Overexpression of sheepgrass R1-MYB transcription factor LcMYB1 confers salt tolerance in transgenic Arabidopsis

Plant Physiology and Biochemistry 70 (2013) 252e260

Contents lists available at SciVerse ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Overexpression of sheepgrass R1-MYB transcription factor LcMYB1 confers salt tolerance in transgenic Arabidopsis Liqin Cheng a,1, 2, Xiaoxia Li a, b,1, Xin Huang a, b, Tian Ma a, c, Ye Liang a, b, Xingyong Ma a, b, Xianjun Peng a, b, Junting Jia a, b, Shuangyan Chen a, Yan Chen e, *, Bo Deng d, **, Gongshe Liu a, *** a

Key Laboratory of Plant Resources, Institute of Botany, The Chinese Academy of Sciences, Beijing 100093, PR China Graduate School of the Chinese Academy of Sciences, Beijing 100049, PR China Agricultural College, Ning Xia University, Ningxia 750021, PR China d Department of Grassland Science, College of Animal Science and Technology, China Agriculture University, Beijing 100193, PR China e Ningxia Agricultural Comprehensive Development Office, Yinchuan 750001, PR China b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 9 April 2013 Accepted 14 May 2013 Available online 6 June 2013

Sheepgrass [Leymus chinensis (Trin.) Tzvel.] is a dominant, rhizomatous grass that has extensive plasticity in adapting to various harsh environments. Based on data from 454 high-throughput sequencing (GS FLX) exposure to salt stress, an unknown functional MYB-related gene LcMYB1 was identified from sheepgrass. Tissue specific expression profiles showed that the LcMYB1 gene was expressed ubiquitously in different tissues, with higher expression levels observed in the rhizome and panicle. The expression of LcMYB1 was induced obviously by high salt, drought and abscisic acid and was induced slightly by cold. A fusion protein of LcMYB1 with green fluorescent protein (GFP) was localized to the nucleus, and yeast one-hybrid analysis indicated that LcMYB1 was an activator of transcriptional activity. LcMYB1-overexpressing plants were more tolerant to salt stress than WT plants. The amounts of proline and soluble sugars were higher in transgenic Arabidopsis than in WT plants under salt stress conditions. The overexpression of LcMYB1 enhanced the expression levels of P5CS1 and inhibited other salt stress response gene markers. These findings demonstrate that LcMYB1 influences the intricate salt stress response signaling networks by promoting different pathways than the classical DREB1A- and MYB2-mediated signaling pathway. Additionally, LcMYB1 is a promising gene resource for improving salinity tolerance in crops. Ó 2013 Elsevier Masson SAS. All rights reserved.

Keywords: Sheepgrass MYB-related LcMYB1 Salt stress

1. Introduction Sheepgrass (Leymus chinensis (Trin.) Tzvel.) is a perennial rhizomatous grass of the family Poaceae. It is a dominant species that is widely distributed throughout the eastern grasslands of the

Abbreviations: ABA, abscisic acid; BD, binding domain of GAL4; MDA, malondialdehyde; MJ, methyl jasmonate; ORF, open reading frame; PEG, polyethylene glycol; SD/-Trp/-His, synthetic dextrose medium lacking tryptophan and histidine; TCA, trichloroacetic acid; P5CS, D-1-pyrroline-5-carboxylate synthetase. * Corresponding author. Tel./fax: þ86 0951 6015008. ** Corresponding author. Tel./fax: þ86 10 62733409. *** Corresponding author. Tel.: þ86 10 62836227; fax: þ86 10 62596227. E-mail addresses: [email protected] (L. Cheng), [email protected] (Y. Chen), [email protected] (B. Deng), [email protected] (G. Liu). 1 These authors contributed equally to this work. 2 Tel.: þ86 10 628362242; fax: þ86 10 62836227. 0981-9428/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.plaphy.2013.05.025

Eurasian arid steppe zone, including Korea, Eastern Russia, Japan, Mongolia and northern China [1,2]. It is extensively plastic in adapting to different harsh environments. Sheepgrasses can grow rapidly after grazing or mowing and have a high tolerance to drought, extreme low temperature (
47.5  C) and salt and alkali stresses [3]. Sheepgrass seedlings have been shown to tolerate to high concentrations of NaCl and Na2CO3, at 600 mmol/L and 175 mmol/L, respectively [4]. The young seedlings normally grow in soil with pH 9.14e9.53 [5]. Sheepgrass can survive in highly alkaline soil (pH 8.5e11.5) naturally [6]. As a precious genetic resource, sheepgrass thus plays an important role in elucidating the molecular mechanisms of stress responses in monocots and providing gene resources for improving the breeding of other crops. Salinity is a major environmental stress that limits agricultural production and the geographical distribution of plants. It is also a major obstacle for feeding the growing world population. Approximately 20% of the earth’s land mass is currently affected

L. Cheng et al. / Plant Physiology and Biochemistry 70 (2013) 252e260

by salinity, and up to 50% of all irrigated land will be thus affected by the year 2050 [7]. The development and application of a novel gene that confers salt tolerance and allows for the breeding of salt-tolerant crops are significant because this will be the most effective way to develop and utilize large areas of salineealkali soil. The adverse effects of salinity on plant growth may be due to ion toxicity and osmotic stress, and most plants have evolved complex salt tolerance mechanisms to overcome these problems [8]. Regulatory genes including various types of transcription factors, which perform as nodes in a complicated signaling transduction network, have been found to play key roles in the adaptation to abiotic stress in plants [9]. Among plant transcription factors, the MYB proteins play a key role in abiotic stress tolerance [10,11]. In Arabidopsis, at least six signal transduction pathways exist for overcoming drought, high salinity and cold stress responses. These pathways involve various transcription factors and down-stream targets including MYB/MYC, NAC, AREB/ABF, DREB, RD22, RD29A, RD29B, P5CS1, P5CS2 and RAB18 that play different roles in the stress

253

response processes [12]. The MYB family of genes, which includes AtMYB2, 15, 33, 96, 101, and 108, were reported to participate in the stress response process [10]. OsMYB3R-2 [13], OsMYB4 [14], OsMYBS3 [15], OsMYB2P-1 [16] and OsMYB2 [17] in rice and TaMYB2, TaMYB32, TaMYB56, TaMYB30 [18e21], TaMYB33 and TaMYB73 [22,23] in wheat were also reported to be important regulators in stress response. Sheepgrass is a species that is closely related to wheat. A large number of salt response genes were obtained using 454 highthroughput sequencing technologies, including 76 MYB family genes. Several abiotic stress-inducible genes from sheepgrass have been identified and characterized, including LcDREB3a and LcSAINT2 [24,25]. In this study, we report the isolation and characterization of the previously unknown functional gene LcMYB1s from sheepgrass. The elucidation of this MYB protein’s function will be helpful for revealing the mechanism by which sheepgrass adapts to high salinity and will provide a valuable gene resource for breeding forage and other crops with improved salt tolerance, especially in monocotyledon plants.

Fig. 1. Domain features by SMART and phylogeny of LcMYB1 with orthologs. (a) Predicted protein structure of LcMYB1 by SMART. The SANT domain (AA 40e88), SWI3, ADA2, N-CoR and TFIIIB DNA-binding domains (E-value: 2.54e
06); the Myb_DNA-binding domain [pfam00249]; low complexity segments (AA 232e240); (b) Phylogeny of LcMYB1 was constructed based on amino acid sequences from stress response MYB-related TFs using the NeighboreJoining method.

254

L. Cheng et al. / Plant Physiology and Biochemistry 70 (2013) 252e260

2. Results 2.1. Isolation and sequence analysis of LcMYB1 A full-length cDNA of the LcMYB1 was isolated from sheepgrass using the RACE method from 454 sequencing transcriptional profile data (GenBank Accession No. KC154048). The sequence is 2697 base pairs (bp) in length with a 751 amino acid open reading frame. The molecular mass of the putative protein is approximately 82.6 kDa, and its theoretical isoelectric point (pI) is 5.6. Further analysis of the deduced amino acid sequence revealed that this protein contained a 49 amino acid (AA 40e88) conserved MYB-like DNA-binding domain and a low complexity segment (AA 232e240) (Fig. 1a). The deduced amino acid sequence shows relatively high homology with the monocot MYB family members wheat, rice, and maize and lower homology with dicot species including Arabidopsis and soybean. LcMYB1 has 92% identity with TaMYB46 (AEV91169.1), 75% homology with the predicted Brachypodium distachyon TSL-kinase interacting protein 1-like (XP_003558387.1), 75% homology with the hypothetical protein OsI_10700 (EAY89204.1), 71% homology with the Zea mays unknown protein (ACN26933.1), 44% homology with the Arabidopsis MYB/SANT domain (AAM94622.1) and the Glycine max (XP_003519867.1), and 28% homology with the Arabidopsis uncharacterized protein (NP_195648.1). Currently, the functional role of the LcMYB1 gene is unknown. Neither TMHMM (http://www.cbs.dtu.dk/services/TMHMM/) nor TMpred found transmembrane domains in the LcMYB1 protein. A phylogenetic tree was constructed with the full-length amino acid sequences of other plant MYB TFs involved in the regulation of abiotic stress. As shown in Fig. 1b, the resulting trees contained three clusters. LcMYB1 (KC154048), isolated in this study, clustered together with the known stress-related genes GmMYB177 (DQ822925), OsMYBS3 (AY151044), AtCCA1 (NM180129), TaMYB30

(AEV91153), and OsMYB3R (BAD81765) into the same clade, C2. The most adjacent gene was OsMYBS3 (4.93% identity), which is a R1-MYB protein involved in cold stress responses [15]. AtCCA1 (10.92% identity) was associated with circadian oscillations [26]. OsMYB3R (an MYB-like protein with 11.38% identity) can enhance chilling stress by altering the cell cycle [13]. GmMYB177 (8.47% identity) can confer plant salt and freezing tolerance in transgenic plants [27]. 2.2. Expression patterns of LcMYB1 Sheepgrass can survive in extreme environments, and we examined whether the expression of LcMYB1 contributes to its adaptability. The expression patterns of LcMYB1 under PEG6000, salt, cold and ABA stresses were monitored by quantitative realtime RT-PCR (qRT-PCR). The results showed that LcMYB1 expression was induced significantly by salt, PEG and ABA stresses in sheepgrass but that it was induced weakly by cold. The expression patterns and maximum expression levels differed for each stress. The expression of LcMYB1 was induced for 1 h after cold treatment and reached to a maximum 3 h after starting the treatment (Fig. 2a). LcMYB1 transcripts accumulated quickly in response to salt and reached its maximal level after 1 h of salt treatment (Fig. 2b). LcMYB1 transcripts reached a maximum at 8 h after PEG treatment (Fig. 2c), and the expression of LcMYB1 was distinctly induced at 1 h and reached a maximum by 24 h with ABA treatment (Fig. 2d). The expression of LcMYB1 was detected ubiquitously in all organs under non-stressed conditions, with the expression level being the highest in rhizomes, which were much higher than those observed in the stems (Fig. 2e), indicating that the sheepgrass LcMYB1 gene worked in various aspects of physiology and developmental processes, especially in young panicle and rhizome development.

Fig. 2. Expression patterns of LcMYB1 in response to various treatments by qRT-PCR. (a) Low temperature (4  C). (b) 400 mM NaCl/L. (c) 20% PEG6000 (w/w). (d) 100 mM ABA/L. The samples were collected for each condition at 0, 1, 3, 8, 12 and 24 h, respectively. (e) LcMYB1 expression profiling in different tissues.

L. Cheng et al. / Plant Physiology and Biochemistry 70 (2013) 252e260

2.3. LcMYB1 is located in the nucleus To determine the subcellular localization of LcMYB1, the open reading frame of LcMYB1 was fused to the 50 -terminus of the GFP reporter gene under the control of the CaMV 35S promoter. The recombinant constructs, the CaMV 35S LcMYB1-GFP fusion gene and GFP alone, were transformed into Arabidopsis by the Floral dip methods [28]. Root tips of 4-day-old T3 transgenic plants grown vertically were used for observation of the GFP fluorescence. Observation with a confocal microscope showed that the LcMYB1GFP fusion protein was localized in the nucleus (Fig. 3def), whereas GFP was present throughout the whole cell (Fig. 3aec). These results suggest that LcMYB1 is a nuclearly localized protein. 2.4. Transcriptional activity of the LcMYB1 protein The transcriptional activity of LcMYB1 was tested using a yeast one-hybrid assay. The yeast strain AH109 with the vector pBridgeBD (as a negative control) could not grow on SD medium without His and Trp (SD/-His-Trp). However, the cells harboring the pBridge-BD-LcMYB1 and pBridge-BD-GAL4 (as a positive control) could grow normally on the same media and exhibited blue signals in b-galactosidase assay upon addition of X-gal to the Whatman filter paper (Fig. 4aec). These results indicated that LcMYB1 is a transcriptional activator. 2.5. The salt tolerance of LcMYB1 transgenic plants To investigate the biological function of LcMYB1, transgenic Arabidopsis plants were created with the LcMYB1 gene construct under the control of the CaMV 35S promoter. The 7-day-old

255

seedlings of transgenic and wild type (WT) plants were transferred to the 1/2MS medium supplemented with 150 mM NaCl after germination in 1/2MS medium. A portion of these seedlings were cultivated upright to allow for observation of the roots for 7 days (Fig. 5e). The other seedlings were grown horizontally for salt tolerance analysis. Images of both plants were taken 21 days after movement to the salt stress medium (Fig. 5aec). The survival percentage of transgenic plants was 58e92% under salt stress, which was significantly higher than that of WT (17e25%) (Fig. 5d). These results indicated that the transgenic plants were more tolerant to salt than the WT plants. There was no difference in development and growth between the WT and transgenic plants in 1/2MS medium without stress. 2.6. LcMYB1-overexpressing plants accumulated greater amounts of proline and soluble sugars and less MDA under salt stress The accumulation of proline and soluble sugars to facilitate osmotic regulation is a common adaptive mechanism for tolerance in plants to abiotic stress [29]. To test whether the enhanced tolerance of LcMYB1-overexpressing plants to salt stress is related to its capacity to accumulate proline and soluble sugars, the effect of salt stress on proline and soluble sugar contents in WT and transgenic plants was investigated. The increase in proline content in the LcMYB1-overexpressing plants was significantly higher than in the WT plants (Fig. 6a). Similarly, the two LcMYB1-overexpressing lines accumulated greater amounts of soluble sugars than the WT plants when these plants were exposed to 150 mM NaCl (Fig. 6b). The effects of salt stress on MDA content in WT and transgenic Arabidopsis were also investigated (Fig. 6c). There were obvious increases in MDA content in both WT and transgenic plants upon

Fig. 3. Subcellular localization of LcMYB1. Arabidopsis was transformed with CaMV 35S GFP (aec) and CaMV 35S LcMYB1-GFP (def). (A) and (D) Nuclear localization of GFP and LcMYB1-GFP photographed in the dark for green fluorescence. (B) and (E) The same cells in (A) and (D) with bright light. (C) and (F) The merged images of (A) and (B) and (D) and (E), respectively. GFP and LcMYB1-GFP fusion proteins were under the control of the CaMV 35S promoter. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

256

L. Cheng et al. / Plant Physiology and Biochemistry 70 (2013) 252e260

Fig. 4. Transactivational assay of LcMYB1. (A) The full-length ORF of LcMYB1 was fused with pBridge, and the transformed RH109 yeasts were selected from SD-Trp-His media. pGAL4 was used as a positive control, and pBridge (pBD) was used as a negative control. (B) b-galactosidase activity assay (the LacZ marker gene was examined by X-gal assay). (C) The position of each transformed yeast cell.

exposure to 150 mM NaCl. However, the MDA content was lower in the LcMYB1-overexpressing plants than in the WT plants under salt stress. These results indicate that the overexpression of LcMYB1 increases the tolerance to the oxidative stress related to salt stress. 2.7. Expression of abiotic stress response genes in transgenic plants Phenotype analysis indicated that the LcMYB1 transgenic lines had enhanced tolerance to salt stress. To further elucidate the mechanism by which the LcMYB1-overexpressing plants accumulate greater amounts of proline than WT plants under salt stress, the effects of salt stress on the expression of the genes responsible for proline biosynthesis, i.e., AtP5CS1 (AB022784.2) and AtP5CS2 (Y09355.1), was investigated. The expression levels of AtP5CS1 in the transgenic Arabidopsis plants increased continually from 6 to 24 h after salt stress treatment and were much higher in transgenic plants than in WT plants (Fig. 7). Several known salt stressresponsive marker genes were analyzed in the transgenic Arabidopsis and WT plants. The expression patterns of ABF3 in the LcMYB1 overexpression plants were significantly enhanced under salt stress, whereas the expression levels of MYB2 and DREB1A were lower in transgenic than WT plants after stress (Fig. 7). The expression levels of other genes did not change in LcMYB1 overexpression plants compared with WT plants. 3. Discussion In this study, a R1-MYB LcMYB1 gene was identified from the high saline, alkali-resistant plant sheepgrass. LcMYB1 has significant amino acid homology (71e92%) with other reported MYBs from the Poaceae family (wheat, rice, and maize), but it has low homology (28e44%) with MYBs from dicotyledonous plants; the genes with high identity are hypothetical or unknown functional proteins. The expression of LcMYB1 was induced rapidly to maximal levels after salt stress for 1 h with the expression declining thereafter (Fig. 2B). This result was markedly different from the expression profile of TaMYB46 (AEV91169.1), which has high amino acid sequence similarity with LcMYB1. TaMYB46 was induced by PEG and low temperature, but it was not induced by salt stress in wheat [19]. Except for an increase after exposure to PEG and cold, research on TaMYB46 involvement in stress response is not currently available. The activity of P5CS represents a rate-limiting step in proline biosynthesis, and P5CS1 mutations result in reduced salt tolerance [30]. The up-regulation of stress response genes such as AtP5CS1 can contribute to enhanced salt stress tolerance in plants [31]. AtP5CS2-mediated proline accumulation is activated by avirulent bacteria and ROS signals [32]. While the expression of P5CS1 was significantly enhanced in transgenic lines compared to the WT plants, the expression levels of AtP5CS2 were lower in transgenic

plants than in WT plants under salt stress. We speculate that the up-regulation of the AtP5CS1 genes in the LcMYB1-overexpressing plants may contribute to the increased salt tolerance. However, the stress response genes DREB1A and MYB2 exhibited decreased transcription in the LcMYB1-overexpressing plants compared with the WT plants (Fig. 7). Other salt stress response marker genes, including RD22, RD26, RD29B, P5CS2 and RAB18, had lower expression in the transgenic Arabidopsis than in the WT plants. The accumulation of compatible osmolytes, including soluble sugars, maintains cell homeostasis under stress [33]. Proline has been proposed to act as an osmoprotective molecule because it participates in the maintenance of redox balance, ROS detoxification, and the protection of protein structures through its chaperonlike features [30]. Salt- and cold-hypersensitive Arabidopsis mutants have been shown to accumulate proline at high levels without any apparent beneficial effect on stress tolerance [29]. This study found an accumulation of soluble sugars and free proline in the LcMYB1-overexpressing plants, which may account for the higher tolerance of LcMYB1-OE plants to salt stress. Malondialdehyde is widely recognized as a marker for lipid peroxidation [34]. In this study, the MDA contents in LcMYB1overexpressing plants were lower than in the WT plants under salt stress (Fig. 6c). The decrease in oxidative damage may contribute to the greater tolerance of LcMYB1-overexpressing plants to salt stress. Altogether, we identified the MYB-related transcription factor LcMYB1 that was distinctly induced by salt stress. The overexpression of LcMYB1 accumulated compatible osmolytes, such as soluble sugars and proline in transgenic Arabidopsis, and reduced the accumulation of MDA under salt stress. We speculate that LcMYB1 transgenic plants increase salt tolerance by regulating down-stream gene expression and accumulating more compatible osmolytes. Sheepgrass is a pivotal forage grass in the Eurasian arid steppe due to its adaptability to harsh environments. Based on our results, sheepgrass can contribute excellent gene resources for molecular breeding to enhance salt stress tolerance in other plants. Previous reports have shown that growth retardation phenotypes are detected in transgenic plants overexpressing abiotic stress-related genes [35,36]. As the plants overexpressing LcMYB1 have no growth retardation or late flowering abnormal phenotypes, LcMYB1 provides a promising gene resource for improving the salinity tolerance of crops. 4. Materials and methods 4.1. Plant materials and treatments Sheepgrass (Zhongke No. 2) seeds were grown at 27/23  C for 16 h in the light and 8 h in the dark in repetition in a greenhouse for 8

L. Cheng et al. / Plant Physiology and Biochemistry 70 (2013) 252e260

257

Fig. 5. Response to salt stress in Arabidopsis transgenic plants overexpressing LcMYB1. (aec) Seven-day-old seedlings were transferred to 1/2MS medium supplemented with 150 mM NaCl for 21 days before the images shown were taken. (d) Survival rate of transgenic and WT plants in 1/2MS medium supplemented with 150 mM NaCl. (e) Seven-day-old seedlings were transferred to the 1/2MS medium supplemented with 150 mM NaCl; the root length and weight were measured for 7 days.

weeks before treatments. Seedlings were transferred to a growth chamber at 4  C for cold stress experiments. For salt, abscisic acid (ABA) and drought stress treatments, seedlings were irrigated with 400 mM NaCl, 100 mM ABA and 20% PEG6000, respectively. The seedlings were sampled at 0, 1, 3, 6, 12 and 24 h after stress treatments. All of the samples were immediately frozen in liquid nitrogen and stored at
80  C for RNA analysis. Leaf, shoot, rhizome, bud,

panicle, and root tissues were also collected from 2-year-old plants grown in a greenhouse under the conditions described above. 4.2. Isolation and sequence analysis of LcMYB1 A large number of salt response genes were obtained by 454 high-throughput sequencing of sheepgrass, including 76 MYB

258

L. Cheng et al. / Plant Physiology and Biochemistry 70 (2013) 252e260

family genes. These genes were analyzed using bioinformatics and RT-PCR methods. An unknown gene, designated as LcMYB1, was significantly activated by salt stress and is a candidate gene for further research to determine its function. To obtain the full-length sequence of LcMYB1, total RNA was extracted from 2-week-old sheepgrass (variety Zhongke No. 2) seedlings using the Trizol reagent (TaKaRa Biotechnology Co., Ltd., Japan) according to the manufacturer’s protocol. The first-strand cDNA for the amplification of the 50 and 30 ends of LcMYB1 was synthesized with the SMARTerÔ RACE cDNA Amplification Kit (Clontech); the 50 and 30 ends of LcMYB1 were cloned according to the manufacturer’s protocol. The RACE primers for LcMYB1 were designed according to the results obtained from 454 highthroughput sequencing (specifically paying attention to the 76 MYBs identified). The gene specific primers were as follows: 5GSP: 50 -GGTATCTGCCCAGTCTACTTCC-30 and 3GSP: 50 -GTCTTTCTTTCGGT GAATAGCC-30 . A putative full-length LcMYB1 cDNA was amplified using the following pair of primers: 50 -CTCCAAATCCCTAACTCCCCAAT-30 and 50 -GACTCCAATTGACCCAAGCTC-30 . The cDNA products were cloned into the pMD18-T vector (TaKaRa) and sequenced. Multiple sequence alignments and phylogenetic analyses were performed using DNAMAN v5.0 (Lynnon Biosoft Inc., Vandreuil, Quebec, Canada). 4.3. Analysis of expression patterns under differing stress conditions Real-time PCR was completed with the following primers: 50 GTTGTGGATGCTGGCAATGTTGG-30 and 50 -CAAAGGCACAGCAAGTCCGCAT-30 on a qPCR machine (MX3000p, Strategene, CA, USA) using the SYBR PrimeScriptÔ RT-PCR Kit (TaKaRa). Constitutive expression of L. chinensis actin was monitored as a positive control (Table 1). Information about the other primers used in qPCR can be found in Table 1. 4.4. Subcellular localization of the LcMYB1 protein Fig. 6. Effect of salt stress on proline, soluble sugars and MDA content in WT and transgenic plants under normal growth conditions and salt stress. Plants were exposed to 150 mM NaCl for 2 days and then collected for the determination of (a) proline, (b) soluble sugar and (c) MDA contents. Data represent the mean  SE of three replicates. Asterisks indicate statistically significant differences (P < 0.05) between WT and transgenic lines.

Subcellular localization of the LcMYB1 protein was determined by cloning the green fluorescent protein (GFP) to the end of the LcMYB1 protein to create a fusion protein. The entire coding region of the target gene was amplified by PCR and inserted into the NcoI and SpeI sites of the vector pCAMBIA1302. The recombinant

Fig. 7. Expression level of salt-responsive genes in WT and transgenic plants. Total RNA was extracted from WT and transgenic seedlings grown in 1/2MS medium for 2 weeks and transferred to 1/2MS supplemented with 150 mM NaCl. The samples were taken at 0 h, 6 h, 12 h, and 24 h after salt stress treatment. The transcript levels were measured by realtime RT-PCR. Actin was used as an internal control. The expression levels of salt-responsive genes P5CS1, ABF3, MYB2 and DREB1A in WT plants and transgenic plant lines L114 and L101 under salt stress, respectively.

L. Cheng et al. / Plant Physiology and Biochemistry 70 (2013) 252e260

259

Table 1 Primer used for quantitative real-time PCR. Primer

Sequence

Primer

Sequence

Function

LcACTIN-S LcMYB1-S AtACTIN-S AtABF3-S AtP5CS1-S AtP5CS2-S AtMYB2-S AtDREB1A-S AtDREB2A-S AtRAB18-S AtRD22-S AtRD26-S AtRD29A-S AtRD29B-S AtSOS1-S AtSTZ-S

TGCTGACCGTATGAGCAAAG GTTGTGGATGCTGGCAATGTTGG TGCTGACCGTATGAGCAAAG AACGCTGGGAGAGATGACTTTGGA TAGCACCCGAAGAGCCCCAT AAGCACTCGCAGAGCCCCCT AACGTCTTCGAATTCTCCGGCTGA AGGAGACGTTGGTGGAGGCT AAACCTGTCAGCAACAACAGCAGG CCACGAGAAGAAGGGGATGAT GGCGATTCGTCTTCCTCT GCACGAGTATCGCTTAATAGAACA TGTGCCGACGGGATTTGACGGA GCAAGCAGAAGAACCAATCA TCGACGCGACGATGGCGTATAGA ATTTCCACCACCAAAACCTCAC

LcACTIN-AS LcMYB1-As AtACTIN-AS AtABF3-AS AtP5CS1-AS P5CS2-AS AtMYB2-AS AtDREB1A-AS AtDREB2A-AS AtRAB18-AS AtRD22-AS AtRD26-AS AtRD29A-AS AtRD29B-AS AtSOS1-AS AtSTZ-AS

GATTGATCCTCCGATCCAGA CAAAGGCACAGCAAGTCCGCAT GATTGATCCTCCGATCCAGA TCCCAAGACCTCCATTACTGCCAA TTTCAGTTCCAACGCCAGTAGA AGCTCTAGCGACAGAAGAGCGGC ATCGTTGAACTCTCCGAAACCCGT ACGTCGTCATCATCGCCGTC TTAAGCCTGCAAACACATCGTCGC CGAATGCGACTGCGTTACAA GAGTGTTTGGTAAAGCAGTGC CGACACAACACCCAATCATC TCCGTCTTTGGGTCTCTTCCCAGC CTTTGGATGCTCCCTTCTCA AGAACGGCGTCGACAGGGCT AGCTCAACTTCTCCACCGCC

qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR

plasmid, p1302-LcMYB1-GFP, was introduced into the Agrobacterium tumefaciens strain EHA105. Arabidopsis transformation and selection was performed as described in Peng et al. [24]. The root tip cells of transformed Arabidopsis were observed using a laser confocal scanning microscope (Leica TCS SP5). 4.5. Transcriptional activity of the LcMYB1 protein The full-length coding sequence of LcMYB1 was amplified using the primers 50 -GGAATTCATGGAGAAGGAGGTGTGTGAA-30 and 50 CGGGATCCCTACATGATGGGTGGAAGAA-30 . The PCR products were inserted into the EcoRI and BamHI restriction sites of the yeast expression vector pBridge containing the GAL4 DNA-binding domain (BD) to obtain pBD-LcMYB1. The pBD-LcMYB1 vector, a positive control that expresses pGAL4 (Clontech), and the pBD vector, a negative control, were both transformed into the yeast strain AH109 (Clontech). Transformed yeast strains were cultured in SD medium without SD/-His-Trp. The transcriptional activity of the proteins was evaluated according to their growth status [24]. The colony-filtering b-galactosidase assay was conducted according to the Yeast Protocols Handbook. 4.6. Arabidopsis transformation The full-length LcMYB1 cDNA was inserted into the BamHI and SmaI sites of the p3301-121 vector (modified from the pCAMBIA3301 and pBI121vectors and donated by the Shen lab) and was under the control of the CaMV 35S promoter and nos terminator. The recombinant plasmid was transformed into Arabidopsis thaliana (ecotype: Columbia-0) by A. tumefaciens EHA105 using the floral dip method (Clough and Bent 1998). The seeds of the transgenic Arabidopsis was screened in Murashige and Skoog (MS) medium supplemented with 20 mg L
1 glufosinate ammonium and T1 transgenic seedlings were identified by PCR using primers targeting the GUS gene (50 -ACGGCAAAGTGTGGGTCAA-30 and 50 -GCGTAAGGGTAATGCGAGG-30 ) and LcMYB1 (50 -CGGGATCCATGGAGAAGGAGGTGTGTGAA-30 and 50 TCCCCCGGGCTACATGATGGG TGGAAGAA-30 ). T2 generation plants were used for the stress tolerance analyses. 4.7. Salt tolerance analysis of transgenic plants For germination tests, the seeds of the WT and transgenic plants were grown in normal 1/2MS medium and 1/2MS medium supplemented with 150 mM NaCl. The germination rates were calculated at 10 and 14 days after salt stress treatment. T2 generation

transgenic Arabidopsis seedlings (WT and transgenic LcMYB1 plants) were grown in 1/2MS medium in a growth chamber with 16 h of light (22  C) and 8 h of darkness (20  C) for 1 week and then transferred to the 1/2MS medium containing 150 mM NaCl for observation. The root lengths of WT and transgenic plants grown upright were surveyed 7 days after salt stress treatment. After 3 weeks of treatment, the phenotype was photographed, and the survival rates were calculated. Salt tolerance experiments were repeated at least three times. Acknowledgments This work was supported by the National Natural Science Foundation of China (31170316), the National Natural Science Foundation of China (3097029); and the National High Technology and Research Development Program of China (‘863’ project) (2011AA100209); the Chinese Ministry of Agriculture Research Program (2011ZX08009-003-002); and Ningxia agricultural comprehensive development land management science and technology promotion project (NNTK-11-04). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.plaphy.2013.05.025. References [1] M. Chen, Z.H. Li, S.J. Pu, The observation and research on reproductive characteristics of Aneurolepidium chinensis, Res. Grassl. Ecosyst. 2 (1988) 193e208. [2] L. Wang, D.L. Wang, Z.B. He, G.F. Liu, K.C. Hodgkinson, Mechanisms linking plant species richness to foraging of a large herbivore, J. Appl. Ecol. 47 (2010) 868e875. [3] J.S. Liu, L. Wang, D.L. Wang, S.P. Bonser, F. Sun, Y.F. Zhou, Y. Gao, X. Teng, Plants can benefit from herbivory: stimulatory effects of sheep saliva on growth of Leymus chinensis, PLoS One 7 (2012) e29259. [4] H. Yan, W. Zhao, S.J. Yin, D.C. Shi, D.W. Zhou, Different physiological responses of Aneurolepidium chinensis to NaCl and Na2CO3, Acta Pratacult. Sin. 15 (2006) 49e55. [5] H.Y. Ma, Z.W. Liang, Effects of different soil pH and soil extracts on the germination and seedling growth of Leymus chinensis, Chin. Bull. Bot. 24 (2007) 181e188. [6] H. Jin, H.R. Kim, P. Plaha, S.K. Liu, J.Y. Park, Y.Z. Piao, Z.H. Yang, G.B. Jiang, S.S. Kwak, G. An, M. Son, Y.H. Jin, J.H. Sohn, Y.P. Lim, Expression profiling of the genes induced by Na2CO3 and NaCl stresses in leaves and roots of Leymus chinensis, Plant Sci. 175 (2008) 784e792. [7] W.X. Wang, B. Vinocur, A. Altman, Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance, Planta 218 (2003) 1e14. [8] J.K. Zhu, Salt and drought stress signal transduction in plants, Annu. Rev. Plant Biol. 53 (2002) 247e273.

260

L. Cheng et al. / Plant Physiology and Biochemistry 70 (2013) 252e260

[9] V. Chinnusamy, A. Jagendorf, J.K. Zhu, Understanding and improving salt tolerance in plants, Crop Sci. 45 (2005) 437e448. [10] C. Dubos, R. Stracke, E. Grotewold, B. Weisshaar, C. Martin, L. Lepiniec, MYB transcription factors in Arabidopsis, Trends Plant Sci. 15 (2010) 573e581. [11] A. Katiyar, S. Smita, S.K. Lenka, R. Rajwanshi, V. Chinnusamy, K.C. Bansal, Genome-wide classification and expression analysis of MYB transcription factor families in rice and Arabidopsis, BMC Genomics 13 (2012) 544e582. [12] K. Shinozaki, K. Yamaguchi-Shinozaki, Gene networks involved in drought stress response and tolerance, J. Exp. Bot. 58 (2007) 221e227. [13] Q.B. Ma, X.Y. Dai, Y.Y. Xu, J. Guo, Y.J. Liu, N. Chen, J. Xiao, D.J. Zhang, Z.H. Xu, X.S. Zhang, K. Chong, Enhanced tolerance to chilling stress in OsMYB3R-2 transgenic rice is mediated by alteration in cell cycle and ectopic expression of stress genes, Plant Physiol. 150 (2009) 244e256. [14] C. Vannini, F. Locatelli, M. Bracale, E. Magnani, M. Marsoni, M. Osnato, M. Mattana, E. Baldoni, I. Coraggio, Overexpression of the rice OsMYB4 gene increases chilling and freezing tolerance of Arabidopsis thaliana plants, Plant J. 37 (2004) 115e127. [15] C.F. Su, Y.C. Wang, T.H. Hsieh, C.A. Lu, T.H. Tseng, S.M. Yu, A novel MYBS3dependent pathway confers cold tolerance in rice, Plant Physiol. 153 (2010) 145e158. [16] X.Y. Dai, Y. Wang, A. Yang, W.H. Zhang, OsMYB2P-1, an R2R3 MYB transcription factor, is involved in the regulation of phosphate-starvation responses and root architecture in rice, Plant Physiol. 159 (2012) 169e183. [17] A. Yang, X.Y. Dai, W.H. Zhang, A R2R3-type MYB gene, OsMYB2, is involved in salt, cold, and dehydration tolerance in rice, J. Exp. Bot. 63 (2012) 2541e2556. [18] X. Mao, D. Jia, A. Li, H. Zhang, S. Tian, X. Zhang, J. Jia, R. Jing, Transgenic expression of TaMYB2A confers enhanced tolerance to multiple abiotic stresses in Arabidopsis, Funct. Integr. Genomics 11 (2011) 445e465. [19] L.C. Zhang, G.Y. Zhao, J.J. Jia, X. Liu, X.Y. Kong, Molecular characterization of 60 isolated wheat MYB genes and analysis of their expression during abiotic stress, J. Exp. Bot. 63 (2012) 203e214. [20] L.C. Zhang, G.Y. Zhao, J.J. Jia, X. Liu, X.Y. Kong, A wheat R2R3-MYB gene, TaMYB30-B, improves drought stress tolerance in transgenic Arabidopsis, J. Exp. Bot. 63 (2012) 5873e5885. [21] L.C. Zhang, G.Y. Zhao, J.J. Jia, X. Liu, X.Y. Kong, Overexpression of a wheat MYB transcription factor gene, TaMYB56-B, enhances tolerances to freezing and salt stresses in transgenic Arabidopsis, Gene 505 (2012c) 100e107. [22] Y.Y. He, W. Li, J. Lv, Y.B. Jia, M.C. Wang, G.M. Xia, Ectopic expression of a wheat MYB transcription factor gene, TaMYB73, improves salinity stress tolerance in Arabidopsis thaliana, J. Exp. Bot. 63 (2012) 1511e1522. [23] Y.X. Qin, M.C. Wang, Y.C. Tian, W.X. He, L. Han, G.M. Xia, Over-expression of TaMYB33 encoding a novel wheat MYB transcription factor increases salt and drought tolerance in Arabidopsis, Mol. Biol. Rep. 39 (2012) 7183e7192.

[24] X.J. Peng, X.Y. Ma, W.H. Fan, M. Su, L.Q. Cheng, A. Iftekhar, B.H. Lee, D.M. Qi, S.H. Shen, G.S. Liu, Improved drought and salt tolerance of Arabidopsis thaliana by transgenic expression of a novel DREB gene from Leymus chinensis, Plant Cell Rep. 30 (2011) 1493e1502. [25] X.X. Li, Q. Gao, Y. Liang, T. Ma, L.Q. Cheng, D.M. Qi, H. Liu, X. Xu, S.Y. Chen, G.S. Liu, A novel salt-induced gene from sheepgrass, LcSAIN2, enhances salt tolerance in transgenic Arabidopsis, Plant Physiol. Biochem. 64 (2013) 52e59. [26] S.X. Lu, S.M. Knowles, C. Andronis, M.S. Ong, E.M. Tobin, CIRCADIAN CLOCK ASSOCIATED1 and LATE ELONGATED HYPOCOTYL function synergistically in the circadian clock of Arabidopsis, Plant Physiol. 150 (2009) 834e843. [27] Y. Liao, H.F. Zou, H.W. Wang, W.K. Zhang, B. Ma, J.S. Zhang, S.Y. Chen, Soybean GmMYB76, GmMYB92, and GmMYB177 genes confer stress tolerance in transgenic Arabidopsis plants, Cell Res. 18 (2008) 1047e1060. [28] S.J. Clough, A.F. Bent, Floral dip: a simplified method for Agrobacteriummediated transformation of Arabidopsis thaliana, Plant J. 16 (1998) 735e743. [29] J. Liu, J.K. Zhu, Proline accumulation and salt-stress-induced gene expression in a salt-hypersensitive mutant of Arabidopsis, Plant Physiol. 114 (1997) 591e596. [30] G. Szekely, E. Abraham, A. Cseplo, G. Rigo, L. Zsigmond, J. Csisza, F. Ayaydin, N. Strizhov, J. Jásik, E. Schmelzer, C. Koncz, L. Szabados, Duplicated P5CS genes of Arabidopsis play distinct roles in stress regulation and developmental control of proline biosynthesis, Plant J. 53 (2008) 11e28. [31] P. Kishor, Z. Hong, G.H. Miao, C. Hu, D. Verma, Overexpression of [delta]pyrroline-5-carboxylate synthetase increases proline production and confers osmotolerance in transgenic plants, Plant Physiol. 108 (1995) 1387e1394. [32] G. Fabro, I. Kovács, V. Pavet, L. Szabados, M.E. Alvarez, Proline accumulation and AtP5CS2 gene activation are induced by plantepathogen incompatible interactions in Arabidopsis, Mol. Plant-Microbe Interact. 17 (2004) 343e350. [33] M. Rosa, C. Prado, G. Podazza, R. Interdonato, J.A. González, M. Hilal, F.E. Prado, Soluble sugarsemetabolism, sensing and abiotic stress: a complex network in the life of plants, Plant Signal Behav. 4 (2009) 388e393. [34] A. RoyChoudhury, C. Roy, D.N. Sengupta, Transgenic tobacco plants overexpressing the heterologous lea gene Rab16A from rice during high salt and water deficit display enhanced tolerance to salinity stress, Plant Cell Rep. 26 (2007) 1839e1859. [35] Z.J. Li, L.L. Zhang, A.X. Wang, X.Y. Xu, J.F. Li, Ectopic overexpression of SlHsfA3, a heat stress transcription factor from tomato, confers increased thermotolerance and salt hypersensitivity in germination in transgenic Arabidopsis, PLoS One 8 (2013) e54880. [36] Q. Liu, M. Kasuga, Y. Sakuma, H. Abe, S. Miura, K. Ymaguchi-Shinozakia, K. Shinozakib, Two transcription factors, DREB1 and DREB2, with an EREBP/ AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low temperature-responsive gene expression, respectively, in Arabidopsis, Plant Cell 10 (1998) 1391e1406.