Overexpression of serotonin receptor and transporter mRNA in blood leukocytes of antipsychotic-free and antipsychotic-naïve schizophrenic patients: Gender differences

Schizophrenia Research 121 (2010) 160–171

Contents lists available at ScienceDirect

Schizophrenia Research j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / s c h r e s

Overexpression of serotonin receptor and transporter mRNA in blood leukocytes of antipsychotic-free and antipsychotic-naïve schizophrenic patients: Gender differences Gang Wang a,1, Changqing Hu a,1, Tao Jiang a, Jiong Luo a, Jian Hu b, Sihai Ling a, Min Liu a, Guoqiang Xing a,⁎ a b

Department of General Psychiatry, Beijing Anding Hospital, Capital University of Medical Sciences, Beijing 100088, China The First Clinical College of Harbin Medical University, Harbin 150001, China

a r t i c l e

i n f o

Article history: Received 1 November 2009 Accepted 29 March 2010 Available online 7 May 2010 Keywords: Serotonin receptor and transporter mRNA Drug-free schizophrenia Leukocytes

a b s t r a c t Background: Abnormal serotonin (5-HT) activity has been implicated in schizophrenia. However, the role of 5-HT receptors and transporter (5-HTT) in male and female schizophrenia remains largely unknown. Recent studies suggest that 5-HT system expressed in the peripheral leukocyte could be a marker of the illness. Methods: 46 acute schizophrenic patients (male=35, female=11) that were antipsychoticnaïve or antipsychotic-free for at least three months (average=27.3 months) and 44 age- and sex-matched healthy subjects (male=24, female=20) were included for blood leukocytes expression of 5-HT1A, 5-HT2A and 5-HT7 receptor and 5-HTT mRNA, using real-time PCR technique. Results: ANOVA analysis showed a significant increase of 5HT2A mRNA and 5-HTT mRNA (each N 2fold, P b 0.01) and a trend increase of 5HT1A mRNA (P b 0.15) and 5-HT7 mRNA (P b 0.09) level in blood leukocytes of pooled schizophrenic patients than in the healthy subjects. The elevation was mainly found in the male patients. Within-sex analysis showed that the male antipsychotic-free schizophrenic patients exhibited greater 5-HT1A and 5-HT7 mRNA expression (Pb0.05, each ) whereas female antipsychotic-free patients showed decreased 5-HT1A mRNA expression (Pb0.05) when compared with the male and female healthy subjects, respectively. The correlations between 5-HT mRNA and clinical symptoms (PANSS scales) were calculated. Conclusions: The present findings showed an abnormal expression of leukocyte 5-HT system in antipsychotic-free and antipsychotic-naïve schizophrenia especially in the male patients. Because of the greater accumulative dose of antipsychotics in the relatively smaller number of the female patients of the study, further study is needed to confirm the present findings. If replicated, blood serotonergic markers could add to the diagnosis and individualized pharmacotherapy of schizophrenic patients, especially the male patients. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Schizophrenia is a severe mental disorder with a gender difference in illness onset and outcome (Faraone et al., 1994; Riecher-Rossler and Hafner, 2000; Takahashi et al., 2000). The ⁎ Corresponding author. Tel.: + 1 301 295 1581; fax: + 1 301 295 1536. E-mail address: [email protected] (G. Xing). 1 These authors contributed equally to this work. 0920-9964/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.schres.2010.03.030

mechanism remains unknown. Abnormal serotonin (5-HT) activity, blunted central 5-HT response to 5-HT-depletingagent, and altered density or expression of 5-HT receptors and transporters (5-HTT) has been implicated in schizophrenia. Yet, inconsistent results exist in the literature regarding brain 5-HT receptors in schizophrenia. 5-HT2A receptor activation mediates the actions of most psychedelic hallucinogens that can be completely blocked by low-dose of high-affinity 5-HT2A antagonists (atypical

G. Wang et al. / Schizophrenia Research 121 (2010) 160–171

antipsychotics) (Vollenweider et al., 1998). However, imaging studies revealed no change in brain 5-HT2A receptor in drug-naïve schizophrenic patients (Lewis et al., 1999) whereas other studies showed either significantly increased 5-HT2A receptors in the nucleus accumbens and ventral putamen (Joyce et al., 1993), or decreased 5-HT2A receptors in the prefrontal cortex of schizophrenics (Dean and Hayes, 1996; Laruelle et al., 1993). Recent studies indicate a potential role of 5-HT7 receptors in schizophrenia. Several classes of drugs including typical and atypical antipsychotics have relatively high affinity for the 5-HT7 receptors (Roth et al., 1994; Shen et al., 1993). The atypical antipsychotic clozapine has higher affinity for the 5-HT7 receptor than for the dopamine D2 receptor previously believed to be the main receptor involved in the mediation of antipsychotic effects (Roth et al., 1994). Interestingly, clozapine restored neuronal function by upregulating 5-HT7 receptor expression in cell lines (Zhukovskaya and Neumaier, 2000). A single nucleotide polymorphism in the 5-HT7 receptor gene is also reported in schizophrenia (Ikeda et al., 2006). So far it is not known if 5-HT7 receptor expression is altered in blood leukocytes of schizophrenia. 5-HTT-mediated 5-HT activity is also implicated in schizophrenic pathoetiology. 5-HTT regulates synaptic 5-HT concentration and activity by recycling free synaptic/extracellular 5-HT back to neurotransmitter pool. Again, mixed 5-HTT results exist in schizophrenia. Decreased density of 5-HTT in the prefrontal cortex, cingulated cortex, hippocampus and in other brain regions of schizophrenic patients has been reported by some (Joyce et al., 1993; Laruelle et al., 1993; Naylor et al., 1996) but not all studies (Gurevich and Joyce, 1997). One recent postmortem study showed a 4-fold increase of 5-HTT mRNA in the prefrontal Brodmann's area 9 but 2-fold reduction in Brodmann's areas 21 and 22 of schizophrenic patients (Hernandez and Sokolov, 1997). These alterations were most prominent in antipsychotic-treated patients, suggesting a potent and divergent effect of antipsychotic on 5-HTT expression in different brain regions. Abnormality in different 5-HT receptor subtypes has also been found in schizophrenia. Both decreased 5-HT1A binding in the amygdala of antipsychotic-naïve schizophrenic patients (Yasuno et al., 2004) and increased 5-HT1A receptor binding in the prefrontal and temporal cortex of schizophrenic patients with and without antipsychotic therapy were reported (Sumiyoshi et al., 1996). Because the potential confounding effects of antipsychotic treatment, sex, age, sample size, and comorbidity with other disorders in postmortem brain studies, platelet and leukocytes 5-HT system have been studied in schizophrenia as a model of the central 5-HT system. Blood leukocytes are preferred cellular model of central serotonin neurons due to their similar genetic and biochemical characteristics. As nucleated cells, change in 5-HT receptor and transporter gene expression and activity in blood leukocytes can be easily detected. Indeed, increased leukocyte 5-HTT binding sites have been reported in male schizophrenic patients (Barkan et al., 2006a,b). To our best knowledge, so far no other study has reported 5-HT2A and 5-HTT mRNA expression in blood leukocytes of antipsychoticfree and antipsychotic-naïve male and female patients. We determined serotonin receptor subtype 5-HT1A, 5-HT2A, and 5-HT7 and serotonin transporter 5-HTT mRNA expression

161

in blood leukocytes of antipsychotic-free and antipsychoticnaïve schizophrenic patients and in age- and sex-matched healthy subjects. 5-HT2A and 5-HTT mRNA expression was found significantly elevated in blood leukocytes of overall schizophrenic patients. 2. Subjects and methods Forty-six (35 male and 11 female) antipsychotic-free and antipsychotic-naïve DSM-IV schizophrenic patients at their first-admission at the Anding Hospital, Beijing Capital Medical University and 44 age- and gender-matched healthy subjects from employees, medical students and staff of Anding Mental Health Hospital were recruited for the study. All schizophrenic diagnosis was confirmed by two senior psychiatrists, according to the guidelines of the Structured Clinical Interview for DSM-IV Axis I Disorders (SCIDP). The diagnosis of schizophrenia was established according to the DSM-IV-TR criteria. The severity of schizophrenia was assessed by the Positive and Negative Syndromes Scales (PANSS) and data from the Positive (PANSS-P), Negative (PANSS-N) and General Psychopathology (PANSS-GP) subscales and global PANSS scales were recorded. Exclusion criteria for both the patients and the controls were acute and chronic symptoms of clinical and neurological disorders, substance abuse in the previous 3 months, antipsychotic and SSRI treatment 12 weeks prior to the study and recent medical history. The study was approved by the Human Study Review Board of Anding Hospital and informed consent was obtained from all participants or their legal guardians after the nature of the study was fully explained to them. 2.1. White blood cell RNA and quantitative real-time PCR Venous blood sample was collected into EDTA-blood collecting tube. Total RNA of mononucleus blood leukocytes was extracted immediately using the QIAamp RNA Blood Mini kit (Qiagen, Germany) and stored at −80 °C. Reverse transcription and real-time PCR was performed after all samples were collected as reported (Xing et al., 2008). In brief, 1 µg of total RNA was reverse transcribed into firststrand cDNA using the Enhanced Avian HS reverse transcriptase kit (Sigma, MO, USA). cDNA of 100 ng reverse transcribed total RNA was used as the template for quantitative real-time PCR reaction with a final PCR reaction volume of 25 µl, with the 5′ and 3′ gene specific PCR primer's final concentrations at 100 nM each. Specific PCR 5′ forward primers and reverse primers for human 5-HT1A (GenBank# NM_000524) (5′CTGCTCATGCTGGTTCTCTATG, 3′-TCTCCATTCACACTCTTCTTGG), 5-HT2A (GenBank# NM_000621) (5′-CTGAAAATCGAACCAACCTTTC, 3′-CTGCCATGATGACGAGTATGTT), 5-HT7 (GenBank# (NM_000872) 5′-CTCCATCACCTTACCTCCACTC, 3′-ATGCCACTGCGGTAGAGTAAAT) and 5-HTT (GenBank# (NM_001054) 5′-GTGGTGAACTGCATGACGAG, 3′GGCCACCTCAGACACATCTT) ranging between 90 and 150 bases for amplified cDNA were designed according to the coding sequences of each human genes using the Primer3 software (Whitehead Institute, MIT, Cambridge, MA). Quantification of mRNA expression was performed in triplicate using 2 × SYBR Green Master Mix (Applied Biosystems, CA) and a 2-step PCR reaction procedure, performed on a 7000

162

G. Wang et al. / Schizophrenia Research 121 (2010) 160–171

Real-Time PCR System (Applied Biosystems, CA). In brief, after the initial denaturation at 95 °C for 10 min, 40 cycles of primer annealing and elongation were conducted at 60 °C for 45 s, followed by denaturation at 95 °C for 15 s. Fluorescent emission data were captured, and mRNA levels were quantified using the threshold cycle value (Ct). The specificity of each gene expression was confirmed by the single melting curve peak and by the gel analysis of the PCR products. To compensate for variations in input RNA amount and efficiency of reverse transcription, data for 5-HT1A, 5-HT2A, 5-HT7 and 5-HTT mRNA of each sample were normalized by reference to the data obtained for the house-keeping gene hypoxanthine phosphoribosyltransferase (HPRT) (GenBank accession no. X62085) determined from the same sample. Fold change in mRNA expression was calculated using the equation: fold change = 2− ΔΔCt, where ΔCt= target gene Ct− house-keeping gene Ct, and ΔΔCt is ΔCt control − ΔCt schizophrenia (or fold change) = 2^(ΔCT control − ΔCT schizophrenia). 2.2. Statistical analysis The effects of schizophrenia and gender on blood leukocyte 5-HT gene expression were analyzed using two-way ANOVA. Because no significant effects of gender and gender × schizophrenia interaction were found in the 5-HT receptor and transporter mRNA expression, the pooled male and female data was further analyzed using one-way ANOVA. The effect of schizophrenic illness on 5-HT mRNA within antipsychotic-free and antipsychotic-naïve schizophrenic subjects and within each gender group was also analyzed using one-way ANOVA, respectively. The reason for separate analysis of the antipsychotic-free and antipsychotic-naïve groups was based on the previous reports that antipsychotic therapy could normalize platelet 5-HT2A and 5-HTT in schizophrenia subjects (Govitrapong et al., 2000, 2002). Because our clinical data showed that the antipsychotic-free male and female patients differed significantly in the accumulative dose of antipsychotics from prior treatment, a gender difference in the leukocyte 5-HT system could be potentially induced by the different antipsychotic dose between the antipsychotic-free male and female patients but not between antipsychotic-naïve male and female patients. Pearson correlation (2-tailed) between leukocyte 5HT mRNA expression, and between 5-HT mRNA and cumulative antipsychotic dosage of previous treatment and PANSS subscales was calculated for pooled schizophrenic patients and for patients within each gender group. Results are expressed as mean± s.e. A difference with P-value less than 0.05 was considered statistically significant. 3. Results 3.1. Patients' clinical data The demographic and clinical characteristics of the patient population were shown in Table 2. The patients did not differ from the healthy subjects in age (33.9 vs. 31.6 years) as revealed by 1-way ANOVA analysis. On average, all schizophrenic patients had a history of the illness for 8.5 years and were antipsychotic free for 27.3 ± 7.0 months (Mean ± s.e.) (Table 1) before entering the study. Of the 46 schizophrenic patients, 8 male and 2 female patients were considered

antipsychotic-naïve because they never received or only received very limited dose of antipsychotics (b20 mg, Risperidone equivalent) (Kane et al., 2003) more than 5 years ago prior to the study. No significant differences in daily sleep hours, total PANSS, PANSS-P, PANSS-N, and PANSS-GP scales were found between the male and female schizophrenic patients (Table 1). The female patients, however, showed a relative late onset of schizophrenia than the male patients (27.5 ± 3.1 vs. 24.7 ± 1.4 years, P N 0.05), a significantly greater dose of cumulative antipsychotic (9902 vs. 1989 mg risperidone equivalent, P b 0.05) and a longer period of drug treatment (67.5 vs. 13.7 months, P b 0.05) than the male patients. The male patients, however, had significantly greater antipsychotic-free months (28.3 ± 8.4) before entering the study than the female patients (23.7 ± 12.5) (P b 0.05). 3.2. 5-HT receptor subtype and transporter mRNA in pooled patients Two-way ANOVA analysis showed that schizophrenia, but not gender, had a significant effect on the 5-HT system. All data were further analyzed using 1-way ANOVA as reported. There was a significant increase of 5HT2A mRNA (P b 0.01) and 5-HTT mRNA (P b 0.01) and a trend increase of 5HT1A mRNA (P b 0.15) and 5-HT7 mRNA (P b 0.09) level in blood leukocytes of all schizophrenic patients than in the healthy subjects (Figs. 1A, 2A, 3A and 4A). Within-gender analysis using 1-way ANOVA showed significantly enhanced 5-HT2A (P b 0.01), 5HT7 (P b 0.05) and 5-HTT (P b 0.01) mRNA in the male but not in the female schizophrenic patients (Figs. 2–4A). 3.3. Antipsychotic-free vs. antipsychotic-naïve patients Because the antipsychotic-free female patients received a significantly greater dose of antipsychotics over a longer period of time than the male patients, and because previous studies have showed that antipsychotic therapy normalized platelet 5-HT2A and 5-HTT in schizophrenia subjects (Govitrapong et al., 2000, 2002), antipsychotics could have differentially affected leukocyte 5-HT system between the antipsychotic-free and antipsychotic-naïve male and female patients. Multi-comparison of 1-way ANOVA, however, showed no difference in leukocyte 5-HT receptor mRNA and 5-HTT mRNA between the antipsychotic-naïve (N = 11) and antipsychotic-free schizophrenic patients (N = 35). Both antipsychotic-free and antipsychotic-naïve patients exhibited significantly increased 5-HT2A (P b 0.01) and 5-HTT (P b 0.01) mRNA level when compared with the healthy subjects, respectively (Figs. 2A and 4A). The pooled male and female antipsychotic-free patients, but not the pooled antipsychoticnaïve patients, also showed a trend of increased 5-HT1A (P b 0.09) and 5-HT7 (P b 0.1) mRNA expression compared with the healthy subjects (Figs. 1C and 3C). Within-gender analysis showed that 5-HT1A (P = 0.05), 5-HT2A (P b 0.01), 5-HT7 (P b 0.05) and 5-HTT mRNA (P b 0.01) (N = 27) was significantly greater in the antipsychotic-free male patients than in the healthy male subjects (N = 24) (Figs. 1C–4C). 5-HT2A mRNA (P b 0.01) was also significantly greater in antipsychotic-naïve male patients (N = 8) than in the healthy male subjects (Fig. 2B).

G. Wang et al. / Schizophrenia Research 121 (2010) 160–171

163

Table 1 Demographic information of the subjects.

Controls, N = 44 Male, n = 24 Female, n = 20 SZ patients, N = 46 Male, n = 35 Female, n = 11 Drug-naïve patients Male, n = 8 Female, n = 2 Drug-free patients Male, n = 27 Female, n = 9

Age

Onset age

Age 1st treat

Months drug -free

Antipsychotics dose (mg)

Sleep hour daily

Positive PANSS

Negative PANSS

Gen PSY PANSS

Total PANSS

31.61 ± 1.2 31.4 ± 1.9 31.9 ± 1.5 33.9 ± 1.7 32.9 ± 1.8 37.3 ± 3.9 27.2 ± 2.0 28.3 ± 2.3 23 ± 2 35.8 ± 1.9 34.2 ± 2.2 40.4 ± 4

25.4 ± 1.3 24.7 ± 1.4 27.5 ± 3.1 24.4 ± 2.6 25.1 ± 3.2 21.5 ± 0.5 25.6 ± 1.5 24.6 ± 1.6 28.8 ± 3.6

26.6 ± 1.3 26.0 ± 1.5 28.5 ± 3.1

27.2 ± 7.0 28.3 ± 8.4* 23.7 ± 12.5

3864 ± 1366 1989 ± 473* 9902 ± 5284

102 ± 18

12 ± 3.6

23.0 ± 6.6 22.8 ± 8.0 23.7 ± 12.5

8604 ± 1434 2136 ± 497 9902 ± 5284

6.4 ± 0.4 6.2±0.4 6.8 ± 0.7 6.1±0.7 5.6 ± 0.8 8.0 ± 0 6.4 ± 0.4 6.4 ± 0.4 6.5 ± 0.9

23.4 ± 0.7 23.5 ± 0.8 22.9±1.2 23.8±1.4 23.8±1.2 24.0 ± 7.0 23.2±0.7 23.4±1.0 22.7 ± 0.8

19.7 ± 0.5 19.5 ± 0.6 20.1±0.8 18.7±1.2 18.4±1.2 20.0 ± 4.0 19.9 ± 0.6 19.9 ± 0.7 20.2±0.7

38.0 ± 0.5 38.1±0.6 37.6 ± 0.8 38.7±1.1 38.1±1.1 41.0 ± 3.0 37.7 ± 0.5 38.1±0.7 36.8 ± 0.7

89.0±1.1 89.4±1.3 88.1±1.5 88.7±2.2 88.1±2.7 91.0±1.0 89.1±1.2 89.7±1.5 87.4±1.8

26 ± 2.9 26.9 ± 1.6 26 ± 1.7 29.7 ± 3.7

* P b 0.05, male vs. female schizophrenic patients.

Antipsychotic-free female patients (N=9) showed reduced 5-HT1A (Pb 0.05) and 5-HT7 mRNA (Pb 0.1) (Fig. 1C and 3C) whereas the antipsychotic-naïve female patients (N=2) showed significantly enhanced 5-HT7 (P b 0.01) and 5-HTT mRNA (Pb 0.01) expression when compared with the healthy female subjects (N=20) (Figs. 3B and 4B). However, the results were based on imbalanced number of male and female patients and few antipsychotic-naïve female patients (n=2). Further studies with balanced male and female antipsychotic-naïve schizophrenic subjects are needed to confirm the present findings. 3.4. Correlations between 5-HT receptor and transporter mRNA Except that between 5-HT1A and 5-HT2A mRNA, significant correlations were consistently found between the 5-HT receptor and transporter mRNA for both the controls and schizophrenic subjects of both sexes (Table 2), implicating a common mechanism of regulation. 3.5. Correlations between antipsychotic, PANSS scales and 5-HT receptor & 5-HTT mRNA The correlations between antipsychotic dose, 5-HT receptor and 5-HTT mRNA and PANSS scales were determined for the pooled patients and for male and female patient groups, respectively (Table 3). 3.5.1. Pooled patients Accumulative dose of antipsychotic was significantly correlated with 5-HT1A mRNA (R = 0.85, P b 0.01) but not with 5-HT2A, 5-HT7 or 5-HTT mRNA in pooled patients (N = 46) (Table 2). 5-HT7 mRNA was significantly correlated with negative PANSS scales (R = 0.36, P b 0.05) and inversely correlated with the positive PANSS scales (R =−0.32, P b 0.05). In antipsychotic-free patients, 5-HT1A mRNA (R = −0.4, P b 0.05) and 5-HTT mRNA (R =−0.36, P b 0.05) were inversely correlated with the negative PANSS scales whereas 5HT7 mRNA (R = 0.37, P b 0.05) was positively correlated with negative PANSS scales. 3.5.2. Male patients No significant correlation exists between antipsychotics and 5-HT1A, 5-HT2A, or 5-HTT mRNA in all male patients (N = 35) (Table 3). 5-HT7 mRNA, however, was significantly correlated

with the negative PANSS scales (R = 0.36, P b 0.05) in all male patients. In antipsychotic-free male patients, the negative PANSS scales was inversely correlated with 5HT1A (R = −0.4, P b 0.05) and 5-HTT mRNA (R = −0.36, P b 0.08), and positively correlated with 5HT7 (R = 0.42, P b 0.05). In antipsychotic-naïve male patients, 5HT1A was inversely correlated with global PANSS scales (R = −0.85, P b 0.01) and negative PANSS scales (R = −0.68, P b 0.07). 3.5.3. Female patients 5-HT1A mRNA level was significantly correlated with antipsychotic dose in antipsychotic-free female schizophrenia patients (N = 9) (R = 0.94, P b 0.01) (Table 3). 5-HT1A, 5-HT7 and 5-HTT mRNA were significantly correlated with PANSS-GP scale (R = 0.74, P b 0.02; R = 0.76, P b 0.01; R = 0.79, P b 0.01, respectively). The negative PANSS scales were significantly correlated with 5-HT2A mRNA in all female patients (R = −0.66, P b 0.05) and in antipsychotic-free female patients (R = 0.77, P b 0.05), but was inversely correlated with 5-HT1A mRNA (R = − 0.73, P b 0.05) in antipsychotic-free female patients. Correlation was not calculated for the antipsychoticnaïve female patients due to insufficient number of patients in this group (N = 2). 4. Discussion The major findings of this study are the significantly elevated 5-HT2A and 5-HTT mRNA expressions in the blood leukocytes of acute schizophrenic patients of either antipsychotic-naïve or with prior antipsychotic treatment history, especially in the male patients. The selection of antipsychoticnaïve and antipsychotic-free patients (averaged 27 months drug-free) for this study was to eliminate the potential confounding effects of antipsychotic treatment on the blood 5-HT system in schizophrenic subjects. Our results suggest that at least part of the goal has been achieved. The inclusion of both male and female patient has also made possible the evaluation of potential gender effect on 5-HT system. The greater leukocyte 5-HT2A mRNA expression in schizophrenic patients agrees with the enhanced platelet 5-HT2 receptor number/density reported in acute schizophrenic patients including those with suicidal attempts (Arranz et al., 2003; Pandey et al., 1995) and those with aggravated positive symptoms (Abi-Saab et al., 2002). Our findings are also in line

164 G. Wang et al. / Schizophrenia Research 121 (2010) 160–171

Fig. 1. 5-HT1A mRNA expression in blood leukocytes of healthy subjects (black bars) and patients with schizophrenia (shadowed bars): A, all male and female schizophrenic (including antipsychotic-naïve and antipsychoticfree) patients were included; B, data from antipsychotic-naïve schizophrenic patients (N = 10, males = 8, females = 2) should be considered preliminary due to few female antipsychotic-naïve patients (n = 2); C, data from antipsychotic-free schizophrenic patients only (with prior antipsychotic treatment history) (N = 36, males = 27, females = 9). Results are presented as the fold change relative to the healthy subjects (of each sex) (= 1 fold). * P b 0.05 vs. healthy subjects.

G. Wang et al. / Schizophrenia Research 121 (2010) 160–171 Fig. 2. 5-HT2A mRNA expression in blood leukocytes of healthy subjects (black bars) and patients with schizophrenia (shadowed bars): A, all male and female schizophrenic (including antipsychotic-naïve and antipsychoticfree) patients were included; B, data from antipsychotic-naïve schizophrenic patients (N = 10, males = 8, females = 2) should be considered preliminary due to few female antipsychotic-naïve patients (n = 2); C, data from antipsychotic-free schizophrenic patients only (with prior antipsychotic treatment history) (N = 36, males = 27, females = 9). Results are presented as the fold change relative to the healthy subjects (of each sex) (= 1 fold). ** P b 0.01 vs. healthy subjects.

165

166 G. Wang et al. / Schizophrenia Research 121 (2010) 160–171

Fig. 3. 5-HT7 mRNA expression in blood leukocytes of healthy subjects (black bars) and patients with schizophrenia (shadowed bars): A, all male and female schizophrenic (including antipsychotic-naïve and antipsychoticfree) patients were included; B, data from antipsychotic-naïve schizophrenic patients (N = 10, males = 8, females = 2) should be considered preliminary due to few female antipsychotic-naïve patients (n = 2); C, data from antipsychotic-free schizophrenic patients only (with prior antipsychotic treatment history) (N = 36, males = 27, females = 9). Results are presented as the fold change relative to the healthy subjects (of each sex) (= 1 fold). * P b 0.05 vs. healthy subjects, + P b 0.05 vs. healthy subjects.

G. Wang et al. / Schizophrenia Research 121 (2010) 160–171

Fig. 4. 5-HTT mRNA expression in blood leukocytes of healthy subjects (black bars) and patients with schizophrenia (shadowed bars): A, all male and female schizophrenic (including antipsychotic-naïve and antipsychoticfree) patients were included; B, data from antipsychotic-naïve schizophrenic patients (N = 10, males = 8, females = 2) should be considered preliminary due to few female antipsychotic-naïve patients (n = 2); C, data from antipsychotic-free schizophrenic patients only (with prior antipsychotic treatment history) (N = 36, males = 27, females = 9). Results are presented as the fold change relative to the healthy subjects (of each sex) (= 1 fold). *, P b 0.05, vs. healthy subjects; ** P b 0.01 vs. healthy subjects.

167

168

G. Wang et al. / Schizophrenia Research 121 (2010) 160–171

Table 2 Pearson correlation coefficiency between leukocyte 5-HT receptor and transporter mRNA in healthy controls and schizophrenic subjects. 5-HT1A mRNA

5-HT1A mRNA Control Pooled (N = 44) Male (N = 24) Female (N = 20) Schizophrenics Pooled (N = 46) Male (N = 35) Female (N = 11)

5-HT2A mRNA

5-HT7 mRNA

5-HTT mRNA

Correlation

Correlation

Correlation

1

0.20

0.79 **

0.55**

1 1

0.52 ** 0.20

0.18 0.85 **

0.42 * 0.76 **

1

0.31 *

0.52 **

0.61 **

1 1

0.29 0.13

0.57 ** 0.97 **

0.60 ** 0.97 **

1

0.50 **

0.64 **

1 1

0.80 ** 0.43

0.64 ** 0.80 **

1

0.58 **

0.72 **

1 1

0.73 ** 0.08

0.74 ** 0.09

1

0.68 **

1 1

0.61 ** 0.84 **

1

0.74 **

1 1

0.76 ** 0.96 **

5-HT2A mRNA Control Pooled (N = 44) Male (N = 24) Female (N = 20) Schizophrenics Pooled (N = 46) Male (N = 35) Female (N = 11) 5-HT7 mRNA Control Pooled (N = 44) Male (N = 24) Female (N = 20) Schizophrenics Pooled (N = 46) Male (N = 35) Female (N = 11) *, P b 0.05; **, P b 0.01, (2-tailed).

with the current knowledge that 5-HT2A are the specific serotonin receptors mediating the actions of most psychedelic hallucinogens that can be blocked by high-affinity 5-HT2A antagonists such as atypical antipsychotic (Vollenweider et al., 1998). Recent studies showed that platelet 5-HT2 receptor binding site was significantly increased in un-medicated schizophrenic patients that returned to control level after a period of neuroleptic treatment (Govitrapong et al., 2000, 2002). Reciprocally reduced platelet 5-HT2A receptors and improved negative symptoms were also reported in firstepisode antipsychotic-naïve schizophrenic patients after 6 weeks of olanzapine treatment (Arranz et al., 2007). Furthermore, the reduction was observed only in the patients who responded to olanzapine treatment (Arranz et al., 2007). Reduced 5-HT2A receptors were also reported in the prefrontal cortex of schizophrenic patients after antipsychotic treatment when compared with antipsychotic-naïve schizo-

phrenic patients (Okubo et al., 2000). Thus, elevated peripheral 5-HT2A receptor appears to be a trait marker of acute schizophrenic patients whereas normalization of 5-HT2A expression is associated with antipsychotic treatment. The lack of apparent alteration of leukocyte 5-HT2A mRNA expression in the female schizophrenic patients warrants further investigation. To date, few study investigated the sex difference in 5-HT system in schizophrenia. Although the mechanism remains unknown, female hormones such as estrogen could have affected the results. One recent study showed that brain 5-HT2A receptor availability was significantly different between postmenopausal women with and without estrogen therapy, with significantly lower 5-HT2A receptor found in the hippocampus of estrogen treated postmenopausal women than in the untreated ones (Compton et al., 2008). The same study also showed a negative association between a greater hippocampal 5-HT2A receptor expression and memory function. In the present study, the greater accumulative antipsychotic dose in the female patients than in the male patients could have contributed to the sex difference in 5-HT2A mRNA expression because antipsychotics has been shown to have caused treatment time and thus accumulative dose-dependent attenuation of elevated platelet 5-HT2A in schizophrenia (Govitrapong et al., 2000, 2002). Nevertheless, the inverse correlations between antipsychotic and the negative symptoms and the total PANSS scores in the female patients suggest a therapeutic effect of residual antipsychotic in these patients. The significant correlation between 5-HT2A mRNA and negative PANSS scales also supports a link between 5-HT2A overactivity and negative symptoms in female patients. The overexpression of leukocyte 5-HTT mRNA in schizophrenic patients agrees with the increased platelet 5-HTT binding sites/density in neuroleptic-free schizophrenic patients that returned to normal level after neuroleptic treatment (Govitrapong et al., 2002). Significantly increased leukocyte 5-HT uptake velocity and 5-HT affinity to 5-HTT was also reported in schizophrenic patients with aggressive behavior (Barkan et al., 2006a). In our study, leukocyte 5-HTT mRNA was inversely correlated with the negative PANSS scales in all schizophrenic patients. Other studies showed that platelet 5-HTT maximum number/density was significantly greater and 5-HT uptake was significantly lower in aggressive male schizophrenic patients when compared with non-aggressive patients or normal controls (Modai et al., 2000). The 5-HTT mRNA overexpression is male patient specific in our study. Significantly increased platelet 5-HT content and 5-HTT binding in male schizophrenic patients was also reported recently by others (Brusov et al., 2007). In this study, no difference in 5-HT1A mRNA was found in antipsychotic-naïve patients. However, leukocyte 5-HT1A mRNA expression was significantly greater in antipsychoticfree male patients but significantly lower in antipsychoticfree female patients when compared with the healthy controls of each gender. Antipsychotic dose was correlated with 5-HT1A mRNA in female patients and inversely correlated with 5-HT1A mRNA in male patients. Thus, prior antipsychotic may have differentially and divergently affected 5-HT1A expression in the male and female patients. 5-HT1A is an inhibitory autoreceptor that inhibits 5-HT neuron firing and 5-HT release in the raphe nuclei but not in

G. Wang et al. / Schizophrenia Research 121 (2010) 160–171

169

Table 3 Correlation coefficiency between 5-HT receptor/transporter mRNA and clinical parameters in antipsychotic-free and antipsychotic-naïve schizophrenics. Drug dose

Sleep hour

PANSS Positive

PANSS Negative

Psycho General

PANSS Total

Drug dose All patients, 46 Male, 35 Female, 11

1 1 1

NS NS 0.38

NS NS − 0.45

NS NS − 0.82 **

NS NS NS

NS NS − 0.71 *

5HT1A mRNA All Male, 35 Female, 11 Drug-free Male, 27 Female, 9 Drug-naïve Male, 8 Female, 2

0.85 ** NS 0.94 ** NS NS NS NS NS NS

NS NS NS NS NS NS NS NS N/A

NS NS NS NS NS NS NS NS N/A

NS NS NS − 0.41 * − 0.41 * NS NS − 0.68 + N/A

NS NS NS NS NS NS NS −0.75 ** N/A

NS NS NS NS NS NS − 0.57 + − 0.85 ** N/A

5HT2A mRNA All Male, 35 Female, 11 Drug-free Male, 27 Female, 9 Drug-naïve Male, 8 Female, 2

NS NS NS NS NS NS NS NS NS

NS NS NS NS NS NS NS NS N/A

NS NS NS NS NS NS NS NS N/A

NS NS 0.66 * NS NS 0.77 * NS NS N/A

NS NS NS NS NS NS NS NS N/A

NS NS NS NS NS NS NS NS N/A

5HT7 mRNA All Male, 35 Female, 11 Drug-free Male, 27 Female, 9 Drug-naïve Male, 8 Female, 2

NS NS NS NS NS NS NS NS NS

NS NS NS NS NS NS NS NS N/A

−0.32 * NS NS NS NS NS NS NS N/A

0.37 0.36 NS 0.37 0.42 NS NS NS N/A

NS NS 0.76 ** NS NS NS NS NS N/A

NS NS NS NS NS NS NS NS N/A

5-HTT mRNA All Male, 35 Female, 11 Drug-free Male, 27 Female, 9 Drug-naïve Male, 8 Female, 2

NS NS NS NS NS NS NS NS NS

NS NS NS NS NS NS NS NS N/A

NS NS NS NS NS NS NS NS N/A

NS NS NS − 0.36 * NS NS NS NS N/A

NS NS 0.81 ** NS NS NS NS NS N/A

NS NS NS NS NS NS NS NS N/A

* * * *

*, P b 0.05; **, P b 0.01; +, P b 0.10; NS, not significant; N/A, not available.

the projection areas of the forebrain (Stahl, 1998). An increased 5-HT1A mRNA expression if also existed in the raphe nuclei of antipsychotic-free male patients may inhibit 5-HT activity, whereas the lower 5-HT1A expression in the female patients may facilitate 5-HT release. There are reports that 5-HT1A receptor antagonists ameliorated the number and the severity of aggressive acts in aggressive male schizophrenic patients (Caspi et al., 2001), whereas partial 5-HT1A agonist is therapeutic for diverse symptoms especially the negative symptoms and cognitive deficit of schizophrenia (NewmanTancredi et al., 2005). It is tempting to speculate that a synergistic alteration in 5-HT1A and 5-HTT expression could underlie an altered intracellular and extracellular 5-HT balance in schizophrenia. Co-overexpression of 5HT1A and 5-HTT could have contrib-

uted to the reduced the basal extracellular plasma 5-HT pool and increased the whole blood or intracellular 5-HT concentration in the platelet/leukocyte of un-medicated schizophrenia (DeLisi et al., 1981; Ertugrul et al., 2007; Garelis et al., 1975). Strong reciprocal alterations in 5-HT1A and 5-HTT have been reported in 5-HTT gene knockout mouse that exhibited significantly reduced number of 5-HT neurons and 5-HT1A receptor but significantly elevated baseline extracellular 5-HT level (Anderson et al., 2000; Holmes et al., 2003). The positive correlation between 5-HT7 mRNA and negative PANSS scales and general psychopathology scales, and an inversely correlation between 5-HT7 mRNA and positive PANSS scales in all schizophrenic patients implicate a role of 5-HT7 in schizophrenia. The greater leukocyte 5-HT7 receptor mRNA expression in antipsychotic-naïve female

170

G. Wang et al. / Schizophrenia Research 121 (2010) 160–171

patients and antipsychotic-free male patients suggests a role of 5-HT7 in schizophrenic pathophysiology in these patients. Recent rodent study suggests that 5-HT7 is involved in the impaired pre-pulse inhibition (PPI) of schizophrenia as genetic inactivation of 5-HT7 receptor blocks phencyclidineinduced disruption of PPI (Semenova et al., 2008). There are limitations of the present study including the clinical heterogeneity of the patients. It has been suggested that schizophrenia is not a single disease in the strict sense, but rather a group of diseases (Bleuler, 1953). The Positive and Negative Syndromes Scales (PANSS) used in the present study therefore is not adequate enough to accurately reflect all the clinical subtype-based schizophrenia cases (paranoid type, simple type, catatonic type, undifferentiated type, residue type etc.) or the symptom-based schizophrenia cases (hallucination, delusion etc). Moreover, the antipsychotic-free schizophrenic patients might have had different course of illness development since their initial treatment: some might have improved from the illness whereas others may have deteriorated and the therapy was ineffective. It is not known whether the altered blood 5-HT system would respond to antipsychotic therapy in a similar manner in different subjects or if the response is stable or short-lived. Our results would suggest that prior antipsychotic treatment failed to reverse the course of the illness or normalize the 5-HT system in the antipsychotic-free patients as reflected by the apparent abnormality in leukocyte 5-HT system and by the relapse of the illness in the selected patients. Further, the variations in age and antipsychotic dose and type could be too big for male and female schizophrenia patients to show similar changes in 5-HT receptor. Future studies should determine if blood 5-HT system in the male and female patients would show similar response to various doses of antipsychotics. In summary, we found significantly enhanced 5-HT2A receptor and 5-HTT mRNA expression in blood leukocyte of antipsychotic-free and antipsychotic-naïve schizophrenic patients, male patients especially. Leukocyte 5-HT1A and 5HT7 mRNA were also abnormal in male and female schizophrenic patients. Further study should investigate if and how sex hormones and residual antipsychotics could have affected blood 5-HT system in schizophrenia. If replicated, leukocyte serotonergic markers could assist in diagnosis and individualized pharmacotherapy of schizophrenic patients. Role of funding source This work was supported, in part, by a SMRI grant (03T-442) and Special Funds from Ministry of Health of China for Excellent Young investigators. The funding had no further role in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication.

Contributors GW and GX designed the study. GW, TJ, JL, JH and CH participated in patient diagnosis, PANSS scale administration and sample collection; CH, SH and ML prepared samples; CH, GW and GX conducted gene expression analysis and data interpretation, GX wrote the manuscript.

Conflict of interest All authors declare that they have no conflict of interest.

Acknowledgement We would like to thank Dr. Robert M Post for comments and suggestions of the manuscript.

References Abi-Saab, W., Seibyl, J.P., D'Souza, D.C., Karper, L.P., Gueorgueva, R., Abi-Dargham, A., et al., 2002. Ritanserin antagonism of m-chlorophenylpiperazine effects in neuroleptic-free schizophrenics patients: support for serotonin-2 receptor modulation of schizophrenia symptoms. Psychopharmacology (Berl) 162, 55–62. Anderson, D.J., Puttfarcken, P.S., Jacobs, I., Faltynek, C., 2000. Assessment of nicotinic acetylcholine receptor-mediated release of [(3)H]-norepinephrine from rat brain slices using a new 96-well format assay. Neuropharmacology 39, 2663–2672. Arranz, B., Rosel, P., Sarro, S., Ramirez, N., Duenas, R., Cano, R., et al., 2003. Altered platelet serotonin 5-HT2A receptor density but not second messenger inositol trisphosphate levels in drug-free schizophrenic patients. Psychiatry Res. 118, 165–174. Arranz, B., Rosel, P., San, L., Ramirez, N., Duenas, R.M., Salavert, J., et al., 2007. Low baseline serotonin-2A receptors predict clinical response to olanzapine in first-episode schizophrenia patients. Psychiatry Res. 153, 103–109. Barkan, T., Peled, A., Modai, I., Barak, P., Weizman, A., Rehavi, M., 2006a. Serotonin transporter characteristics in lymphocytes and platelets of male aggressive schizophrenia patients compared to non-aggressive schizophrenia patients. Eur. Neuropsychopharmacol. 16, 572–579. Barkan, T., Peled, A., Modai, I., Weizman, A., Rehavi, M., 2006b. Characterization of the serotonin transporter in lymphocytes and platelets of schizophrenia patients treated with atypical or typical antipsychotics compared to healthy individuals. Eur. Neuropsychopharmacol. 16, 429–436. Bleuler, M., 1953. Thoughts on the present theory of schizophrenia, with reference to concepts of constitutional pathology. Wien. Z. Nervenheilkd. Grenzgeb 7, 255–270. Brusov, O.S., Faktor, M.I., Zlobina, G.P., Dupin, A.M., Katasonov, A.B., Dmitriev, A.D., et al., 2007. Platelet serotonergic parameters and clinical symptoms of psychosis in patients with episodic progressive schizophrenia. Zh Nevrol. Psikhiatr. Im SS Korsakova 107, 17–24. Caspi, N., Modai, I., Barak, P., Waisbourd, A., Zbarsky, H., Hirschmann, S., et al., 2001. Pindolol augmentation in aggressive schizophrenic patients: a double-blind crossover randomized study. Int. Clin. Psychopharmacol. 16, 111–115. Compton, J., Travis, M.J., Norbury, R., Erlandsson, K., van Amelsvoort, T., Daly, E., et al., 2008. Long-term estrogen therapy and 5-HT2A receptor binding in postmenopausal women: a single photon emission tomography (SPET) study. Horm. Behav. 53, 61–68. Dean, B., Hayes, W., 1996. Decreased frontal cortical serotonin2A receptors in schizophrenia. Schizophr. Res. 21, 133–139. DeLisi, L.E., Neckers, L.M., Weinberger, D.R., Wyatt, R.J., 1981. Increased whole blood serotonin concentrations in chronic schizophrenic patients. Arch. Gen. Psychiatry 38, 647–650. Ertugrul, A., Ucar, G., Basar, K., Demir, B., Yabanoglu, S., Ulug, B., 2007. Influence of clozapine on platelet serotonin, monoamine oxidase and plasma serotonin levels. Psychiatry Res. 149, 49–57. Faraone, S.V., Chen, W.J., Goldstein, J.M., Tsuang, M.T., 1994. Gender differences in age at onset of schizophrenia. Br. J. Psychiatry 164, 625–629. Garelis, E., Gillin, J.C., Wyatt, R.J., Neff, N., 1975. Elevated blood serotonin concentrations in unmediated chronic schizophrenic patients: a preliminary study. Am. J. Psychiatry 132, 184–186. Govitrapong, P., Chagkutip, J., Turakitwanakan, W., Srikiatkhachorn, A., 2000. Platelet 5-HT(2A) receptors in schizophrenic patients with and without neuroleptic treatment. Psychiatry Res. 96, 41–50. Govitrapong, P., Mukda, S., Turakitwanakan, W., Dumrongphol, H., Chindaduangratn, C., Sanvarinda, Y., 2002. Platelet serotonin transporter in schizophrenic patients with and without neuroleptic treatment. Neurochem. Int. 41, 209–216. Gurevich, E.V., Joyce, J.N., 1997. Alterations in the cortical serotonergic system in schizophrenia: a postmortem study. Biol. Psychiatry 42, 529–545. Hernandez, I., Sokolov, B.P., 1997. Abnormal expression of serotonin transporter mRNA in the frontal and temporal cortex of schizophrenics. Mol. Psychiatry 2, 57–64. Holmes, A., Yang, R.J., Lesch, K.P., Crawley, J.N., Murphy, D.L., 2003. Mice lacking the serotonin transporter exhibit 5-HT(1A) receptor-mediated abnormalities in tests for anxiety-like behavior. Neuropsychopharmacology 28, 2077–2088. Ikeda, M., Iwata, N., Kitajima, T., Suzuki, T., Yamanouchi, Y., Kinoshita, Y., et al., 2006. Positive association of the serotonin 5-HT7 receptor gene with schizophrenia in a Japanese population. Neuropsychopharmacology 31, 866–871. Joyce, J.N., Shane, A., Lexow, N., Winokur, A., Casanova, M.F., Kleinman, J.E., 1993. Serotonin uptake sites and serotonin receptors are altered in the limbic system of schizophrenics. Neuropsychopharmacology 8, 315–336.

G. Wang et al. / Schizophrenia Research 121 (2010) 160–171 Kane, J.M., Leucht, S., Carpenter, D., Docherty, J.P., 2003. The expert consensus guideline series. Optimizing pharmacologic treatment of psychotic disorders. Introduction: methods, commentary, and summary. J. Clin. Psychiatry 64 (Suppl 12), 5–19. Laruelle, M., Abi-Dargham, A., Casanova, M.F., Toti, R., Weinberger, D.R., Kleinman, J.E., 1993. Selective abnormalities of prefrontal serotonergic receptors in schizophrenia. A postmortem study. Arch. Gen. Psychiatry 50, 810–818. Lewis, R., Kapur, S., Jones, C., DaSilva, J., Brown, G.M., Wilson, A.A., et al., 1999. Serotonin 5-HT2 receptors in schizophrenia: a PET study using [18F] setoperone in neuroleptic-naive patients and normal subjects. Am. J. Psychiatry 156, 72–78. Modai, I., Gibel, A., Rauchverger, B., Ritsner, M., Klein, E., Ben-Shachar, D., 2000. Paroxetine binding in aggressive schizophrenic patients. Psychiatry Res. 94, 77–81. Naylor, L., Dean, B., Opeskin, K., Pavey, G., Hill, C., Keks, N., et al., 1996. Changes in the serotonin transporter in the hippocampus of subjects with schizophrenia identified using [3H]paroxetine. J. Neural Transm. 103, 749–757. Newman-Tancredi, A., Assie, M.B., Leduc, N., Ormiere, A.M., Danty, N., Cosi, C., 2005. Novel antipsychotics activate recombinant human and native rat serotonin 5-HT1A receptors: affinity, efficacy and potential implications for treatment of schizophrenia. Int. J. Neuropsychopharmacol. 8, 341–356. Okubo, Y., Suhara, T., Suzuki, K., Kobayashi, K., Inoue, O., Terasaki, O., et al., 2000. Serotonin 5-HT2 receptors in schizophrenic patients studied by positron emission tomography. Life Sci. 66, 2455–2464. Pandey, G.N., Pandey, S.C., Dwivedi, Y., Sharma, R.P., Janicak, P.G., Davis, J.M., 1995. Platelet serotonin-2A receptors: a potential biological marker for suicidal behavior. Am. J. Psychiatry 152, 850–855. Riecher-Rossler, A., Hafner, H., 2000. Gender aspects in schizophrenia: bridging the border between social and biological psychiatry. Acta Psychiatr. Scand. Suppl. 58–62.

171

Roth, B.L., Craigo, S.C., Choudhary, M.S., Uluer, A., Monsma Jr., F.J., Shen, Y., et al., 1994. Binding of typical and atypical antipsychotic agents to 5-hydroxytryptamine-6 and 5-hydroxytryptamine-7 receptors. J. Pharmacol. Exp. Ther. 268, 1403–1410. Semenova, S., Geyer, M.A., Sutcliffe, J.G., Markou, A., Hedlund, P.B., 2008. Inactivation of the 5-HT(7) receptor partially blocks phencyclidineinduced disruption of prepulse inhibition. Biol. Psychiatry 63, 98–105. Shen, Y., Monsma Jr., F.J., Metcalf, M.A., Jose, P.A., Hamblin, M.W., Sibley, D.R., 1993. Molecular cloning and expression of a 5-hydroxytryptamine7 serotonin receptor subtype. J. Biol. Chem. 268, 18200–18204. Stahl, S.M., 1998. Mechanism of action of serotonin selective reuptake inhibitors. Serotonin receptors and pathways mediate therapeutic effects and side effects. J. Affect. Disord. 51, 215–235. Sumiyoshi, T., Stockmeier, C.A., Overholser, J.C., Dilley, G.E., Meltzer, H.Y., 1996. Serotonin1A receptors are increased in postmortem prefrontal cortex in schizophrenia. Brain Res. 708, 209–214. Takahashi, S., Matsuura, M., Tanabe, E., Yara, K., Nonaka, K., Fukura, Y., et al., 2000. Age at onset of schizophrenia: gender differences and influence of temporal socioeconomic change. Psychiatry Clin. Neurosci. 54, 153–156. Vollenweider, F.X., Vollenweider-Scherpenhuyzen, M.F., Babler, A., Vogel, H., Hell, D., 1998. Psilocybin induces schizophrenia-like psychosis in humans via a serotonin-2 agonist action. NeuroReport 9, 3897–3902. Xing, G., Qualls, C., Huicho, L., Rivera-Ch, M., Stobdan, T., Slessarev, M., et al., 2008. Adaptation and mal-adaptation to ambient hypoxia; Andean. Ethiopian and Himalayan patterns. PLoS ONE 3, e2342. Yasuno, F., Suhara, T., Ichimiya, T., Takano, A., Ando, T., Okubo, Y., 2004. Decreased 5-HT1A receptor binding in amygdala of schizophrenia. Biol. Psychiatry 55, 439–444. Zhukovskaya, N.L., Neumaier, J.F., 2000. Clozapine downregulates 5hydroxytryptamine6 (5-HT6) and upregulates 5-HT7 receptors in HeLa cells. Neurosci. Lett. 288, 236–240.