Analysis of the crystal structure of nSec1 bound to syntaxin 1 suggested at the same time a negative role in SNARE complex formation due to inhibition of SNAP25 and VAMP2 binding at steady state, and a positive ‘chaperon’-like role for SNARE complex formation during stimulation (Misura et al., 2000). It might be that depending on the system, overexpression strengthens one or the other role of nSec1/Munc18a. Given the low transfection e⁄ciency of both PC12 cells and primary neurons ( 6 10%) quanti¢cation of overexpression per cell was not possible. In any case, these results underline that, in general, studies on neurite formation in cell lines cannot always be directly extrapolated to primary neurons. Enhanced branching upon nSec1/Munc18a transfection suggests that elevated levels of this protein favour directly or indirectly membrane fusion events which are necessary for new membrane addition at potential branch points. It has been reported that inhibition of syntaxin 1 by either anti-sense oligonucleotides or antibody injection induced axonal sprouting in primary neurons (Yamaguchi et al., 1996). Interestingly, overexpression of nSec1 in hippocampal neurons in our study resulted in a similar e¡ect, suggesting that elevated levels of nSec1/Munc18a exert an inhibitory e¡ect on syntaxin 1 function.

903

Developmental analysis showed that the nSec1/ Munc18a mRNA as well as the protein is already expressed at late embryonic stages, and increases strongly at around postnatal day 7 (Pevsner et al., 1994b; Veeranna et al., 1997). In nSec1/Munc18a-knockout (KO) mice neurotransmission is completely abolished leading to the death of these animals at birth (Verhage et al., 2000). When comparing brains at birth from these KO mice with wt mice, the authors did not detect any morphological defects, which indicates that nSec1/ Munc18a is not essential for correct brain development until birth. Our results in primary neurons are in agreement with the notion that nsec1/Munc18a is dispensable for axon and dendrite elongation which mainly take place in embryonic development. In contrast, the e¡ect on axon rami¢cation which we observed here, is a rather subtle event, occurring in many brain regions during postnatal development. We found here that Munc18b also decreased total neurite length in PC12 cells, while its transfection into primary neurons had no signi¢cant e¡ect. Although this isoform is only weakly, but detectably, expressed in adult brain (Hata and Sudhof, 1995; Katagiri et al., 1995), it might not be involved in the same membrane fusion events as nSec1/Munc18a during neurite formation in neurons. Unfortunately, analysis of Munc18c, which mainly binds to syntaxin 2 and 4, but not to syntaxin 1 (Tamori et al., 1998), was not possible due to cell death following its transfection. The e¡ect of nSec1/Munc18a wt and, to a stronger extent, of nSec1-T574A, underline a role of syntaxin 1, during development. Previous studies have shown growth cone collapse of neurites in primary neurons when cells are treated with botulinum toxin C which cleaves syntaxin 1 and SNAP-25 (Igarashi et al., 1996; Osen-Sand et al., 1996). Also, neurite elongation was inhibited upon introduction of peptides corresponding to syntaxin 1 (Igarashi et al., 1996). This implicates syntaxin 1 in the process of neurite elongation. A role of syntaxin in neurite formation is also supported by a study on the Drosophila syntaxin 1, which is essential at developmental events as early as cellularisation, a process in which the blastodermal nuclei are separated by new membranes into individual cells (Burgess et al., 1997). This is consistent with the hypothesis that membrane fusion events in membrane expansion and neurotransmitter release share common proteins (Catsicas et al., 1994). Taken together, our ¢ndings suggest that nSec1/Munc18a in growth cones is involved in the regulation of SNARE-dependent vesicle fusion for membrane expansion during neurite formation.

Acknowledgements3We thank Liliane Glauser and Sarah Magnin for technical help with neurite morphology and secretion analysis. This work was supported by grants No. 31-52587.97 from the Swiss National Science Foundation and BMH4-951406 from EEC.

NSC 5668 5-8-02

904

P. Steiner et al. REFERENCES

Aalto, M.K., Ruohonen, L., Hosono, K., Keranen, S., 1991. Cloning and sequencing of the yeast Saccharomyces cerevisiae SEC1 gene localised on chromosome IV. Yeast 7, 643^650. Ahnert-Hilger, G., Kutay, U., Chahoud, I., Rapoport, T., Wiedenmann, B., 1996. Synaptobrevin is essential for secretion but not for the development of synaptic processes. Eur. J. Cell Biol. 70, 1^11. Bennett, M.K., Calakos, N., Kreiner, T., Scheller, R.H., 1992. Synaptic vesicle membrane proteins interact to form a multimeric complex. J. Cell Biol. 116, 761^775. Burgess, R., Deitcher, D., Schwarz, T., 1997. The synaptic protein syntaxin 1 is required for cellularization of Drosophila embryos. J. Cell Biol. 138, 861^875. Carr, C.M., Grote, E., Munson, M., Hughson, F.M., Novick, P.J., 1999. Sec1p binds to SNARE complexes and concentrates at sites of secretion. J. Cell Biol. 146, 333^344. Catsicas, S., Grenningloh, G., Pich, E.M., 1994. Nerve-terminal proteins : to fuse to learn. Trends Neurosci. 17, 368^373. Cubitt, A.B., Heim, R., Adams, S.R., Boyd, A.E., Gross, L.A., Tsien, R.Y., 1995. Understanding, improving and using green £uorescent proteins. Trends Biochem. Sci. 20, 448^455. Dresbach, T., Burns, M.E., O’Connor, V., DeBello, W.M., Betz, H., Augustine, G.J., 1998. A neuronal Sec1 homolog regulates neurotransmitter release at the squid giant synapse. J. Neurosci. 18, 2923^2932. Dulubova, I., Sugita, S., Hill, S., Hosaka, M., Fernandez, I., Sudhof, T.C., Rizo, J., 1999. A conformational switch in syntaxin during exocytosis : role of munc18. EMBO J. 18, 4372^4382. Fletcher, A.I., Shuang, R., Giovannucci, D.R., Zhang, L., Bittner, M.A., Stuenkel, E.L., 1999. Regulation of exocytosis by cyclin-dependent kinase 5 via phosphorylation of Munc18. J. Biol. Chem. 274, 4027^4035. Fujita, Y., Sasaki, T., Fukui, K., Kotani, H., Kimura, T., Hata, Y., Sudhof, T.C., Scheller, R.H., Takai, Y., 1996. Phosphorylation of Munc-18/nSec1/rbSec1 by protein kinase C: its implication in regulating the interaction of Munc-18/n-Sec1/rbSec1 with syntaxin. J. Biol. Chem. 271, 7265^7268. Garcia, E.P., Gatti, E., Butler, M., Burton, J., DeCamilli, P., 1994. A rat brain Sec1 homologue related to Rop and UNC18 interacts with syntaxin. Proc. Natl. Acad. Sci. USA 91, 2003^2007. Graham, M.E., Sudlow, A.W., Burgoyne, R.D., 1997. Evidence against an acute inhibitory role of nSec-1 (munc-18) in late steps of regulated exocytosis in chroma⁄n and PC12 cells. J. Neurochem. 69, 2369^2377. Grussenmeyer, T., Scheidtmann, K.H., Hutchinson, M.A., Eckhart, W., Walter, G., 1985. Complexes of polyoma virus medium T antigen and cellular proteins. Proc. Natl. Acad. Sci. USA 82, 7952^7954. Halachmi, N., Lev, Z., 1996. The Sec1 family : a novel family of proteins involved in synaptic transmission and general secretion. J. Neurochem. 66, 889^897. Hata, Y., Slaughter, C.A., Sudhof, T.C., 1993. Synaptic vesicle fusion complex contains unc-18 homologue bound to syntaxin. Nature 366, 347^ 351. Hata, Y., Sudhof, T.C., 1995. A novel ubiquitous form of Munc-18 interacts with multiple syntaxins. Use of the yeast two-hybrid system to study interactions between proteins involved in membrane tra⁄c. J. Biol. Chem. 270, 13022^13028. Hirling, H., Steiner, P., Chaperon, C., Marsault, R., Regazzi, R., Catsicas, S., 2000. Syntaxin 13 is a developmentally regulated SNARE involved in neurite outgrowth and endosomal tra⁄cking. Eur. J. Neurosci. 12, 1913^1923. Hodel, A., Schafer, T., Gerosa, D., Burger, M.M., 1994. In chroma⁄n cells, the mammalian Sec1p homologue is a syntaxin 1A-binding protein associated with chroma⁄n granules. J. Biol. Chem. 269, 8623^8626. Holz, R.W., Brondyk, W.H., Senter, R.A., Kuizon, L., Macara, I.G., 1994. Evidence for the involvement of Rab3A in Ca(2+)-dependent exocytosis from adrenal chroma⁄n cells. J. Biol. Chem. 269, 10229^10234. Hosono, R., Hekimi, S., Kamiya, Y., Sassa, T., Murakami, S., Nishiwaki, K., Miwa, J., Taketo, A., Kodaira, K.I., 1992. The unc-18 gene encodes a novel protein a¡ecting the kinetics of acetylcholine metabolism in the nematode Caenorhabditis elegans. J. Neurochem. 58, 1517^1525. Igarashi, M., Kozaki, S., Terakawa, S., Kawano, S., Ide, C., Komiya, Y., 1996. Growth cone collapse and inhibition of neurite growth by Botulinum neurotoxin C1: a t-SNARE is involved in axonal growth. J. Cell Biol. 134, 205^215. Igarashi, M., Tagaya, M., Komiya, Y., 1997. The soluble N-ethylmaleimide-sensitive factor attached protein receptor complex in growth cones : molecular aspects of the axon terminal development. J. Neurosci. 17, 1460^1470. Ip, N.Y., Stitt, T.N., Tapley, P., Klein, R., Glass, D.J., Fandl, J., Greene, L.A., Barbacid, M., Yancopoulos, G.D., 1993. Similarities and di¡erences in the way neurotrophins interact with the Trk receptors in neuronal and nonneuronal cells. Neuron 10, 137^149. Jahn, R., Sudhof, T.C., 1999. Membrane fusion and exocytosis. Ann. Rev. Biochem. 68, 863^911. Katagiri, H., Terasaki, J., Murata, T., Ishihara, H., Ogihara, T., Inukai, K., Fukushima, Y., Anai, M., Kikuchi, M., Miyazaki, J., Yoshio, Y., Yoshitomo, O., 1995. A novel isoform of syntaxin-binding protein homologous to yeast Sec1 expressed ubiquitously in mammalian cells. J. Biol. Chem. 270, 4963^4966. Misura, K.M.S., Scheller, R.H., Weis, W.I., 2000. Three-dimensional structure of the neuronal-Sec1^syntaxin 1a complex. Nature 404, 355^362. Novick, P., Field, C., Schekman, R., 1980. Identi¢cation of 23 complementation groups required for post-translational events in the yeast secretory pathway. Cell 21, 205^215. Okamoto, M., Sudhof, T.C., 1997. Mints, Munc18-interacting proteins in synaptic vesicle exocytosis. J. Biol. Chem. 272, 31459^31464. Osen-Sand, A., Catsicas, M., Staple, J.K., Jones, K.A., Ayala, G., Knowles, J., Grenningloh, G., Catsicas, S., 1993. Inhibition of axonal growth by SNAP-25 antisense oligonucleotides in vitro and in vivo. Nature 364, 445^448. Osen-Sand, A., Staple, J.K., Naldi, E., Schiavo, G., Rossetto, O., Petitpierre, S., Malgaroli, A., Montecucco, C., Catsicas, S., 1996. Common and distinct fusion proteins in axonal growth and transmitter release. J. Comp. Neurol. 367, 222^234. Pevsner, J., 1996. The role of Sec1p-related proteins in vesicle tra⁄cking in the nerve terminal. J. Neurosci. Res. 45, 89^95. Pevsner, J., Hsu, S.C., Braun, J.E., Calakos, N., Ting, A.E., Bennett, M.K., Scheller, R.H., 1994a. Speci¢city and regulation of a synaptic vesicle docking complex. Neuron 13, 353^361. Pevsner, J., Hsu, S.C., Scheller, R.H., 1994b. n-Sec1: a neural-speci¢c syntaxin-binding protein. Proc. Natl. Acad. Sci. USA 91, 1445^1449. Prekeris, R., Klumperman, J., Chen, Y.A., Scheller, R.H., 1998. Syntaxin 13 mediates cycling of plasma membrane proteins via tubulovesicular recycling endosomes. J. Cell Biol. 143, 957^971. Rowe, J., Corradi, N., Malosio, M.L., Taverna, E., Halban, P., Meldolesi, J., Rosa, P., 1999. Blockade of membrane transport and disassembly of the Golgi complex by expression of syntaxin 1A in neurosecretion-incompetent cells: prevention by rbSEC1. J. Cell Sci. 112, 1865^1877. Santerre, R.F., Cook, R.A., Crisel, R.M., Sharp, J.D., Schmidt, R.J., Williams, D.C., Wilson, C.P., 1981. Insulin synthesis in a clonal cell line of simian virus 40-transformed hamster pancreatic L cells. Proc. Natl. Acad. Sci. USA 78, 4339^4343. Scheller, R.H., 1995. Membrane tra⁄cking in the presynaptic nerve terminal. Neuron 14, 893^897.

NSC 5668 5-8-02

nSec1/Munc18a in neurite formation

905

Schulze, K.L., Littleton, J.T., Salzberg, A., Halachmi, N., Stern, M., Lev, Z., Bellen, H.J., 1994. rop, a Drosophila homolog of yeast Sec1 and vertebrate n-Sec1/Munc-18 proteins, is a negative regulator of neurotransmitter release in vivo. Neuron 13, 1099^1108. Shuang, R., Zhang, L., Fletcher, A., Groblewski, G.E., Pevsner, J., Stuenkel, E.L., 1998. Regulation of Munc-18/syntaxin 1A interaction by cyclindependent kinase 5 in nerve endings. J. Biol. Chem. 273, 4957^4966. Sollner, T., Whiteheart, S.W., Brunner, M., Erdjument-Bromage, H., Geromanos, S., Tempst, P., Rothman, J.E., 1993. SNAP receptors implicated in vesicle targeting and fusion. Nature 362, 318^324. Y Sutton, R.B., Fasshauer, D., Jahn, R., Brunger, A.T., 1998. Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4 A resolution. Nature 395, 347^353. Tamori, Y., Kawanishi, M., Niki, T., Shinoda, H., Araki, S., Okazawa, H., Kasuga, M., 1998. Inhibition of insulin-induced GLUT4 translocation by Munc18c through interaction with syntaxin4 in 3T3-L1 adipocytes. J. Biol. Chem. 273, 19740^19746. Tellam, J.T., McIntosh, S., James, D.E., 1995. Molecular identi¢cation of two novel Munc-18 isoforms expressed in non-neuronal tissues. J. Biol. Chem. 270, 5857^5863. Veeranna, Grant, P., Pant, H.C., 1997. Expression of p67 (Munc-18), Cdk5, P-NFH and syntaxin during development of the rat cerebellum. Dev. Neurosci. 19, 172^183. Verhage, M., de Vries, K.J., Roshol, H., Burbach, J.P., Gispen, W.H., Sudhof, T.C., 1997. DOC2 proteins in rat brain: complementary distribution and proposed function as vesicular adapter proteins in early stages of secretion. Neuron 18, 453^461. Verhage, M., Maia, A.S., Plomp, J.J., Brussaard, A.B., Heeroma, J.H., Vermeer, H., Toonen, R.F., Hammer, R.E., van den Berg, T.K., Missler, M., Geuze, H.J., Sudhof, T.C., 2000. Synaptic assembly of the brain in the absence of neurotransmitter secretion. Science 287, 864^869. Vogel, K., Cabaniols, J.P., Roche, P.A., 2000. Targeting of SNAP-25 to membranes is mediated by its association with the target SNARE syntaxin. J. Biol. Chem. 275, 2959^2965. Wu, M.N., Littleton, J.T., Bhat, M.A., Prokop, A., Bellen, H.J., 1998. rop, the Drosophila Sec1 homolog, interacts with syntaxin and regulates neurotransmitter release in a dosage-dependent manner. EMBO J. 17, 127^139. Xia, Z., Dudek, H., Miranti, C.K., Greenberg, M.E., 1996. Calcium in£ux via the NMDA receptor induces immediate early gene transcription by a MAP kinase/ERK-dependent mechanism. J. Neurosci. 16, 5425^5436. Yamaguchi, K., Nakayama, T., Fujiwara, T., Akagawa, K., 1996. Enhancement of neurite-sprouting by suppression of HPC-1/syntaxin 1A activity in cultured vertebrate nerve cells. Brain Res. 740, 185^192. Yang, B., Steegmaier, M., Gonzalez, L.C., Jr., Scheller, R.H., 2000. nSec1 binds a closed conformation of syntaxin 1A. J. Cell Biol. 148, 247^252. Zhang, W., Efanov, A., Yang, S.N., Fried, G., Kolare, S., Brown, H., Zaitsev, S., Berggren, P.O., Meister, B., 2000. Munc-18 associates with syntaxin and serves as a negative regulator of exocytosis in the pancreatic L-cell. J. Biol. Chem. 275, 41521^41527. Zhou, Q., Xiao, J.N., Liu, Y.C., 2000. Participation of syntaxin 1A in membrane tra⁄cking involving neurite elongation and membrane expansion. J. Neurosci. Res. 61, 321^328. (Accepted 28 March 2002)

NSC 5668 5-8-02