- Email: [email protected]
Overexpression of TtNRAMP6 enhances the accumulation of Cd in Arabidopsis
Gene 696 (2019) 225–232
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Overexpression of TtNRAMP6 enhances the accumulation of Cd in Arabidopsis
T ⁎
Chao Wanga, Xing Chena, Qin Yaoa, Dan Longa, Xing Fana,b, Houyang Kanga,b, Jian Zengc, , ⁎ Lina Shaa,b, Haiqin Zhanga,b, Yonghong Zhoua,b, Yi Wanga,b, a
Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, Sichuan, China Joint International Research Laboratory of Crop Resources and Genetic Improvement, Sichuan Agricultural University, Wenjiang 611130, Sichuan, China c College of Resources, Sichuan Agricultural University, Wenjiang 611130, Sichuan, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Wheat Cadmium TtNRAMP6 Metal transporter
The uptake and translocation of non-essential heavy metals in plant are always through metal transporters for essential micronutrient transport, such as NRAMP (Natural Resistance-Associated Macrophage Protein). NRAMPs from different species exhibit different biological functions, although their sequences are highly identical. In the present study, a NRAMP6 was isolated from Ailanmai (Triticum turgidum L. ssp. turgidum). TtNRAMP6, localized on chromosome 3B, was mainly expressed in roots, followed by other tissues varied with different growth stages. At the seedling stage, TtNRAMP6 was significantly regulated by Cd stress in roots, but not by the deficiency of Zn, Fe or Mg. Subcellular localization analysis indicated that TtNRAMP6 encoded a plasma membrane protein. Expressing-TtNRAMP6 significantly enhanced the Cd concentration in yeast, and increased the Cd sensitivity. Meanwhile, overexpression of TtNRAMP6 also increased the Cd concentration in roots, stems, leaves and the whole plant of Arabidopsis, which indicated that overexpression of TtNRAMP6 enhanced the Cd accumulation. Thus, genetic manipulation of TtNRAMP6 may reduce the uptake of Cd from external solution to wheat, finally protecting the safety of wheat food.
1. Introduction Heavy metals consist of essential micronutrients and non-essential micronutrients. Essential micronutrients are crucial for the plant growth and development, such as iron (Fe) and zinc (Zn); they play important roles in the photosynthesis, the respiration, the chlorophyll biosynthesis, and other basic cellular processes (Kobayashi and Nishizawa, 2012). However, non-essential heavy metals, such as cadmium (Cd) and lead (Pb), can damage the photosynthetic apparatus, affect the nutrient uptake, and then inhibit the plant growth and development to cause serious production reduction (Gravot et al., 2004; Herbette et al., 2006; Verbruggen et al., 2009; Balen et al., 2011). Thus, plants theoretically do not develop metal transporters to specifically transport non-essential heavy metals to injure themselves. The uptake and translocation of non-essential heavy metals in plant are always through metal transporters for essential micronutrient transport, including NRAMP (Natural Resistance-Associated Macrophage Protein), ZIP (Zrt- and Irt-related protein), heavy metal P-type ATPases, and YSL
(Yellow Stripe-Like) transporters (Clemens and Ma, 2016; Williams and Mills, 2005; Verbruggen et al., 2009; Cailliatte et al., 2009; Takahashi et al., 2011, 2012). Of them, increasing studies indicate that members of NRAMP family transport a broad range of metal substrates, which are responsible for metal uptake and translocation, such as Cd, Zn, Fe and Mn (Thomine et al., 2000; Cailliatte et al., 2009; Tiwari et al., 2014). To date, numerous NRAMP genes have been discovered and functionally characterized from various plants, such as Arabidopsis (Curie et al., 2000; Thomine et al., 2000, 2003; Lanquar et al., 2005, 2010; Cailliatte et al., 2009, 2010; Pottier et al., 2015; Gao et al., 2018), rice (Curie et al., 2000; Xia et al., 2010; Takahashi et al., 2011; Sasaki et al., 2012; Ishimaru et al., 2012; Yamaji et al., 2013; Yang et al., 2013; Tiwari et al., 2014; Li et al., 2014; Peris-Peris et al., 2017), Polish wheat (Peng et al., 2018a, 2018b), soybean (Kaiser et al., 2003; Qin et al., 2017), Malus baccata (Xiao et al., 2008), tobacco (Tang et al., 2017), barley (Wu et al., 2016), Thlaspi japonicum (Mizuno et al., 2005), Medicago truncatula (Tejada-Jiménez et al., 2015) and Sedum alfredii (Chen et al., 2017). Of these NRAMPs, only AtNRAMP6 specifically
Abbreviations: NRAMP, Natural Resistance-Associated Macrophage Protein; Cd, cadmium; Fe, iron; Zn, zinc; Pb, lead; Mn, manganese ⁎ Corresponding authors at: J. Zeng, College of Resources, Sichuan Agricultural University, Wenjiang 611130, Sichuan, China; Y. Wang, Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, Sichuan, China. E-mail addresses: [email protected] (J. Zeng), [email protected] (Y. Wang). https://doi.org/10.1016/j.gene.2019.02.008 Received 2 November 2018; Received in revised form 25 January 2019; Accepted 5 February 2019 Available online 12 February 2019 0378-1119/ © 2019 Elsevier B.V. All rights reserved.
Gene 696 (2019) 225–232
C. Wang, et al.
amplification (cDNA from root sample was used as PCR template) and sequence alignment, amino acid sequence predication, gene structure and chromosome localization, putative subcellular localization, transmembrane domains, and phylogenetic analysis of TtNRAMP6 were performed as described by Peng et al. (2018a, 2018b).
transports Cd (Cailliatte et al., 2009); most of NRAMPs can transport Cd and other essential metals such as Mn and Fe, although the essential metal varies from different NRAMPs. Meanwhile, several other NRAMPs can't transport Cd, such as OsNRAMP3 specifically transports Mn (Yamaji et al., 2013; Yang et al., 2013), OsNRAMP4 specifically transports Al (Xia et al., 2010; Li et al., 2014), TjNRAMP4 specifically transports Ni (Mizuno et al., 2005), and OsNRAMP6 transports Mn and Fe (Peris-Peris et al., 2017). Thus, different NRAMPs transport different metals, which may be resulted from some residue differences among these NRAMPs (Pottier et al., 2015; Tang et al., 2017). For Triticeae, only three NRAMPs, TpNRAMP3 and TpNRAMP5 from Triticum polonicum (Peng et al., 2018a, 2018b) and HvNRAMP5 from Hordeum vulgare (Wu et al., 2016), are identified. As homologous of OsNRAMP5 which transports Cd, Mn and Fe (Sasaki et al., 2012; Ishimaru et al., 2012; Yang et al., 2013), TpNRAMP5 and HvNRAMP5 transport Cd and Mn but not Fe (Wu et al., 2016; Peng et al., 2018b), although their residue differences do not change their expression patterns. TpNRAMP3 is 90% identity with OsNRAMP3, but their expression patterns and metal substrates transport are different. OsNRAMP3 is mainly expressed in nodes, culms and basal stems, but very low expression in roots and leaf blades and sheaths (Yamaji et al., 2013; Yang et al., 2013); TpNRAMP3 is mainly expressed in leaf blades and sheaths, roots and the first node (Peng et al., 2018a). Meanwhile, TpNRAMP3 transports Cd and Mn (Peng et al., 2018a), but OsNRAMP3 specifically transports Mn but not Cd (Yamaji et al., 2013; Yang et al., 2013). These results indicate that NRAMPs from different species exhibit different biological functions, although their sequences are highly identical. Recently, Peris-Peris et al. (2017) found that OsNRAMP6 could transport Mn and Fe but not Cd. As its homologous, we hypothesized that a NRAMP6 from Triticum might transport Cd. To test this hypothesis, we isolated a NRAMP6 from a tetraploid wheat (Ailanmai, Triticum turgidum L. ssp. turgidum, 2n = 4× = 28, AABB) which is a landrace of Sichuan, China. Its biological functions were revealed by analyzing its expression pattern at the wheat growth season or under metal stresses, and the effects of TtNRAMP6 expression on metal tolerance and accumulation in yeast, and overexpressing Arabidopsis.
2.3. Relative expression analysis of TtNRAMP6 TtNRAMP6-specific expression primers (Forward: GTCAGCATCCG TACTATTCAAGAA; Reverse: TGGTGAGACAGGGAGCAAA) were designed by the Beacon designer 7.0 for quantitative real-time PCR (qPCR). The Actin gene described by Wang et al. (2015) was used as a reference gene to normalize the relative expression level of TtNRAMP6. Then qPCR and calculation of the relative expression level were performed as described by Wang et al. (2015) with minor modification. Briefly, each PCR volume was 25 μL, including 1 μL forward primer (4 pmol/μL), 1 μL reverse primer (4 pmol/μL), 15 μL iTaq™ universal SYBR® green supermix (Bio-Rad), and 8 μL cDNA. The relative expression level was normalized using the 2ΔΔCt method by the CFX Manager 3.1 software (Bio-Rad). 2.4. Functional analysis in yeast
At the wheat growth season (October 2017 to May 2018), Ailanmai was grown in the field of Sichuan Agricultural University, Chengdu, China. Total 23 tissues, including 5 tissues (root, basal stem, leaf sheath, leaf blade, and young leaf) from the jointing stage, 11 tissues (root, basal stem, low leaf sheath, low leaf blade, node III, inter node II, node II, node I, flag leaf sheath, flag leaf blade, and peduncle) from the booting stage, and 7 tissues (root, node I, flag leaf sheath, flag leaf blade, inter node I, lemma, and immature grain) from the grain filling stage, were collected with three biological replicates. For metal stresses, seedlings of Ailanmai were grown in Hoagland nutrient solution in a growth chamber at 25 °C with 16/8 h light/dark. At the three-leaf stage, seedlings were individually treated with deficiency of MgCl2 (Mg), ZnSO4 (Zn), FeCl3 (Fe) or CuCl2 (Cu), or with supply of 40 μM CdCl2 (Cd) for 24 h. Roots and leaves were individually collected. All collected tissues were snap-frozen in liquid nitrogen and stored at −80 °C for RNA extraction. RNA isolation and cDNA synthesis were performed as described by Peng et al. (2018a, 2018b).
The open reading frame of TtNRAMP6 was amplified using primers (Forward: CGGGGTACCATGGAAGAGAGGGGAAGC; Reverse: GCTCTA GAGCAATGTAGAGCCAAAACTTCATC), and then was sub-cloned into the Kpn I and Xba I sites of empty vector pYES2 using the method of double endonuclease restriction. The recombinant plasmid and the empty vector were individually transformed into yeast strains [wild type (BY4743), Cd-sensitive strain Δycf1 (YDR135), and Zn-sensitive strain Δzrc1 (YMC243)] as described by Wang et al. (2012). The positively transformed yeasts were confirmed as described by Peng et al. (2018a, 2018b) using PCR with TtNRAMP6-specific expression primers. Firstly, the metal tolerance of the transformed yeast strains was analyzed on synthetic defined (SD) plate medium. Briefly, each yeast strain was cultured in liquid SD medium at 30 °C for 20 h. The OD600 value of each suspension was adjusted to 0.6, and then was sequentially diluted to four gradients (1:10, 1:100, 1:1000, and 1:10000). 5 μL of each dilution was spotted on SD plate medium containing 2% galactose, and with CdCl2 (0 and 60 μM), ZnCl2 (0 and 6 mM), MnCl2 (0 and 10 mM), or FeSO4 (0 and 20 mM). All plates were incubated at 30 °C for 72 h to investigate the metal sensitivity. Strains of YDR135 and YMC243 transformed with TtNRAMP6 were used to test Cd and Zn tolerance, respectively; strain of BY4743 transformed with TtNRAMP6 was used to test Fe and Mn tolerance; strains of BY4743, YDR135 and YMC243 transformed with pYES2 were used as controls. To confirm the Cd tolerance grown on SD plate medium, the yeast growth curves grown in liquid SD medium with 40 μM CdCl2 were investigated as described by Peng et al. (2018b). The OD600 values were investigated at 0, 4, 8, 20, 32 and 56 h using a microplate spectrophotometer (Fisher Scientific). To reveal whether expression of TtNRAMP6 in yeast could influence the Cd accumulation, the Cd concentration of each yeast strain was measured as described by Peng et al. (2018b). Briefly, 20 μL yeast cells with OD600 = 0.5 were cultured in 350 mL liquid SD medium containing 40 μΜ CdCl2 for 48 h. After centrifugation, the precipitated cells were washed with 100 μM EDTA for twice and deionized water for three times, and dried at 80 °C. All samples were digested in mixed acid (VHNO3:VHClO3 = 1:4) at 180 °C for 4 h. The Cd concentration was measured by ICP-MS (Fisher Scientific, USA).
2.2. TtNRAMP6 cloning, bioinformatics and phylogenetic analysis
2.5. Subcellular localization of TtNramp6
According to the sequence of TpNRAMP6 (KX165387), PCR primers (Forward: AGACGAGAAGAGAAATGGAA; Reverse: CGTCTCCAAAACA AGGTCTG) for the cDNA of TtNRAMP6 were designed. PCR
The open reading frame of TtNRAMP6 without the stop codon was cloned into the BamH I and Spe I sites of HBT95-GFP vector, and the primers (Forward: CGCGGATCCATGGAAGAGAGGGGAAGC; Reverse:
2. Materials and methods 2.1. Plant growth, sample collection, RNA isolation and cDNA synthesis
226
Gene 696 (2019) 225–232
C. Wang, et al.
CTAGACTAGTATGTAGAGCCAAAACTTCATC) were designed by the Beacon designer 7.0. Arabidopsis protoplasts were prepared as described by Yoo et al. (2007). Recombined plasmid of HBT95-TtNRAMP6-GFP (10 μL, 1.5 μg/μL) was transformed into prepared protoplasts using 40% PEG solution (8 g PEG4000, 4 mL 0.2 M Mannitol, 2 mL 0.1 M CaCl2, 6 mL H2O) at 23 °C for 30 min, and then diluted by solution A (10 mL 154 mM NaCl, 12.5 mL 125 mM CaCl2, 2.5 mL 5 mM KCl, 2 mL 2 mM MES with pH = 5.7, and 73 mL H2O). The dilution was centrifuged with 100 g for 8 min, and suspended by solution B (5 mL 0.5 M Mannitol, 1 mL 20 mM KCl, 400 μL 4 mM MES with pH = 5.7, and 3.6 mL H2O) at 23 °C with dark. After overnight cultivation, the cell suspension was centrifuged again, and resuspended by solution B, then incubated with 5 μL Dil (1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate, red fluorescence) (Sigma-Adrich, USA) under dark for 20 min. After centrifugation, cells were resuspended by solution B again and incubated with 1 μL DAPI (blue fluorescence) under dark for 5 min. After twice washing with solution B, a confocal laser scanning microscope (Olympus, Japan) was used to observe the signals under 405 nm and 488 nm. Dil and DAPI are plasma membrane and nucleus dyes, respectively. 2.6. Functional analysis of TtNRAMP6 in overexpressing Arabidopsis Fig. 1. Phylogenetic tree of TtNRAMP6 with NRAMPs from Arabidopsis, rice and other plants. The phylogenetic tree was constructed based on sequence alignment of NRAMP homologous from Arabidopsis, rice, Polish wheat and barley, including AtNRAMP1 to AtNRAMP6 (AF165125, AF141204, AF202539, AF202540, NM_117995.2, NM_101464.4). OsNRAMP1 to OsNRAMP7 (AK121534.1, L81152.1, AK070574.1, AB125305, AK070788.1, Os01g0503400, Os12g39180), TpNRAMP3 (KX165384.1), TpNRAMP5 (KX165386.1), HvNRAMP5 (AK364374.1), and TtNRAMP6 (MK098501).
The open reading frame of TtNRAMP6 was sub-cloned into the Kpn I and Xba I sites of vector pCambia1305. The recombined vector and empty vector were individually introduced transferred into wild-type Arabidopsis (Columbia ecotype) by floral infiltration using agrobacterium (Bent et al., 1994). The positive and homozygous TtNRAMP6-expressing lines, wild type and transgenic vector lines were used to analyze the Cd tolerance and accumulation as described by Peng et al. (2018a, 2018b). 3. Results and discussions
expression of TtNRAMP6 in node I was higher than other tissues. These results indicated that TtNRAMP6 mainly functioned in roots at whole growth stage, and also in other tissues varying with different growth stages. In plant, several NRAMPs mainly expressed in roots, including OsNRAMP1 (Takahashi et al., 2011), OsNRAMP5 (Tang et al., 2017), HvNRAMP5 (Wu et al., 2016), GmNRAMP7 (Qin et al., 2017) and TpNRAMP5 (Peng et al., 2018b). All proteins encoded by these genes (except of GmNRAMP7) could transport Cd for it was uptake in roots (Takahashi et al., 2011; Ishimaru et al., 2012; Sasaki et al., 2012; Wu et al., 2016; Tang et al., 2017; Peng et al., 2018b). Thus, TtNRAMP6 might be responsible for metal uptake in wheat. The expression level of TtNRAMP6 in roots and leaves was not regulated by the deficiency of Zn, Mg, Fe or Cu (Fig. 2B, C), but was down-regulated by the deficiency of Cu in leaves (Fig. 2C). It was upregulated by the supply of Cd in roots (Fig. 2D), but not in leaves (Fig. 2E). Thus, the response of TtNRAMP6 to metal stresses was also different from OsNRAMP5 (Ishimaru et al., 2012; Sasaki et al., 2012; Yang et al., 2013), HvNRAMP5 (Wu et al., 2016), TpNRAMP3 and TpNRAMP5 (Peng et al., 2018a, 2018b). For example, TpNRAMP3 and TpNRAMP5 were not regulated by Cd stress (Peng et al., 2018a, 2018b); HvNRAMP5 was only regulated by the deficiency of Fe, but not by the supply of Cd (Wu et al., 2016); OsNRAMP5 was significantly up-regulated by the deficiency of Zn or Fe, but not by the deficiency of Cu and Mn (Sasaki et al., 2012; Yang et al., 2013). Although OsNRAMP3 was not regulated by the deficiency of Zn, Fe, Mn or Cu (Yamaji et al., 2013; Yang et al., 2013), it was unknown that whether OsNRAMP3 could be regulated by Cd. Interestingly, the expressions of OsNRAMP1 and SaNRAMP6 in roots were dramatically regulated by Cd stress; meanwhile, they were also responsible for Cd accumulation (Takahashi et al., 2011; Chen et al., 2017). Thus, these results implied that TtNRAMP6 might be responsible for Cd uptake in wheat.
3.1. Characterization of TtNRAMP6 1679 bp cDNA of TtNRAMP6 (MK098501), including 1629 bp open reading frame, 14 bp of 5′-UTR and 36 bp of 3′-UTR, was amplified. TtNRAMP6 encoded 543 amino acids, which was shorter than OsNRAMP6 with 550 amino acids (Peris-Peris et al., 2017). Phylogenetic analysis indicated that TtNRAMP6 was closely clustered with OsNRAMP6 with a 67.9% identity (Fig. 1). Using the open reading frame of TtNRAMP6 to search against the wheat genome (The International Wheat Genome Sequencing Consortium, 2014) indicated that TtNRAMP6 was localized on the chromosome 3B (gene: TRIAE_CS42_3B_TGACv1_225495_AA0809010), which including 13 introns and 14 exons. Subcellular localization predication indicated that TtNRAMP6 was a plasma membrane protein and had 10 transmembrane domains (SFig. 1). Although OsNRAMP6 was a plasma membrane protein, it contained 9 transmembrane domains (Peris-Peris et al., 2017). Importantly, transmembrane domains positively discriminate the transport substrate specificity and the expression pattern of metal transporters (Ueno et al., 2010). These results implied that the expression patterns and metal transport substrates were different. 3.2. Expression patterns of TtNRAMP6 The expression pattern of TtNRAMP6 was investigated in various tissues at the jointing, the booting and the grain filling stages. At all stages, TtNRAMP6 mainly expressed in roots (Fig. 2A); however, it varied in other tissues at different stages. At the jointing stage, the expression levels of TtNRAMP6 in leaf sheathes, leaf blades and young leaves were higher than that in basal stems (Fig. 2A). At the booting stage, the expression level of TtNRAMP6 in basal stems was similar with that in flag leaf sheathes and peduncles; the lowest expression was investigated in node I (Fig. 2A). However, at the grain filling stage, the 227
Gene 696 (2019) 225–232
C. Wang, et al.
Fig. 2. Relative expression level of TtNRAMP6. A: relative expression of TtNRAMP6 of various tissues at three growth stages; B–C: relative expression of TtNRAMP6 in roots and leaves under the deficiency of Fe, Zn, Cu or Mg; D–E: relative expression of TtNRAMP6 in roots and leaves under Cd stress. The bar represented standard error of three biological replicates; asterisks represented significant difference between treatment and control at P < 0.05 by Tukey's test.
HvNRAMP5, TpNRAMP3, TpNRAMP5 and SaNRAMP6 (Thomine et al., 2000; Takahashi et al., 2011; Wu et al., 2016; Chen et al., 2017; Peng et al., 2018a, 2018b). Additionally, these transporters could transport other metals. For example, OsNRAMP1 transports Fe (Takahashi et al., 2011); OsNRAMP5, AtNRAMP1 and AtNRAMP3 transport Fe and Mn (Thomine et al., 2000; Ishimaru et al., 2012; Ihnatowicz et al., 2014; Tang et al., 2017); HvNRAMP5 transports Mn (Wu et al., 2016). In this study, expression of TtNRAMP6 did not influence the yeast growth under Zn, Fe or Mn stress (SFig. 2A, B), which implied that TtNRAMP6 could not transport Zn, Fe and Mn in yeast. Conversely, expression of OsNRAMP6 in yeast indicated that OsNRAMP6 could transport Fe and Mn, but not Cd (Peris-Peris et al., 2017). Thus, the function of TtNRAMP6 was different from OsNRAMP6, although they had a 67.9% identity. The differences might be resulted from the residue differences that caused the change of the putative protein structures and the metal transport substrates.
3.3. Expressing-TtNRAMP6 enhanced the Cd accumulation to increase the Cd sensitivity in yeast NRAMPs were involved in one or several metal(s) transport, including Fe, Mn, Zn, Al and/or Cd (Peris-Peris et al., 2017). In this study, expression of TtNRAMP6 in the Cd sensitive yeast strain YDR135 inhibited the growth when compared with YDR135 and BY4743 transformed with empty vector pYES2 (Fig. 3A). Similar results were revealed by the yeast growth curves experiment. The OD600 values of YDR135 transformed with TtNRAMP6 were significantly lower than these of YDR135 and BY4743 transformed with pYES2 (Fig. 3B). Meanwhile, the Cd concentration of yeast YDR135 transformed with TtNRAMP6 was significantly higher than that of YDR135 and BY4743 transformed with pYES2 (Fig. 3C). These results indicated that expression of TtNRAMP6 enhanced the Cd accumulation to increase the Cd sensitivity in yeast. Similar results were also found in other NRAMPs, including OsNRAMP1, AtNRAMP1, AtNRAMP3, AtNRAMP4, 228
Gene 696 (2019) 225–232
C. Wang, et al.
Fig. 3. Cd sensitivity and concentration of expressing-TtNRAMP6 yeast. A: growth of expressing-TtNRAMP6 yeast grown on SD medium plate with 0 or 60 μM CdCl2; B: OD600 values of expressing-TtNRAMP6 yeast grown in liquid SD medium with 0 or 40 μM CdCl2 at 0, 4, 8, 20, 32, and 56 h; C: Cd concentration in yeasts. Asterisk indicated significant difference between YDR135TtNRAMP6 and YDR135-pYES2 at P < 0.05 by Tukey's test.
and HvNRAMP5 reduced the Cd concentration in roots and leaves (Sasaki et al., 2012; Ishimaru et al., 2012; Wu et al., 2016; Tang et al., 2017); AtNRAMP3 and AtNRAMP4 were involved in the intercellular Cd transport (Lanquar et al., 2005, 2010); and AtNRAMP6 was involved in intracellular Cd transport (Cailliatte et al., 2009). In this study, overexpression of TtNRAMP6 enhanced the Cd accumulation in Arabidopsis, but did not affect it translocation (Fig. 6E, F), which were same as the results of overexpression of SaNRAMP6 (Chen et al., 2017), TpNRAMP3 or TpNRAMP5 (Peng et al., 2018a, 2018b). Additionally, TtNRAMP6 mainly expressed in roots at whole growth stages (Fig. 2A) and encoded a plasma membrane protein. As a Cd transporter, TtNRAMP6 thereby should be responsible for the Cd uptake in roots from external solution.
3.4. TtNRAMP6 was a plasma membrane protein To investigate the subcellular localization of TtNRAMP6, HBT95TtNRAMP6-GFP was transiently transformed into Arabidopsis protoplasts, and empty vector (HBT95-GFP) was used as a control. The green fluorescence of empty vector accumulated predominantly in plasma membrane, nucleus and cytosol (Fig. 4A). DAPI and Dil also specifically marked cell nucleus and plasma membrane (Fig. 4), respectively. The green fluorescence of HBT95-TtNRAMP6-GFP accumulated predominantly in plasma membrane, but not nucleus (Fig. 4B). The merged result of GFP and Dil indicated that TtNRAM6 was a plasma membrane protein. Similarly, TpNRAMP3 and TpNRAMP5 cloned from Polish wheat also encode plasma membrane proteins as ducumented in previous studies (Peng et al., 2018a, 2018b). Meanwhile, all NRAMPs cloned from rice were plasma membrane proteins (Sasaki et al., 2012; Yamaji et al., 2013; Yang et al., 2013; Li et al., 2014; Peris-Peris et al., 2017).
4. Summary TtNRAMP6, localized on the chromosome 3B, was mainly expressed in roots at whole growth stage. TtNRAMP6 was regulated by Cd, but not by the deficiency of other essential metals such as Fe, Zn and Mn. TtNRAMP6 encoded a Cd transporter for Cd accumulation, which was supported by the following: (1) expression of TtNRAMP6 enhanced the Cd concentration to increase the Cd sensitivity in yeast; (2) overexpression of TtNRAMP6 enhanced the Cd concentration in roots, stems, leaves and the whole plant. Expression of TtNRAMP6 did not affect the sensitivity to other metals including Zn, Fe and Mn in yeast. Thus, the function of TtNRAMP6 is different from its homologues including OsNRAMP1, OsNRAMP5 and OsNRAMP6 transport Mn and Fe (Takahashi et al., 2011; Sasaki et al., 2012; Tiwari et al., 2014; PerisPeris et al., 2017), and HvNRAMP5, TpNRAMP3 and TpNRAMP5 transport Mn (Wu et al., 2016; Peng et al., 2018a, 2018b), although they are all plasma membrane proteins.
3.5. Overexpressing-TtNRAMP6 enhanced the Cd accumulation in Arabidopsis To confirm that TtNRAMP6 transported Cd in yeast, we tested that whether overexpression of TtNRAMP6 could affect Cd accumulation and translocation in Arabidopsis. Under normal growth condition (control), overexpression of TtNRAMP6 significantly promoted the growth of plants when compared with wild type and transformed empty vector line (Fig. 5A, B). Under 500 μM CdCl2 stress, overexpression of TtNRAMP6 gave rise to slightly chlorosis (Fig. 5A), which was one of the symptoms of Cd toxicity; meanwhile, it also significantly reduced the dry weight at the maturity stage (Fig. 5B). At the maturity stage, we also investigated the Cd concentration of root, stem and leaf under Cd stress. Overexpression of TtNRAMP6 significantly increased the Cd concentration in roots (Fig. 6A), stems (Fig. 6B), leaves (Fig. 6C) and the whole plant (Fig. 6D), but did not affect the Cd translocation factors (the Cd concentration ratio that root to stem or leaf). These results indicated that overexpression of TtNRAMP6 enhanced the Cd accumulation in Arabidopsis, so that caused Cd toxicity to reduce biomass. Previous studies indicated that many NRAMPs were involved in Cd transport, including root cell uptake from external solution, transport within plant and/or intercellular translocation. For instance, OsNRAMP1 participated in cellular Cd uptake and Cd transport within plants (Takahashi et al., 2011); OsNRAMP5 and HvNRAMP5 were responsible for the Cd uptake in roots, because knockout of OsNRAMP5
Acknowledgements The authors thank the National Natural Science Foundation of China, China (No 31671688, 31670387 and 31870309) for all financial support. The authors thank associated Prof. Yan Huang (Sichuan Agricultural University) for supporting the plasmid of pCambia1305. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.gene.2019.02.008. 229
Gene 696 (2019) 225–232
C. Wang, et al.
Fig. 4. Subcellular localization of TtNramp6. A: Arabidopsis protoplast transformed with HBT95-GFP vector; B: Arabidopsis protoplast transformed with HBT95-TtNRAMP6-GFP vector. GFP-expressing in protoplasts was shown in green; nucleus was stained by DAPI (blue); plasma membrane was stained by Dil (red); yellow signals indicated the position of TtNRAMP6. Scale bar = 5 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 5. Phenotypic assay of overexpressingTtNRAMP6 Arabidopsis. A: growth of overexpressing-TtNRAMP6 Arabidopsis grown in soil with 0 or 500 μM CdCl2; B: dry weight of overexpressing-TtNRAMP6 Arabidopsis grown in soil with 0 or 500 μM CdCl2 at the maturity stage. Asterisks represented significant difference from CK at P < 0.05 by Tukey's test with three independently biological replicates.
230
Gene 696 (2019) 225–232
C. Wang, et al.
Fig. 6. Cd concentration in different tissues of overexpressing-TtNRAMP6 Arabidopsis. A–D: Cd concentration in roots (A), stems (B), leaves (C), and the whole plant (D); E–F: translocation factors. The bar represented standard error of three biological replicates; asterisks indicated significant difference from wild type and vector at P < 0.05 by Tukey's test with three independently biological replicates.
References
6503–6508. Mizuno, T., Usui, K., Horie, K., Nosaka, S., Mizuno, N., Obata, H., 2005. Cloning of three ZIP/Nramp transporter genes from a Ni hyperaccumulator plant Thlaspi japonicum and their Ni2+ transport abilities. Plant Physiol. Biochem. 43, 793–801. Peng, F., Wang, C., Cheng, Y., Zeng, J., Kang, H., Fan, X., Sha, L., Zhang, H., Zhou, Y., Wang, Y., 2018a. Cloning and characterization of TpNRAMP3, a metal transporter from polish wheat (Triticum polonicum L.). Front. Plant Sci. 9, 1354. Peng, F., Wang, C., Zhu, J., Zeng, J., Kang, H., Fan, X., Sha, L., Zhang, H., Zhou, Y., Wang, Y., 2018b. Expression of TpNRAMP5, a metal transporter from Polish wheat (Triticum polonicum L.), enhances the accumulation of Cd, Co and Mn in transgenic Arabidopsis plants. Planta 247, 1395–1406. Peris-Peris, C., Serra Cardona, A., Sánchez Sanuy, F., Campo, S., Ariño, J., San Segundo, B., 2017. Two NRAMP6 isoforms function as iron and manganese transporters and contribute to disease resistance in rice. Mol. Plant-Microbe Interact. 30, 385–398. Pottier, M., Oomen, R., Picco, C., Giraudat, J., Scholz-Starke, J., Richaud, P., Carpaneto, A., Thomine, S., 2015. Identification of mutations allowing natural resistance associated macrophage proteins (NRAMP) to discriminate against cadmium. Plant J. 83, 625–637. Qin, L., Han, P., Chen, L., Walk, T., Li, Y., Hu, X., Xie, L., Liao, H., Liao, X., 2017. Genomewide identification and expression analysis of NRAMP family genes in soybean (Glycine Max L.). Front. Plant Sci. 8, 1436. Sasaki, A., Yamaji, N., Yokosho, K., Ma, J.F., 2012. Nramp5 is a major transporter responsible for manganese and cadmium uptake in rice. Plant Cell 24, 2155–2167. Takahashi, R., Ishimaru, Y., Senoura, T., Shimo, H., Ishikawa, S., Arao, T., Nakanishi, H., Nishizawa, N., 2011. The OsNRAMP1 iron transporter is involved in Cd accumulation in rice. J. Exp. Bot. 62, 4843–4850. Takahashi, R., Bashir, K., Ishimaru, Y., Nishizawa, N., Nakanishi, H., 2012. The role of heavy-metal ATPases, HMAs, in zinc and cadmium transport in rice. Plant Signal. Behav. 7, 1605–1617. Tang, L., Mao, B., Li, Y., Lv, Q., Zhang, L., Chen, C., He, H., Wang, W., Zeng, X., Shao, Y., Pan, Y., Hu, Y., Peng, Y., Fu, X., Li, H., Xia, S., Zhao, B., 2017. Knockout of OsNramp5 using the CRISPR/Cas9 system produces low Cd-accumulating indica rice without compromising yield. Sci. Rep. 7, 14438. Tejada-Jiménez, M., Castro-Rodríguez, R., Kryvoruchko, I., Lucas, M., Udvardi, M., Imperial, J., González-Guerrero, M., 2015. Medicago truncatula natural resistanceassociated macrophage protein 1 is required for iron uptake by rhizobia-infected nodule cells. Plant Physiol. 168, 258–272. The International Wheat Genome Sequencing Consortium, 2014. A chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome. Science 345, 1251788. Thomine, S., Wang, R., Ward, J., Crawford, N., Schroeder, J., 2000. Cadmium and iron transport by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes. Proc. Natl. Acad. Sci. U. S. A. 97, 4991–4996. Thomine, S., Lelièvre, F., Debarbieus, E., Schroeder, J., Barbier-Brygoo, H., 2003. AtNRAMP3, a multispecific vacuolar metal transporter involved in plant responses to iron deficiency. Plant J. 34, 685–695. Tiwari, M., Sharma, D., Dwivedi, S., Singh, M., Tripathi, R., Trivedi, P., 2014. Expression in Arabidopsis and cellular localization reveal involvement of rice NRAMP, OsNRAMP1, in arsenic transport and tolerance. Plant Cell Environ. 37, 140–152. Ueno, D., Yamaji, N., Kono, I., Huang, C., Ando, T., Yano, M., Ma, J., 2010. Gene limiting cadmium accumulation in rice. Proc. Natl. Acad. Sci. U. S. A. 107, 16500–16505. Verbruggen, N., Hermans, C., Schat, H., 2009. Mechanisms to cope with arsenic or cadmium excess in plants. Curr. Opin. Plant Biol. 12, 364–372.
Balen, B., Tkalec, M., Šiki’c, S., Toli’c, S., Cvjetko, P., Pavlica, M., Vidaković-Cifrek, Ž., 2011. Biochemical responses of Lemna minor experimentally exposed to cadmium and zinc. Ecotoxicology 20 915–826. Bent, A., Kunkel, B., Dahlbeck, D., Brown, K., Schmidt, R., Giraudat, J., Leung, J., Staskawicz, B., 1994. RPS2 of Arabidopsis thaliana: a leucine-rich repeat class of plant disease resistance genes. Science 265, 1856–1860. Cailliatte, R., Lapeyre, B., Briat, J., Mari, S., Curie, C., 2009. The NRAMP6 metal transporter contributes to cadmium toxicity. Biochem. J. 422, 217–228. Cailliatte, R., Schikora, A., Briat, J., Mari, S., Curie, C., 2010. High-affinity manganese uptake by the metal transporter NRMAP1 is essential for Arabidopsis growth in low manganese conditions. Plant Cell 22, 904–917. Chen, S., Han, X., Fang, J., Lu, Z., Qiu, W., Liu, M., Sang, J., Jiang, J., Zhou, R., 2017. Sedum alfredii SaNRAMP6 metal transporter contributes to cadmium accumulation in transgenic Arabidopsis thaliana. Sci. Rep. 7, 13318. Clemens, S., Ma, J., 2016. Toxic heavy metal and metalloid accumulation in crop plants and foods. Annu. Rev. Plant Biol. 67, 489–512. Curie, C., Alonso, M., Le Jean, M., Ecker, J., Briat, J., 2000. Involvement of NRAMP1 from Arabidopsis thaliana in iron transport. Biochem. J. 347, 749–755. Gao, H., Xie, W., Yang, C., Xu, J., Li, J., Wang, H., Chen, X., Huang, C., 2018. Nramp2, a trans-Golgi network-localized manganese transporter, is required for Arabidopsis root growth under manganese deficiency. New Phytol. 217, 179–193. Gravot, A., Lieutaud, A., Verret, F., Auroy, P., Vavasseur, A., Richaud, P., 2004. AtHMA3, a plant P1B-ATPase, functions as a Cd/Pb transporter in yeast. FEBS Lett. 561, 22–28. Herbette, S., Taconnat, L., Hugouvieux, V., Piette, L., Magniette, M., Cuine, S., Auroy, P., Richaud, P., Forestier, C., Bourguignon, J., Renou, J., Vavasseur, A., Leonhardt, N., 2006. Genome-wide transcriptome profiling of the early cadmium response of Arabidopsis roots and shoots. Biochimie 88, 1751–1765. Ihnatowicz, A., Siwinska, J., Meharg, A., Carey, M., Koornneef, M., Reymond, M., 2014. Conserved histidine of metal transporter AtNRAMP1 is crucial for optimal plant growth under manganese deficiency at chilling temperatures. New Phytol. 202, 1173–1183. Ishimaru, Y., Takahashi, R., Bashir, K., Shimo, H., Senoura, T., Sugimoto, K., Ono, K., Yano, M., Ishikawa, S., Arao, T., Nakanishi, H., Nishizawa, N., 2012. Characterizing the role of rice NRAMP5 in manganese, iron and cadmium transport. Sci. Rep. 2, 286. Kaiser, B., Moreau, S., Castelli, J., Thomson, R., Lambert, A., Bogliolo, S., Puppo, A., Day, D., 2003. The soybean NRAMP homologue, GmDMT1, is a symbiotic divalent metal transporter capable of ferrous iron transport. Plant J. 35, 295–304. Kobayashi, T., Nishizawa, N., 2012. Iron uptake, translocation, and regulation in higher plants. Annu. Rev. Plant Biol. 63, 131–152. Lanquar, V., Lelièvre, F., Bolte, S., Hamès, C., Alcon, C., Neumann, D., Vansuyt, G., Curie, C., Schröder, A., Krämer, U., Barbier-Brygoo, H., Thomine, S., 2005. Mobilization of vacuolar iron by AtNRAMP3 and AtNRAMP4 is essential for seed germination on low iron. EMBO J. 24, 4041–4051. Lanquar, V., Ramos, M., Lelièvre, F., Barbier-Brygoo, H., Krieger-Liszkay, A., Krämer, U., Thomine, S., 2010. Export of vacuolar manganese by AtNRAMP3 and AtNRAMP4 is required for optimal photosynthesis and growth under manganese deficiency. Plant Physiol. 152, 1986–1999. Li, J., Liu, J., Dong, D., Jia, X., McCouch, S., Kochian, L., 2014. Natural variation underlies alterations in Nramp aluminum transporter (NRAT1) expression and function that play a key role in rice aluminum tolerance. Proc. Natl. Acad. Sci. U. S. A. 111,
231
Gene 696 (2019) 225–232
C. Wang, et al.
aluminum in rice. Proc. Natl. Acad. Sci. U. S. A. 107, 18381–18385. Xiao, H., Yin, L., Xu, X., Li, T., Han, Z., 2008. The iron-regulated transporter, MbNRAMP1, isolated from Malus baccata is involved in Fe, Mn and Cd trafficking. Ann. Bot. 102, 881–889. Yamaji, N., Sasaki, A., Xia, J., Yokosho, K., Ma, J., 2013. A node-based switch for preferential distribution of manganese in rice. Nat. Commun. 4, 2442. Yang, M., Zhang, W., Dong, H., Zhang, Y., Lv, K., Wang, D., Lian, X., 2013. OsNRAMP3 is a vascular bundles-specific manganese transporter that is responsible for manganese distribution in rice. PLoS One 8, e83990. Yoo, S., Cho, Y., Sheen, J., 2007. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat. Protoc. 2, 1565–1572.
Wang, Y., Yu, K., Poysa, V., Shi, C., Zhou, Y., 2012. A single point mutation in GmHMA3 affects cadmium (Cd) translocation and accumulation in soybean seeds. Mol. Plant 5, 1154–1156. Wang, Y., Wang, X., Gu, M., Kang, H., Zeng, J., Fan, X., Sha, L., Zhang, H., Yu, K., Zhou, Y., 2015. Cloning and characterization of four novel SnRK2 genes from Triticum polonicum. Biol. Plant. 59, 211–219. Williams, L., Mills, R., 2005. P1B-ATPases an ancient family of transition metal pumps with diverse functions in plants. Trends Plant Sci. 10, 491–502. Wu, D., Yamaji, N., Yamane, M., Kashino-Fujii, M., Sato, K., Ma, J., 2016. The HvNRAMP5 transporter mediates uptake of cadmium and manganese, but not iron. Plant Physiol. 172, 1899–1910. Xia, J., Yamaji, N., Kasai, T., Ma, J., 2010. Plasma membrane-localized transporter for
232
Contents lists available at ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Research paper
Overexpression of TtNRAMP6 enhances the accumulation of Cd in Arabidopsis
T ⁎
Chao Wanga, Xing Chena, Qin Yaoa, Dan Longa, Xing Fana,b, Houyang Kanga,b, Jian Zengc, , ⁎ Lina Shaa,b, Haiqin Zhanga,b, Yonghong Zhoua,b, Yi Wanga,b, a
Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, Sichuan, China Joint International Research Laboratory of Crop Resources and Genetic Improvement, Sichuan Agricultural University, Wenjiang 611130, Sichuan, China c College of Resources, Sichuan Agricultural University, Wenjiang 611130, Sichuan, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Wheat Cadmium TtNRAMP6 Metal transporter
The uptake and translocation of non-essential heavy metals in plant are always through metal transporters for essential micronutrient transport, such as NRAMP (Natural Resistance-Associated Macrophage Protein). NRAMPs from different species exhibit different biological functions, although their sequences are highly identical. In the present study, a NRAMP6 was isolated from Ailanmai (Triticum turgidum L. ssp. turgidum). TtNRAMP6, localized on chromosome 3B, was mainly expressed in roots, followed by other tissues varied with different growth stages. At the seedling stage, TtNRAMP6 was significantly regulated by Cd stress in roots, but not by the deficiency of Zn, Fe or Mg. Subcellular localization analysis indicated that TtNRAMP6 encoded a plasma membrane protein. Expressing-TtNRAMP6 significantly enhanced the Cd concentration in yeast, and increased the Cd sensitivity. Meanwhile, overexpression of TtNRAMP6 also increased the Cd concentration in roots, stems, leaves and the whole plant of Arabidopsis, which indicated that overexpression of TtNRAMP6 enhanced the Cd accumulation. Thus, genetic manipulation of TtNRAMP6 may reduce the uptake of Cd from external solution to wheat, finally protecting the safety of wheat food.
1. Introduction Heavy metals consist of essential micronutrients and non-essential micronutrients. Essential micronutrients are crucial for the plant growth and development, such as iron (Fe) and zinc (Zn); they play important roles in the photosynthesis, the respiration, the chlorophyll biosynthesis, and other basic cellular processes (Kobayashi and Nishizawa, 2012). However, non-essential heavy metals, such as cadmium (Cd) and lead (Pb), can damage the photosynthetic apparatus, affect the nutrient uptake, and then inhibit the plant growth and development to cause serious production reduction (Gravot et al., 2004; Herbette et al., 2006; Verbruggen et al., 2009; Balen et al., 2011). Thus, plants theoretically do not develop metal transporters to specifically transport non-essential heavy metals to injure themselves. The uptake and translocation of non-essential heavy metals in plant are always through metal transporters for essential micronutrient transport, including NRAMP (Natural Resistance-Associated Macrophage Protein), ZIP (Zrt- and Irt-related protein), heavy metal P-type ATPases, and YSL
(Yellow Stripe-Like) transporters (Clemens and Ma, 2016; Williams and Mills, 2005; Verbruggen et al., 2009; Cailliatte et al., 2009; Takahashi et al., 2011, 2012). Of them, increasing studies indicate that members of NRAMP family transport a broad range of metal substrates, which are responsible for metal uptake and translocation, such as Cd, Zn, Fe and Mn (Thomine et al., 2000; Cailliatte et al., 2009; Tiwari et al., 2014). To date, numerous NRAMP genes have been discovered and functionally characterized from various plants, such as Arabidopsis (Curie et al., 2000; Thomine et al., 2000, 2003; Lanquar et al., 2005, 2010; Cailliatte et al., 2009, 2010; Pottier et al., 2015; Gao et al., 2018), rice (Curie et al., 2000; Xia et al., 2010; Takahashi et al., 2011; Sasaki et al., 2012; Ishimaru et al., 2012; Yamaji et al., 2013; Yang et al., 2013; Tiwari et al., 2014; Li et al., 2014; Peris-Peris et al., 2017), Polish wheat (Peng et al., 2018a, 2018b), soybean (Kaiser et al., 2003; Qin et al., 2017), Malus baccata (Xiao et al., 2008), tobacco (Tang et al., 2017), barley (Wu et al., 2016), Thlaspi japonicum (Mizuno et al., 2005), Medicago truncatula (Tejada-Jiménez et al., 2015) and Sedum alfredii (Chen et al., 2017). Of these NRAMPs, only AtNRAMP6 specifically
Abbreviations: NRAMP, Natural Resistance-Associated Macrophage Protein; Cd, cadmium; Fe, iron; Zn, zinc; Pb, lead; Mn, manganese ⁎ Corresponding authors at: J. Zeng, College of Resources, Sichuan Agricultural University, Wenjiang 611130, Sichuan, China; Y. Wang, Triticeae Research Institute, Sichuan Agricultural University, Wenjiang 611130, Sichuan, China. E-mail addresses: [email protected] (J. Zeng), [email protected] (Y. Wang). https://doi.org/10.1016/j.gene.2019.02.008 Received 2 November 2018; Received in revised form 25 January 2019; Accepted 5 February 2019 Available online 12 February 2019 0378-1119/ © 2019 Elsevier B.V. All rights reserved.
Gene 696 (2019) 225–232
C. Wang, et al.
amplification (cDNA from root sample was used as PCR template) and sequence alignment, amino acid sequence predication, gene structure and chromosome localization, putative subcellular localization, transmembrane domains, and phylogenetic analysis of TtNRAMP6 were performed as described by Peng et al. (2018a, 2018b).
transports Cd (Cailliatte et al., 2009); most of NRAMPs can transport Cd and other essential metals such as Mn and Fe, although the essential metal varies from different NRAMPs. Meanwhile, several other NRAMPs can't transport Cd, such as OsNRAMP3 specifically transports Mn (Yamaji et al., 2013; Yang et al., 2013), OsNRAMP4 specifically transports Al (Xia et al., 2010; Li et al., 2014), TjNRAMP4 specifically transports Ni (Mizuno et al., 2005), and OsNRAMP6 transports Mn and Fe (Peris-Peris et al., 2017). Thus, different NRAMPs transport different metals, which may be resulted from some residue differences among these NRAMPs (Pottier et al., 2015; Tang et al., 2017). For Triticeae, only three NRAMPs, TpNRAMP3 and TpNRAMP5 from Triticum polonicum (Peng et al., 2018a, 2018b) and HvNRAMP5 from Hordeum vulgare (Wu et al., 2016), are identified. As homologous of OsNRAMP5 which transports Cd, Mn and Fe (Sasaki et al., 2012; Ishimaru et al., 2012; Yang et al., 2013), TpNRAMP5 and HvNRAMP5 transport Cd and Mn but not Fe (Wu et al., 2016; Peng et al., 2018b), although their residue differences do not change their expression patterns. TpNRAMP3 is 90% identity with OsNRAMP3, but their expression patterns and metal substrates transport are different. OsNRAMP3 is mainly expressed in nodes, culms and basal stems, but very low expression in roots and leaf blades and sheaths (Yamaji et al., 2013; Yang et al., 2013); TpNRAMP3 is mainly expressed in leaf blades and sheaths, roots and the first node (Peng et al., 2018a). Meanwhile, TpNRAMP3 transports Cd and Mn (Peng et al., 2018a), but OsNRAMP3 specifically transports Mn but not Cd (Yamaji et al., 2013; Yang et al., 2013). These results indicate that NRAMPs from different species exhibit different biological functions, although their sequences are highly identical. Recently, Peris-Peris et al. (2017) found that OsNRAMP6 could transport Mn and Fe but not Cd. As its homologous, we hypothesized that a NRAMP6 from Triticum might transport Cd. To test this hypothesis, we isolated a NRAMP6 from a tetraploid wheat (Ailanmai, Triticum turgidum L. ssp. turgidum, 2n = 4× = 28, AABB) which is a landrace of Sichuan, China. Its biological functions were revealed by analyzing its expression pattern at the wheat growth season or under metal stresses, and the effects of TtNRAMP6 expression on metal tolerance and accumulation in yeast, and overexpressing Arabidopsis.
2.3. Relative expression analysis of TtNRAMP6 TtNRAMP6-specific expression primers (Forward: GTCAGCATCCG TACTATTCAAGAA; Reverse: TGGTGAGACAGGGAGCAAA) were designed by the Beacon designer 7.0 for quantitative real-time PCR (qPCR). The Actin gene described by Wang et al. (2015) was used as a reference gene to normalize the relative expression level of TtNRAMP6. Then qPCR and calculation of the relative expression level were performed as described by Wang et al. (2015) with minor modification. Briefly, each PCR volume was 25 μL, including 1 μL forward primer (4 pmol/μL), 1 μL reverse primer (4 pmol/μL), 15 μL iTaq™ universal SYBR® green supermix (Bio-Rad), and 8 μL cDNA. The relative expression level was normalized using the 2ΔΔCt method by the CFX Manager 3.1 software (Bio-Rad). 2.4. Functional analysis in yeast
At the wheat growth season (October 2017 to May 2018), Ailanmai was grown in the field of Sichuan Agricultural University, Chengdu, China. Total 23 tissues, including 5 tissues (root, basal stem, leaf sheath, leaf blade, and young leaf) from the jointing stage, 11 tissues (root, basal stem, low leaf sheath, low leaf blade, node III, inter node II, node II, node I, flag leaf sheath, flag leaf blade, and peduncle) from the booting stage, and 7 tissues (root, node I, flag leaf sheath, flag leaf blade, inter node I, lemma, and immature grain) from the grain filling stage, were collected with three biological replicates. For metal stresses, seedlings of Ailanmai were grown in Hoagland nutrient solution in a growth chamber at 25 °C with 16/8 h light/dark. At the three-leaf stage, seedlings were individually treated with deficiency of MgCl2 (Mg), ZnSO4 (Zn), FeCl3 (Fe) or CuCl2 (Cu), or with supply of 40 μM CdCl2 (Cd) for 24 h. Roots and leaves were individually collected. All collected tissues were snap-frozen in liquid nitrogen and stored at −80 °C for RNA extraction. RNA isolation and cDNA synthesis were performed as described by Peng et al. (2018a, 2018b).
The open reading frame of TtNRAMP6 was amplified using primers (Forward: CGGGGTACCATGGAAGAGAGGGGAAGC; Reverse: GCTCTA GAGCAATGTAGAGCCAAAACTTCATC), and then was sub-cloned into the Kpn I and Xba I sites of empty vector pYES2 using the method of double endonuclease restriction. The recombinant plasmid and the empty vector were individually transformed into yeast strains [wild type (BY4743), Cd-sensitive strain Δycf1 (YDR135), and Zn-sensitive strain Δzrc1 (YMC243)] as described by Wang et al. (2012). The positively transformed yeasts were confirmed as described by Peng et al. (2018a, 2018b) using PCR with TtNRAMP6-specific expression primers. Firstly, the metal tolerance of the transformed yeast strains was analyzed on synthetic defined (SD) plate medium. Briefly, each yeast strain was cultured in liquid SD medium at 30 °C for 20 h. The OD600 value of each suspension was adjusted to 0.6, and then was sequentially diluted to four gradients (1:10, 1:100, 1:1000, and 1:10000). 5 μL of each dilution was spotted on SD plate medium containing 2% galactose, and with CdCl2 (0 and 60 μM), ZnCl2 (0 and 6 mM), MnCl2 (0 and 10 mM), or FeSO4 (0 and 20 mM). All plates were incubated at 30 °C for 72 h to investigate the metal sensitivity. Strains of YDR135 and YMC243 transformed with TtNRAMP6 were used to test Cd and Zn tolerance, respectively; strain of BY4743 transformed with TtNRAMP6 was used to test Fe and Mn tolerance; strains of BY4743, YDR135 and YMC243 transformed with pYES2 were used as controls. To confirm the Cd tolerance grown on SD plate medium, the yeast growth curves grown in liquid SD medium with 40 μM CdCl2 were investigated as described by Peng et al. (2018b). The OD600 values were investigated at 0, 4, 8, 20, 32 and 56 h using a microplate spectrophotometer (Fisher Scientific). To reveal whether expression of TtNRAMP6 in yeast could influence the Cd accumulation, the Cd concentration of each yeast strain was measured as described by Peng et al. (2018b). Briefly, 20 μL yeast cells with OD600 = 0.5 were cultured in 350 mL liquid SD medium containing 40 μΜ CdCl2 for 48 h. After centrifugation, the precipitated cells were washed with 100 μM EDTA for twice and deionized water for three times, and dried at 80 °C. All samples were digested in mixed acid (VHNO3:VHClO3 = 1:4) at 180 °C for 4 h. The Cd concentration was measured by ICP-MS (Fisher Scientific, USA).
2.2. TtNRAMP6 cloning, bioinformatics and phylogenetic analysis
2.5. Subcellular localization of TtNramp6
According to the sequence of TpNRAMP6 (KX165387), PCR primers (Forward: AGACGAGAAGAGAAATGGAA; Reverse: CGTCTCCAAAACA AGGTCTG) for the cDNA of TtNRAMP6 were designed. PCR
The open reading frame of TtNRAMP6 without the stop codon was cloned into the BamH I and Spe I sites of HBT95-GFP vector, and the primers (Forward: CGCGGATCCATGGAAGAGAGGGGAAGC; Reverse:
2. Materials and methods 2.1. Plant growth, sample collection, RNA isolation and cDNA synthesis
226
Gene 696 (2019) 225–232
C. Wang, et al.
CTAGACTAGTATGTAGAGCCAAAACTTCATC) were designed by the Beacon designer 7.0. Arabidopsis protoplasts were prepared as described by Yoo et al. (2007). Recombined plasmid of HBT95-TtNRAMP6-GFP (10 μL, 1.5 μg/μL) was transformed into prepared protoplasts using 40% PEG solution (8 g PEG4000, 4 mL 0.2 M Mannitol, 2 mL 0.1 M CaCl2, 6 mL H2O) at 23 °C for 30 min, and then diluted by solution A (10 mL 154 mM NaCl, 12.5 mL 125 mM CaCl2, 2.5 mL 5 mM KCl, 2 mL 2 mM MES with pH = 5.7, and 73 mL H2O). The dilution was centrifuged with 100 g for 8 min, and suspended by solution B (5 mL 0.5 M Mannitol, 1 mL 20 mM KCl, 400 μL 4 mM MES with pH = 5.7, and 3.6 mL H2O) at 23 °C with dark. After overnight cultivation, the cell suspension was centrifuged again, and resuspended by solution B, then incubated with 5 μL Dil (1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate, red fluorescence) (Sigma-Adrich, USA) under dark for 20 min. After centrifugation, cells were resuspended by solution B again and incubated with 1 μL DAPI (blue fluorescence) under dark for 5 min. After twice washing with solution B, a confocal laser scanning microscope (Olympus, Japan) was used to observe the signals under 405 nm and 488 nm. Dil and DAPI are plasma membrane and nucleus dyes, respectively. 2.6. Functional analysis of TtNRAMP6 in overexpressing Arabidopsis Fig. 1. Phylogenetic tree of TtNRAMP6 with NRAMPs from Arabidopsis, rice and other plants. The phylogenetic tree was constructed based on sequence alignment of NRAMP homologous from Arabidopsis, rice, Polish wheat and barley, including AtNRAMP1 to AtNRAMP6 (AF165125, AF141204, AF202539, AF202540, NM_117995.2, NM_101464.4). OsNRAMP1 to OsNRAMP7 (AK121534.1, L81152.1, AK070574.1, AB125305, AK070788.1, Os01g0503400, Os12g39180), TpNRAMP3 (KX165384.1), TpNRAMP5 (KX165386.1), HvNRAMP5 (AK364374.1), and TtNRAMP6 (MK098501).
The open reading frame of TtNRAMP6 was sub-cloned into the Kpn I and Xba I sites of vector pCambia1305. The recombined vector and empty vector were individually introduced transferred into wild-type Arabidopsis (Columbia ecotype) by floral infiltration using agrobacterium (Bent et al., 1994). The positive and homozygous TtNRAMP6-expressing lines, wild type and transgenic vector lines were used to analyze the Cd tolerance and accumulation as described by Peng et al. (2018a, 2018b). 3. Results and discussions
expression of TtNRAMP6 in node I was higher than other tissues. These results indicated that TtNRAMP6 mainly functioned in roots at whole growth stage, and also in other tissues varying with different growth stages. In plant, several NRAMPs mainly expressed in roots, including OsNRAMP1 (Takahashi et al., 2011), OsNRAMP5 (Tang et al., 2017), HvNRAMP5 (Wu et al., 2016), GmNRAMP7 (Qin et al., 2017) and TpNRAMP5 (Peng et al., 2018b). All proteins encoded by these genes (except of GmNRAMP7) could transport Cd for it was uptake in roots (Takahashi et al., 2011; Ishimaru et al., 2012; Sasaki et al., 2012; Wu et al., 2016; Tang et al., 2017; Peng et al., 2018b). Thus, TtNRAMP6 might be responsible for metal uptake in wheat. The expression level of TtNRAMP6 in roots and leaves was not regulated by the deficiency of Zn, Mg, Fe or Cu (Fig. 2B, C), but was down-regulated by the deficiency of Cu in leaves (Fig. 2C). It was upregulated by the supply of Cd in roots (Fig. 2D), but not in leaves (Fig. 2E). Thus, the response of TtNRAMP6 to metal stresses was also different from OsNRAMP5 (Ishimaru et al., 2012; Sasaki et al., 2012; Yang et al., 2013), HvNRAMP5 (Wu et al., 2016), TpNRAMP3 and TpNRAMP5 (Peng et al., 2018a, 2018b). For example, TpNRAMP3 and TpNRAMP5 were not regulated by Cd stress (Peng et al., 2018a, 2018b); HvNRAMP5 was only regulated by the deficiency of Fe, but not by the supply of Cd (Wu et al., 2016); OsNRAMP5 was significantly up-regulated by the deficiency of Zn or Fe, but not by the deficiency of Cu and Mn (Sasaki et al., 2012; Yang et al., 2013). Although OsNRAMP3 was not regulated by the deficiency of Zn, Fe, Mn or Cu (Yamaji et al., 2013; Yang et al., 2013), it was unknown that whether OsNRAMP3 could be regulated by Cd. Interestingly, the expressions of OsNRAMP1 and SaNRAMP6 in roots were dramatically regulated by Cd stress; meanwhile, they were also responsible for Cd accumulation (Takahashi et al., 2011; Chen et al., 2017). Thus, these results implied that TtNRAMP6 might be responsible for Cd uptake in wheat.
3.1. Characterization of TtNRAMP6 1679 bp cDNA of TtNRAMP6 (MK098501), including 1629 bp open reading frame, 14 bp of 5′-UTR and 36 bp of 3′-UTR, was amplified. TtNRAMP6 encoded 543 amino acids, which was shorter than OsNRAMP6 with 550 amino acids (Peris-Peris et al., 2017). Phylogenetic analysis indicated that TtNRAMP6 was closely clustered with OsNRAMP6 with a 67.9% identity (Fig. 1). Using the open reading frame of TtNRAMP6 to search against the wheat genome (The International Wheat Genome Sequencing Consortium, 2014) indicated that TtNRAMP6 was localized on the chromosome 3B (gene: TRIAE_CS42_3B_TGACv1_225495_AA0809010), which including 13 introns and 14 exons. Subcellular localization predication indicated that TtNRAMP6 was a plasma membrane protein and had 10 transmembrane domains (SFig. 1). Although OsNRAMP6 was a plasma membrane protein, it contained 9 transmembrane domains (Peris-Peris et al., 2017). Importantly, transmembrane domains positively discriminate the transport substrate specificity and the expression pattern of metal transporters (Ueno et al., 2010). These results implied that the expression patterns and metal transport substrates were different. 3.2. Expression patterns of TtNRAMP6 The expression pattern of TtNRAMP6 was investigated in various tissues at the jointing, the booting and the grain filling stages. At all stages, TtNRAMP6 mainly expressed in roots (Fig. 2A); however, it varied in other tissues at different stages. At the jointing stage, the expression levels of TtNRAMP6 in leaf sheathes, leaf blades and young leaves were higher than that in basal stems (Fig. 2A). At the booting stage, the expression level of TtNRAMP6 in basal stems was similar with that in flag leaf sheathes and peduncles; the lowest expression was investigated in node I (Fig. 2A). However, at the grain filling stage, the 227
Gene 696 (2019) 225–232
C. Wang, et al.
Fig. 2. Relative expression level of TtNRAMP6. A: relative expression of TtNRAMP6 of various tissues at three growth stages; B–C: relative expression of TtNRAMP6 in roots and leaves under the deficiency of Fe, Zn, Cu or Mg; D–E: relative expression of TtNRAMP6 in roots and leaves under Cd stress. The bar represented standard error of three biological replicates; asterisks represented significant difference between treatment and control at P < 0.05 by Tukey's test.
HvNRAMP5, TpNRAMP3, TpNRAMP5 and SaNRAMP6 (Thomine et al., 2000; Takahashi et al., 2011; Wu et al., 2016; Chen et al., 2017; Peng et al., 2018a, 2018b). Additionally, these transporters could transport other metals. For example, OsNRAMP1 transports Fe (Takahashi et al., 2011); OsNRAMP5, AtNRAMP1 and AtNRAMP3 transport Fe and Mn (Thomine et al., 2000; Ishimaru et al., 2012; Ihnatowicz et al., 2014; Tang et al., 2017); HvNRAMP5 transports Mn (Wu et al., 2016). In this study, expression of TtNRAMP6 did not influence the yeast growth under Zn, Fe or Mn stress (SFig. 2A, B), which implied that TtNRAMP6 could not transport Zn, Fe and Mn in yeast. Conversely, expression of OsNRAMP6 in yeast indicated that OsNRAMP6 could transport Fe and Mn, but not Cd (Peris-Peris et al., 2017). Thus, the function of TtNRAMP6 was different from OsNRAMP6, although they had a 67.9% identity. The differences might be resulted from the residue differences that caused the change of the putative protein structures and the metal transport substrates.
3.3. Expressing-TtNRAMP6 enhanced the Cd accumulation to increase the Cd sensitivity in yeast NRAMPs were involved in one or several metal(s) transport, including Fe, Mn, Zn, Al and/or Cd (Peris-Peris et al., 2017). In this study, expression of TtNRAMP6 in the Cd sensitive yeast strain YDR135 inhibited the growth when compared with YDR135 and BY4743 transformed with empty vector pYES2 (Fig. 3A). Similar results were revealed by the yeast growth curves experiment. The OD600 values of YDR135 transformed with TtNRAMP6 were significantly lower than these of YDR135 and BY4743 transformed with pYES2 (Fig. 3B). Meanwhile, the Cd concentration of yeast YDR135 transformed with TtNRAMP6 was significantly higher than that of YDR135 and BY4743 transformed with pYES2 (Fig. 3C). These results indicated that expression of TtNRAMP6 enhanced the Cd accumulation to increase the Cd sensitivity in yeast. Similar results were also found in other NRAMPs, including OsNRAMP1, AtNRAMP1, AtNRAMP3, AtNRAMP4, 228
Gene 696 (2019) 225–232
C. Wang, et al.
Fig. 3. Cd sensitivity and concentration of expressing-TtNRAMP6 yeast. A: growth of expressing-TtNRAMP6 yeast grown on SD medium plate with 0 or 60 μM CdCl2; B: OD600 values of expressing-TtNRAMP6 yeast grown in liquid SD medium with 0 or 40 μM CdCl2 at 0, 4, 8, 20, 32, and 56 h; C: Cd concentration in yeasts. Asterisk indicated significant difference between YDR135TtNRAMP6 and YDR135-pYES2 at P < 0.05 by Tukey's test.
and HvNRAMP5 reduced the Cd concentration in roots and leaves (Sasaki et al., 2012; Ishimaru et al., 2012; Wu et al., 2016; Tang et al., 2017); AtNRAMP3 and AtNRAMP4 were involved in the intercellular Cd transport (Lanquar et al., 2005, 2010); and AtNRAMP6 was involved in intracellular Cd transport (Cailliatte et al., 2009). In this study, overexpression of TtNRAMP6 enhanced the Cd accumulation in Arabidopsis, but did not affect it translocation (Fig. 6E, F), which were same as the results of overexpression of SaNRAMP6 (Chen et al., 2017), TpNRAMP3 or TpNRAMP5 (Peng et al., 2018a, 2018b). Additionally, TtNRAMP6 mainly expressed in roots at whole growth stages (Fig. 2A) and encoded a plasma membrane protein. As a Cd transporter, TtNRAMP6 thereby should be responsible for the Cd uptake in roots from external solution.
3.4. TtNRAMP6 was a plasma membrane protein To investigate the subcellular localization of TtNRAMP6, HBT95TtNRAMP6-GFP was transiently transformed into Arabidopsis protoplasts, and empty vector (HBT95-GFP) was used as a control. The green fluorescence of empty vector accumulated predominantly in plasma membrane, nucleus and cytosol (Fig. 4A). DAPI and Dil also specifically marked cell nucleus and plasma membrane (Fig. 4), respectively. The green fluorescence of HBT95-TtNRAMP6-GFP accumulated predominantly in plasma membrane, but not nucleus (Fig. 4B). The merged result of GFP and Dil indicated that TtNRAM6 was a plasma membrane protein. Similarly, TpNRAMP3 and TpNRAMP5 cloned from Polish wheat also encode plasma membrane proteins as ducumented in previous studies (Peng et al., 2018a, 2018b). Meanwhile, all NRAMPs cloned from rice were plasma membrane proteins (Sasaki et al., 2012; Yamaji et al., 2013; Yang et al., 2013; Li et al., 2014; Peris-Peris et al., 2017).
4. Summary TtNRAMP6, localized on the chromosome 3B, was mainly expressed in roots at whole growth stage. TtNRAMP6 was regulated by Cd, but not by the deficiency of other essential metals such as Fe, Zn and Mn. TtNRAMP6 encoded a Cd transporter for Cd accumulation, which was supported by the following: (1) expression of TtNRAMP6 enhanced the Cd concentration to increase the Cd sensitivity in yeast; (2) overexpression of TtNRAMP6 enhanced the Cd concentration in roots, stems, leaves and the whole plant. Expression of TtNRAMP6 did not affect the sensitivity to other metals including Zn, Fe and Mn in yeast. Thus, the function of TtNRAMP6 is different from its homologues including OsNRAMP1, OsNRAMP5 and OsNRAMP6 transport Mn and Fe (Takahashi et al., 2011; Sasaki et al., 2012; Tiwari et al., 2014; PerisPeris et al., 2017), and HvNRAMP5, TpNRAMP3 and TpNRAMP5 transport Mn (Wu et al., 2016; Peng et al., 2018a, 2018b), although they are all plasma membrane proteins.
3.5. Overexpressing-TtNRAMP6 enhanced the Cd accumulation in Arabidopsis To confirm that TtNRAMP6 transported Cd in yeast, we tested that whether overexpression of TtNRAMP6 could affect Cd accumulation and translocation in Arabidopsis. Under normal growth condition (control), overexpression of TtNRAMP6 significantly promoted the growth of plants when compared with wild type and transformed empty vector line (Fig. 5A, B). Under 500 μM CdCl2 stress, overexpression of TtNRAMP6 gave rise to slightly chlorosis (Fig. 5A), which was one of the symptoms of Cd toxicity; meanwhile, it also significantly reduced the dry weight at the maturity stage (Fig. 5B). At the maturity stage, we also investigated the Cd concentration of root, stem and leaf under Cd stress. Overexpression of TtNRAMP6 significantly increased the Cd concentration in roots (Fig. 6A), stems (Fig. 6B), leaves (Fig. 6C) and the whole plant (Fig. 6D), but did not affect the Cd translocation factors (the Cd concentration ratio that root to stem or leaf). These results indicated that overexpression of TtNRAMP6 enhanced the Cd accumulation in Arabidopsis, so that caused Cd toxicity to reduce biomass. Previous studies indicated that many NRAMPs were involved in Cd transport, including root cell uptake from external solution, transport within plant and/or intercellular translocation. For instance, OsNRAMP1 participated in cellular Cd uptake and Cd transport within plants (Takahashi et al., 2011); OsNRAMP5 and HvNRAMP5 were responsible for the Cd uptake in roots, because knockout of OsNRAMP5
Acknowledgements The authors thank the National Natural Science Foundation of China, China (No 31671688, 31670387 and 31870309) for all financial support. The authors thank associated Prof. Yan Huang (Sichuan Agricultural University) for supporting the plasmid of pCambia1305. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.gene.2019.02.008. 229
Gene 696 (2019) 225–232
C. Wang, et al.
Fig. 4. Subcellular localization of TtNramp6. A: Arabidopsis protoplast transformed with HBT95-GFP vector; B: Arabidopsis protoplast transformed with HBT95-TtNRAMP6-GFP vector. GFP-expressing in protoplasts was shown in green; nucleus was stained by DAPI (blue); plasma membrane was stained by Dil (red); yellow signals indicated the position of TtNRAMP6. Scale bar = 5 μm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 5. Phenotypic assay of overexpressingTtNRAMP6 Arabidopsis. A: growth of overexpressing-TtNRAMP6 Arabidopsis grown in soil with 0 or 500 μM CdCl2; B: dry weight of overexpressing-TtNRAMP6 Arabidopsis grown in soil with 0 or 500 μM CdCl2 at the maturity stage. Asterisks represented significant difference from CK at P < 0.05 by Tukey's test with three independently biological replicates.
230
Gene 696 (2019) 225–232
C. Wang, et al.
Fig. 6. Cd concentration in different tissues of overexpressing-TtNRAMP6 Arabidopsis. A–D: Cd concentration in roots (A), stems (B), leaves (C), and the whole plant (D); E–F: translocation factors. The bar represented standard error of three biological replicates; asterisks indicated significant difference from wild type and vector at P < 0.05 by Tukey's test with three independently biological replicates.
References
6503–6508. Mizuno, T., Usui, K., Horie, K., Nosaka, S., Mizuno, N., Obata, H., 2005. Cloning of three ZIP/Nramp transporter genes from a Ni hyperaccumulator plant Thlaspi japonicum and their Ni2+ transport abilities. Plant Physiol. Biochem. 43, 793–801. Peng, F., Wang, C., Cheng, Y., Zeng, J., Kang, H., Fan, X., Sha, L., Zhang, H., Zhou, Y., Wang, Y., 2018a. Cloning and characterization of TpNRAMP3, a metal transporter from polish wheat (Triticum polonicum L.). Front. Plant Sci. 9, 1354. Peng, F., Wang, C., Zhu, J., Zeng, J., Kang, H., Fan, X., Sha, L., Zhang, H., Zhou, Y., Wang, Y., 2018b. Expression of TpNRAMP5, a metal transporter from Polish wheat (Triticum polonicum L.), enhances the accumulation of Cd, Co and Mn in transgenic Arabidopsis plants. Planta 247, 1395–1406. Peris-Peris, C., Serra Cardona, A., Sánchez Sanuy, F., Campo, S., Ariño, J., San Segundo, B., 2017. Two NRAMP6 isoforms function as iron and manganese transporters and contribute to disease resistance in rice. Mol. Plant-Microbe Interact. 30, 385–398. Pottier, M., Oomen, R., Picco, C., Giraudat, J., Scholz-Starke, J., Richaud, P., Carpaneto, A., Thomine, S., 2015. Identification of mutations allowing natural resistance associated macrophage proteins (NRAMP) to discriminate against cadmium. Plant J. 83, 625–637. Qin, L., Han, P., Chen, L., Walk, T., Li, Y., Hu, X., Xie, L., Liao, H., Liao, X., 2017. Genomewide identification and expression analysis of NRAMP family genes in soybean (Glycine Max L.). Front. Plant Sci. 8, 1436. Sasaki, A., Yamaji, N., Yokosho, K., Ma, J.F., 2012. Nramp5 is a major transporter responsible for manganese and cadmium uptake in rice. Plant Cell 24, 2155–2167. Takahashi, R., Ishimaru, Y., Senoura, T., Shimo, H., Ishikawa, S., Arao, T., Nakanishi, H., Nishizawa, N., 2011. The OsNRAMP1 iron transporter is involved in Cd accumulation in rice. J. Exp. Bot. 62, 4843–4850. Takahashi, R., Bashir, K., Ishimaru, Y., Nishizawa, N., Nakanishi, H., 2012. The role of heavy-metal ATPases, HMAs, in zinc and cadmium transport in rice. Plant Signal. Behav. 7, 1605–1617. Tang, L., Mao, B., Li, Y., Lv, Q., Zhang, L., Chen, C., He, H., Wang, W., Zeng, X., Shao, Y., Pan, Y., Hu, Y., Peng, Y., Fu, X., Li, H., Xia, S., Zhao, B., 2017. Knockout of OsNramp5 using the CRISPR/Cas9 system produces low Cd-accumulating indica rice without compromising yield. Sci. Rep. 7, 14438. Tejada-Jiménez, M., Castro-Rodríguez, R., Kryvoruchko, I., Lucas, M., Udvardi, M., Imperial, J., González-Guerrero, M., 2015. Medicago truncatula natural resistanceassociated macrophage protein 1 is required for iron uptake by rhizobia-infected nodule cells. Plant Physiol. 168, 258–272. The International Wheat Genome Sequencing Consortium, 2014. A chromosome-based draft sequence of the hexaploid bread wheat (Triticum aestivum) genome. Science 345, 1251788. Thomine, S., Wang, R., Ward, J., Crawford, N., Schroeder, J., 2000. Cadmium and iron transport by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes. Proc. Natl. Acad. Sci. U. S. A. 97, 4991–4996. Thomine, S., Lelièvre, F., Debarbieus, E., Schroeder, J., Barbier-Brygoo, H., 2003. AtNRAMP3, a multispecific vacuolar metal transporter involved in plant responses to iron deficiency. Plant J. 34, 685–695. Tiwari, M., Sharma, D., Dwivedi, S., Singh, M., Tripathi, R., Trivedi, P., 2014. Expression in Arabidopsis and cellular localization reveal involvement of rice NRAMP, OsNRAMP1, in arsenic transport and tolerance. Plant Cell Environ. 37, 140–152. Ueno, D., Yamaji, N., Kono, I., Huang, C., Ando, T., Yano, M., Ma, J., 2010. Gene limiting cadmium accumulation in rice. Proc. Natl. Acad. Sci. U. S. A. 107, 16500–16505. Verbruggen, N., Hermans, C., Schat, H., 2009. Mechanisms to cope with arsenic or cadmium excess in plants. Curr. Opin. Plant Biol. 12, 364–372.
Balen, B., Tkalec, M., Šiki’c, S., Toli’c, S., Cvjetko, P., Pavlica, M., Vidaković-Cifrek, Ž., 2011. Biochemical responses of Lemna minor experimentally exposed to cadmium and zinc. Ecotoxicology 20 915–826. Bent, A., Kunkel, B., Dahlbeck, D., Brown, K., Schmidt, R., Giraudat, J., Leung, J., Staskawicz, B., 1994. RPS2 of Arabidopsis thaliana: a leucine-rich repeat class of plant disease resistance genes. Science 265, 1856–1860. Cailliatte, R., Lapeyre, B., Briat, J., Mari, S., Curie, C., 2009. The NRAMP6 metal transporter contributes to cadmium toxicity. Biochem. J. 422, 217–228. Cailliatte, R., Schikora, A., Briat, J., Mari, S., Curie, C., 2010. High-affinity manganese uptake by the metal transporter NRMAP1 is essential for Arabidopsis growth in low manganese conditions. Plant Cell 22, 904–917. Chen, S., Han, X., Fang, J., Lu, Z., Qiu, W., Liu, M., Sang, J., Jiang, J., Zhou, R., 2017. Sedum alfredii SaNRAMP6 metal transporter contributes to cadmium accumulation in transgenic Arabidopsis thaliana. Sci. Rep. 7, 13318. Clemens, S., Ma, J., 2016. Toxic heavy metal and metalloid accumulation in crop plants and foods. Annu. Rev. Plant Biol. 67, 489–512. Curie, C., Alonso, M., Le Jean, M., Ecker, J., Briat, J., 2000. Involvement of NRAMP1 from Arabidopsis thaliana in iron transport. Biochem. J. 347, 749–755. Gao, H., Xie, W., Yang, C., Xu, J., Li, J., Wang, H., Chen, X., Huang, C., 2018. Nramp2, a trans-Golgi network-localized manganese transporter, is required for Arabidopsis root growth under manganese deficiency. New Phytol. 217, 179–193. Gravot, A., Lieutaud, A., Verret, F., Auroy, P., Vavasseur, A., Richaud, P., 2004. AtHMA3, a plant P1B-ATPase, functions as a Cd/Pb transporter in yeast. FEBS Lett. 561, 22–28. Herbette, S., Taconnat, L., Hugouvieux, V., Piette, L., Magniette, M., Cuine, S., Auroy, P., Richaud, P., Forestier, C., Bourguignon, J., Renou, J., Vavasseur, A., Leonhardt, N., 2006. Genome-wide transcriptome profiling of the early cadmium response of Arabidopsis roots and shoots. Biochimie 88, 1751–1765. Ihnatowicz, A., Siwinska, J., Meharg, A., Carey, M., Koornneef, M., Reymond, M., 2014. Conserved histidine of metal transporter AtNRAMP1 is crucial for optimal plant growth under manganese deficiency at chilling temperatures. New Phytol. 202, 1173–1183. Ishimaru, Y., Takahashi, R., Bashir, K., Shimo, H., Senoura, T., Sugimoto, K., Ono, K., Yano, M., Ishikawa, S., Arao, T., Nakanishi, H., Nishizawa, N., 2012. Characterizing the role of rice NRAMP5 in manganese, iron and cadmium transport. Sci. Rep. 2, 286. Kaiser, B., Moreau, S., Castelli, J., Thomson, R., Lambert, A., Bogliolo, S., Puppo, A., Day, D., 2003. The soybean NRAMP homologue, GmDMT1, is a symbiotic divalent metal transporter capable of ferrous iron transport. Plant J. 35, 295–304. Kobayashi, T., Nishizawa, N., 2012. Iron uptake, translocation, and regulation in higher plants. Annu. Rev. Plant Biol. 63, 131–152. Lanquar, V., Lelièvre, F., Bolte, S., Hamès, C., Alcon, C., Neumann, D., Vansuyt, G., Curie, C., Schröder, A., Krämer, U., Barbier-Brygoo, H., Thomine, S., 2005. Mobilization of vacuolar iron by AtNRAMP3 and AtNRAMP4 is essential for seed germination on low iron. EMBO J. 24, 4041–4051. Lanquar, V., Ramos, M., Lelièvre, F., Barbier-Brygoo, H., Krieger-Liszkay, A., Krämer, U., Thomine, S., 2010. Export of vacuolar manganese by AtNRAMP3 and AtNRAMP4 is required for optimal photosynthesis and growth under manganese deficiency. Plant Physiol. 152, 1986–1999. Li, J., Liu, J., Dong, D., Jia, X., McCouch, S., Kochian, L., 2014. Natural variation underlies alterations in Nramp aluminum transporter (NRAT1) expression and function that play a key role in rice aluminum tolerance. Proc. Natl. Acad. Sci. U. S. A. 111,
231
Gene 696 (2019) 225–232
C. Wang, et al.
aluminum in rice. Proc. Natl. Acad. Sci. U. S. A. 107, 18381–18385. Xiao, H., Yin, L., Xu, X., Li, T., Han, Z., 2008. The iron-regulated transporter, MbNRAMP1, isolated from Malus baccata is involved in Fe, Mn and Cd trafficking. Ann. Bot. 102, 881–889. Yamaji, N., Sasaki, A., Xia, J., Yokosho, K., Ma, J., 2013. A node-based switch for preferential distribution of manganese in rice. Nat. Commun. 4, 2442. Yang, M., Zhang, W., Dong, H., Zhang, Y., Lv, K., Wang, D., Lian, X., 2013. OsNRAMP3 is a vascular bundles-specific manganese transporter that is responsible for manganese distribution in rice. PLoS One 8, e83990. Yoo, S., Cho, Y., Sheen, J., 2007. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat. Protoc. 2, 1565–1572.
Wang, Y., Yu, K., Poysa, V., Shi, C., Zhou, Y., 2012. A single point mutation in GmHMA3 affects cadmium (Cd) translocation and accumulation in soybean seeds. Mol. Plant 5, 1154–1156. Wang, Y., Wang, X., Gu, M., Kang, H., Zeng, J., Fan, X., Sha, L., Zhang, H., Yu, K., Zhou, Y., 2015. Cloning and characterization of four novel SnRK2 genes from Triticum polonicum. Biol. Plant. 59, 211–219. Williams, L., Mills, R., 2005. P1B-ATPases an ancient family of transition metal pumps with diverse functions in plants. Trends Plant Sci. 10, 491–502. Wu, D., Yamaji, N., Yamane, M., Kashino-Fujii, M., Sato, K., Ma, J., 2016. The HvNRAMP5 transporter mediates uptake of cadmium and manganese, but not iron. Plant Physiol. 172, 1899–1910. Xia, J., Yamaji, N., Kasai, T., Ma, J., 2010. Plasma membrane-localized transporter for
232