Overlap between molecular markers expressed by naturally occurring CD4+CD25+ regulatory T cells and antigen specific CD4+CD25+ and CD8+CD28− T suppressor cells

Overlap Between Molecular Markers Expressed by Naturally Occurring CD4ⴙCD25ⴙ Regulatory T Cells and Antigen Specific CD4ⴙCD25ⴙ and CD8ⴙCD28ⴚ T Suppressor Cells Luigi Scotto, Afzal Jamal Naiyer, Sara Galluzzo, Paola Rossi, John Sanil Manavalan, Seunghee Kim-Schulze, Jianshe Fang, Riccardo Dalla Favera, Raffaello Cortesini, and Nicole Suciu-Foca ABSTRACT: Alloantigen specific CD8⫹CD28⫺ T suppressor (TS) cells differ from naturally occurring CD4⫹CD25⫹ T-regulatory (natural TR) cells not only by their phenotype but also by their mechanism of action. Natural TR have been extensively studied, leading to the identification of characteristic “molecular markers” such as Forkhead box P3 (FOXP3), glucocorticoid-induced tumor necrosis factor receptor–related protein (GITR) and cytotoxic T lymphocyte–associated antigen 4 (CTLA-4). We have investigated the expression of these genes in alloantigen specific TS and CD4⫹CD25⫹ T regulatory (TR) cells and found that they are expressed at levels similar to those observed in natural TR. Furthermore, similar to natural CD4⫹CD25⫹ TR, antigen-specific

CD8⫹CD28⫺CD62L⫹ TS cells have more suppressive capacity than CD8⫹CD28⫺CD62L⫺ TS cells. In spite of these similarities, natural TR are not antigen-specific and inhibit other T cells by T cell–to–T cell interaction, whereas TS are antigen-specific and exert their inhibitory function by interacting with antigen-presenting cells and render them tolerogenic to other T cells. The molecular characterization of TS cells may contribute to a better understanding of mechanisms involved in inhibition of immune responses in autoimmunity, transplantation, and chronic viral infection. Human Immunology 65, 1297–1306 (2004). © American Society for Histocompatibility and Immunogenetics, 2004. Published by Elsevier Inc.

ABBREVIATIONS APC antigen-presenting cells CTL cytolytic T-lymphocyte DC dendritic cells EC endothelial cells ILT immunoglobin-like transcript TC cytotoxic T cells

TCL T cell line TCR T cell receptor TH T-helper cells TR regulatory T cells TS T suppressor

INTRODUCTION In recent years, the concept that peripheral tolerance is maintained by T cells with immunoregulatory function has reemerged. Research in this area is driven by the need

From the Department of Pathology, Columbia University, New York, NY. Address reprint requests to: Dr. Nicole Suciu-Foca, Columbia University, 630 West 168 Street–P&&S 14-401, New York, NY 10032; Tel: (212) 305-6941; Fax: (212) 305-3429; E-mail: [email protected]. Received August 25, 2004; accepted September 9, 2004. Human Immunology 65, 1297–1306 (2004) © American Society for Histocompatibility and Immunogenetics, 2004 Published by Elsevier Inc.

to develop strategies that can prevent autoimmunity, transplant rejection, and progression of malignant and chronic viral diseases. It is apparent that although, in some pathologic conditions, the induction of efficient immune responses is crucial to survival, in others, induction of antigen-specific tolerance prevents development of the disease. In both humans and rodents the most extensively characterized regulatory T (TR) cells are the thymus-derived 0198-8859/04/$–see front matter doi:10.1016/j.humimm.2004.09.004

1298

CD4⫹CD25⫹ natural TR. Depletion of these cells in newborn mice leads to spontaneous development of various autoimmune diseases, whereas reconstitution of the depleted population prevents the development of autoimmunity [1– 6]. Similarly, elimination of CD4⫹CD25⫹T cells enhances allograft rejection and tumor immunity in rodents, whereas expansion of CD4⫹CD25⫹ TR suppresses alloreactivity [1– 6]. CD4⫹CD25⫹ natural TR were shown to be anergic, yet they require T cell receptor (TCR) triggering to suppress antigen-induced activation and proliferation of other CD4⫹ or CD8⫹ T cells. Natural TR act in an antigen-nonspecific manner by a cell contact– dependent mechanism that involves T cell–to–T cell interaction [1–7]. The existence of a similar subset of anergic CD4⫹CD25⫹ TR has also been documented in humans [8 –10]. Similar to the situation encountered in mice, human CD4⫹CD25⫹ natural TR have no antigen specificity and inhibit T-cell proliferation in response to alloantigens, phytohaemagglutinin (PHA), and immobilized anti-CD3 monoclonal antibodies (mAb) [8 –10]. The most characteristic feature of murine and human natural TRis the expression of the forkhead/winged helix transcription factor FOXP3, a key regulatory gene involved in the development of natural TR [11–13]. It has been recently demonstrated that unprimed CD4⫹CD25⫺ T cells from human peripheral blood can be converted into FOXP3⫹ TR by TCR triggering and exposure to transforming growth factor-beta (TGF-␤) [14, 15]. Other nonantigen-specific regulatory T-cell subtypes that have been described include: CD4⫹CD25⫹ interleukin (IL)-10 producing TR1 cells, gamma-delta T cells, NK1.1 T cells, CD8⫹CD25⫹, and CD4⫺CD8⫺ T cells. It is still unknown whether these regulatory T-cell subtypes share molecular markers, such as FOXP3, with natural TR [16 –21]. Regulatory T-cell populations that display antigen specificity and exert their function by conditioning antigen presenting cells (APC) to become tolerogenic have also been described [22–30]. Included in this latter category are human CD8⫹CD28⫺, major histocompatibility complex (MHC) class I restricted, T suppressor (TS) cells [22–29] and CD4⫹CD25⫹CD45RO⫹, MHC class II restricted, TR cells [30]. In previous studies, we have shown that MHC-allorestricted TS and TR can be generated in vitro by multiple rounds of T-cell stimulations with allogeneic APC [22, 25, 26, 28]. Evidence that TS and TR also develop in vivo has emerged from studies of rejection-free organ allograft recipients [28 –30]. TS and TR act directly on APC, inducing the upregulation of inhibitory receptors, immunoglobulin-like transcript (ILT)3 and ILT4 [28 –30]. Dendritic cells (DC) and endothelial cells (EC), which interact with allospecific TS, become tolerogenic to primed and unprimed T-helper (TH) cells that recognize

L. Scotto et al.

MHC class II antigens on their membrane [28, 30, 31]. Furthermore, ILT3high ILT4high DC and EC were shown to promote the differentiation of CD8⫹ TS and CD4⫹ TRcells [28, 30, 31]. To gain insight into the common denominators of antigen specific and nonspecific regulatory T cells, we have analyzed their characteristics at the molecular level. We now demonstrate that there is an almost complete overlap between natural TR and alloantigen-specific CD8⫹CD28⫺ TS in terms of expression of molecular markers considered to be specific for natural TR.

MATERIALS AND METHODS Generation of Allospecific T-Cell Lines Peripheral blood mononuclear cells from healthy donors were primed with either gamma-irradiated CD2depleted APC from an allogeneic donor or with irradiated monomyelocytic DC-like cells from the KG1 cell line (ATCC, Manassas, VA) as previously described [22, 28, 30]. After multiple stimulations with allogeneic priming cells, CD8⫹CD28⫺, CD8⫹CD28⫹, ⫹ ⫺ ⫹ ⫹ CD4 CD25 , and CD4 CD25 T cells were isolated using magnetic beads (Miltenyi Biotech, Auburn, CA), as previously described [22, 28, 30]. CD62L⫹ and CD62L⫺ T-cell subsets were separated from allospecific CD8⫹CD28⫺ T cells using goat–anti-mouse magnetic beads (Dynal, Lake Success, NY) coupled with mAb to CD62L (BD Pharmingen, San Diego, CA). Proliferation Assays Unprimed CD4⫹CD25⫺ T cells (5 ⫻ 104) from fresh peripheral blood were stimulated in 5-day mixed lymphocyte culture (MLC) with allogeneic DC (1.25 ⫻ 104). CD8⫹CD28⫺ TS cells (5 ⫻ 104) or CD4⫹CD25⫹ TR cells (5 ⫻ 104) from T cell line (TCL) primed to the same DC were added to triplicate reactions. Cultures were labeled with 3H thymidine (1 ␮Ci/well) (Amersham Biosciences, Piscataway, NJ) on day 5 and harvested after 18 hours. Percent inhibition of 3H thymidine incorporation in TH primed to allogeneic DC in the presence of TS and TR was calculated as previously described [22, 28, 30]. Cytolytic T-Lymphocyte Assays Epstein-Barr virus–transformed B cell lines, sharing human leukocyte antigen (HLA) class I antigens with the APC used for TCL priming, served as targets for cytolytic T-lymphocyte (CTL) assays. Target cells were labeled with 100 ␮Ci of Na251CrO4, (Amersham Biosciences) and plated at a concentration of 5 ⫻ 103/well in 96-well plates. Serial twofold dilutions of effector cells were added to a constant number of target cells to obtain effector to target cell ratios of 100:1, 50:1, 25:1, and

Molecular Markers in Regulatory T Cells

12.5:1. After 4 hours of incubation at 37 °C in a 5% CO2 atmosphere, the amount of 51Cr released in the supernatant was measured using a gamma scintillation counter and percent lysis was calculated as previously described [22]. Generation of Gene Expression Profiles T cells from the peripheral blood of different responders were stimulated two times (at 7-day intervals) with irradiated KG1 cells. At the end of the second round of priming, CD8⫹ T cells were isolated from these lines and restimulated for 24 hours with KG1. The KG1 cells were then removed using mAb to CD34 conjugated to magnetic beads (Dynal). The CD28⫹ and CD28⫺ fractions were isolated and tested for suppressive and cytotoxic activity as previously described [22]. CD8⫹ CD28⫺ T cells, which had no cytotoxic activity, yet inhibited CD4⫹ TH proliferation to KG1 by ⱖ80%, were used as TS. CD8⫹CD28⫹ T cells from the same TCL, which exhibited ⬎30% cytotoxic activity at a 25:1 effector to target cell ratio, were used as cytotoxic T (TC) cells. CD8⫹CD28⫺ TS and CD8⫹CD28⫹ TC cells isolated from five independent lines and fulfilling the requirements discussed, were subjected to oligonucleotide microarray analysis [32]. Briefly, RNA samples were prepared using the TRIzol reagent (Invitrogen Corporation, Carlsbad, CA) and the Rneasy RNA extraction kit (QIAGEN Inc, Valencia, CA) following the manufacturers’ recommendations. Double-stranded complementary DNA was synthesized from 6 ␮g of total RNA according to Affymetrix methodology (Affymetrix, Santa Clara, CA) and correspondent cDNA was purified with Phase Lock Gels (Eppendorf, Hamburg, Germany). cDNA were then used as template to synthesize biotin-labeled RNA with the BioArray High Yield RNA Transcript Labeling Kit (Enzo, New York, NY). Hybridization from biotinylated cRNA to human genome GeneChips (U95A Affymetrix) was performed in accordance with the manufacturer’s instructions. The hybridized gene chips were stained with streptavidin-phycoerythrin and scanned using the Hewlett-Packard gene array scanner (Palo Alto, CA). MicroArray Suite, version 5.0, (Affymetrix) was used to calculate average differences, log ratio, and absolute call from the scanned images. The average difference of each experiment was normalized to 100 to allow comparison among multiple arrays. Microarray Data Analysis We used the software platform Genes@Work (IBM, TJ Watson Research Center, Yorktown, NY) to analyze the 10 data sets (5 sets of CD8⫹ CD28⫺ TS cells and 5 sets of CD8⫹CD28⫹ TC cells; each pair of TS and TC were from the same TCL). An unsupervised analysis was first performed to determine whether the two

1299

T-cell subsets (TS and TC) clustered separately with regard to their global gene expression, followed by a supervised analysis to identify candidate genes. Supervised clustering allows the identification of genes that are differentially expressed in two cell types defined a priori according to a given criterion (the expression of CD28 in our study). Data are presented in a matrix format. Each row represents a single gene, and each column an experimental sample. The ratio of the abundance of transcripts of each gene to the median abundance of the gene’s transcript is represented by a color in the corresponding sample in the matrix. Green squares indicate transcript levels below the median; red squares indicate transcripts levels above the median. A crucial requirement for the identification of differentially expressed genes is the consistent expression of a given gene across all five samples of a given subset. To confirm the microarray data, semiquantitative reverse transcriptase–polymerase chain reaction (RT-PCR) was performed using a Mastercycler (Eppendorf, Hamburg, Germany) and specific primers to amplify fragments from the different genes analyzed. Semiquantitative RT-PCR Total RNA was extracted from CD8⫹CD28⫺TS, CD8⫹CD28⫹ TC, CD4⫹CD25⫹ TR, and CD4⫹CD25⫺ T cells isolated from allospecific TCL. Total RNA was also extracted from CD4⫹CD25⫹ natural TR, CD4⫹CD25⫺, CD8⫹CD28⫺, and CD8⫹CD28⫹ T cells isolated from fresh peripheral blood using the corresponding magnetic beads as previously described [22]. For RNA extraction, the RNAqueous kit (Ambion, Inc., Austin, TX) was used according to the manufacturer’s recommendation. First-strand cDNA was synthesized using SuperScript II RNase H⫺ Reverse Transcriptase (Invitrogen Corporation). The following primers were used in PCR reactions: glucocorticoid-induced tumor necrosis factor receptor (TNFR)–related protein (GITR) primers from R&D System (Minneapolis, MN); FOXP3: 5= primer #1 TTGGACAAGGACCCGATGCCCAACCCC, 3= primer #2 CCCTGGCAGGCAAGACAGTGGAAACCTC (expected size, 1350 or 1450 bp); 5= primer #3 TCCCAGAGTTCCTCCACAAC, 3= primer #4 GCAAGACAGTGGAAACCTCAC (expected size, 465 bp); LYN: 5= primer AAGGCAGAAGAGAGACCAACGTTT, 3= AGAATAGATGTTTTCTTCTCAAACGGC (expected size, 383 bp); KIR2DL3: 5= primer CTGGAATCTGAAGGCGTGAGTC, 3= primer CACGTGTCTAAGTGCCGTGTTAA (expected size, 287 bp); KIR3DL1: 5= primer AGCCCTGTCTCAAAACCGAGTT, 3= primer TGGGTAAGTGCCACGTCAAGA (expected size, 323 bp); KIR3DL2: 5= primer CTCTTCCTCACACCACGAATC, 3= primer CAAGTGTGTAAGTGCCGTGTT (expected size, 250 bp);

1300

CTLA4: 5= primer CATAGCAGTGCTTGATTGCGT, 3= primer TAAGAATTGGGCCCATCGAAC (expected size, 217 bp); OX40: 5= primer GTGGGGCCCAGCATAACATAC, 3= primer GAACAGCTTAAGTGCAGACGAGA (expected size, 282 bp); 4-1BB: 5= primer GCTTTGGGACATTTAACGATCAGA, (expected size 369 bp) 3= primer GAGTTTCTTTCTGCCCCGTTTAAC; CD103: 5= primer GAACCACAGAACTAAGATCACTGTCGT, 3= primer AGCAGGTCCTAATTCTCTTCTTCGAG (expected size, 231 bp); CD25: 5= primer AATCAAAGGTGCTAAATGGTCGC, 3= primer TTTATTAGGCAACGTGAACGGG (expected size 459 bp); CD62L: 5= primer GATCCTTTAAATCCTTCCATGAAACG, 3= primer CTGGAGTTAGAAAGAAAGGAGAGCGTA (expected size, 463 bp); TNFR2: 5= primer GTGTGTGTAGCCAAGGTCGGTAA, 3= primer CACAGAGTCTCCAAATTCATCGC (expected size, 673 bp); and GAPDH: 5= primer CGGAGTCAACGGATTTGGTCGTAT, 3= primer AGCCTTCTCCSTGGTGGTGAAGAC (expected size, 362 bp). PCR reactions were performed in a Mastercycler (Eppendorf, Hamburg, Germany) at 30 cycles in a 20 ␮l volume; PCR products were analyzed in agarose gel stained with ethidium bromide. Flow Cytometry Flow cytometry studies were performed with a FACScan (Becton Dickinson). CaliBRITE beads from Becton Dickinson were run under the FACSComp program to calibrate the instrument [30]. CD8⫹ T cells were stained with the following antibodies: phycoerythrin-conjugated mAbs to IL-10, TGF-␤, and interferon (IFN)-␥, fluorescein isothiocyanate– conjugated mAb to CD62L, perdinin chlorophyll protein to CD28 and allophycocyminCD8 all from BD Pharmingen. Other mAbs used to check for purity include phycoerythrin-CD16, CD56, CD14, and CD19. Intracellular levels of IL-10, TGF-␤, or IFN-␥ in T cells from alloantigen-specific TCL were measured after 6 hours of incubation with 25 ng/ml phorbol 12-myristate 13 acetate and 1 ␮M ionomycin, both from Sigma (St. Louis, MO). Cells were stained with allophycocyminCD8, perdinin chlorophyll protein-CD28 fluorescein isothiocyanate conjugated- CD62L (BD Pharmingen), and either phycoerythrin-, IFN-␥, ⌻GF-␤, or IL-10 (BD Pharmingen) using cytoperm/cytofix intracellular staining kit (BD Pharmingen) according to the manufacturer’s instructions. ILT3 and ILT4 expression on CD14⫹ monocytes was determined using fluorescein isothiocyanate conjugatedCD14 (BD Pharmingen), R-phycoerythrin-cyanine (PC5) conjugated anti-human ILT3 (Beckman-Coulter Inc., Miami, FL). ILT4 staining was performed as previously described [28, 30].

L. Scotto et al.

For each cell surface marker, a corresponding isotypematched control antibody that was conjugated with the same fluorescent dye was used. Six parameters (forward scatter, side scatter, and four fluorescence channels) were used for list mode data analysis. RESULTS Comparison of CD8ⴙCD28ⴚ With CD8ⴙCD28ⴙ T Cells From Allospecific TCL In an attempt to identify markers characteristic for allospecific CD8⫹CD28⫺ TS, we first compared their gene expression profile (mRNA microarray profiles) with that of allospecific CD8⫹CD28⫹ TC cells from the same TCL. Affymetrix gene chip analysis of CD8⫹CD28⫺ TS and CD8⫹CD28⫹ TC from five different TCL showed differences in the level of expression of genes that encode cell surface molecules, signal transduction molecules, chemokines, cytokines, apoptosis-related proteins, cell growth regulators, and metabolic enzymes. Of 12,000 genes tested, 72 were differentially expressed. Of these 72 genes, 34 had higher and 38 had lower expression in CD8⫹CD28⫺ TS cells compared with the CD8⫹CD28⫹ TC cells. Among the genes with higher expression in the CD8⫹CD28⫺ TS cells, three were members of the killer cell immunoglobulin-related receptors (KIR) family: KIR3DL1 (NKAT3, CD158E2), which is specific for HLA-B antigens; KIR3DL2 (NKAT4, CD158K), which is specific for HLA-A antigens; and KIR2DL3 (NKAT2, CD158B2), which is specific for HLA-C antigens (Figure 1A) [33]. The higher expression of KIR genes in CD8⫹CD28⫺ TS compared with CD8⫹CD28⫹ TC is consistent with the fact that TS have no cytolytic activity [19]. The oncogene LYN (V-YES-1 Yamaguchi Sarcoma Viral Related Oncogene Homolog), a tyrosine kinase essential for establishing immunoreceptor tyrosine-based inhibitory motif (ITIM)– dependent signaling [34], was also expressed at higher levels in CD8⫹CD28⫺ TS compared with CD8⫹CD28⫹ TC cells. The increased expression of these genes in CD8⫹CD28⫺ TS compared with CD8⫹CD28⫹ TC was further confirmed by semiquantitative RT-PCR analysis of independent TS and TC samples from other TCL (Figures 1A, B). Comparison of Different Markers in Natural CD4ⴙCD25ⴙ TR, Alloantigen-Specific CD4ⴙCD25ⴙ TR, and CD8ⴙCD28ⴚ TS The intensive search for molecular markers specific for natural TR has generated a growing list of candidate genes that includes CTLA4 [35, 36], FOXP3 [11, 13, 37], L-selectin (CD62L) [38], ␣⬙␤7 integrin (CD103)

Molecular Markers in Regulatory T Cells

FIGURE 1 Gene expression profiles in CD8⫹CD28⫺ T suppressor (TS) cells and CD8⫹CD28⫹ cytotoxic T (TC) cells. (A) A total of 34 genes had higher and 38 had lower expression in TS compared to TC. (B) Semiquantitative RT-PCR analysis of KIR2DL3, KIR3DL1, KIR3DL2, and Lyn, in TS and TC. GAPDH was used as control for sample loading.

1301

1302

L. Scotto et al.

[39], and members of the TNFR family such as the GITR [40, 41], TNFRSF4 (OX-40) [42], TNFRSF9 (4-1BB) [43], and TNFR2 [44]. The mRNA expression level of GITR, CTLA-4, OX40, CD103, FOXP3, and TNFR2 was similar in natural CD4⫹CD25⫹ TR, alloantigen-induced CD4⫹CD25⫹, and CD8⫹CD28⫺ regulatory T-cell subsets, respectively (Figure 2). TS showed lower expression of CD25 compared with natural and alloantigen-induced TR. Allospecific CD4⫹CD25⫹ TR showed lower expression of CD62L compared with natural CD4⫹ TR and antigeninduced CD8⫹ TS. Unprimed CD8⫹CD28⫺ T cells from fresh peripheral blood, which have no regulatory activity, do not express FOXP3, GITR, OX40, CD25, CD62L, and 4-1BB. However, these unprimed T cells display low levels of CTLA-4 and TNFR2. CD103 was expressed at the same level in unprimed CD8⫹CD28⫺ T cells and in primed regulatory cells. Thus CD8⫹CD28⫺ TS differ from natural CD4⫹CD25⫹ TR only by the lower mRNA expression level of CD25. CD4⫹CD25⫹ antigen-induced TR differ from natural TR by the lower mRNA expression level of CD62L. Because unprimed CD8⫹CD28⫺ T cells from peripheral blood do not express FOXP3, whereas CD8⫹CD28⫺ TS from allostimulated TCL are FOXP3-positive, we investigated the kinetics of FOXP3 expression after Tcell allostimulation in cultures. Daily monitoring of FOXP3 expression revealed its absence during the first 7 days after the primary stimulation. FOXP3 became detectable 2 days after the second round of stimulation, on day 9, and its expression peaked on day 14 (data not shown). Stimulation of CD8⫹CD28⫺ T cells from fresh peripheral blood with phorbol 12-myristate 13 acetate and ionomycin for 3 days did not result in induced FOXP3 expression in the stimulated T cells. FOXP3␣ Expression in Natural TR and Antigen-Specific TS and TR In previous studies, we have described the identification of a new isoform of FOXP3, which we referred to as FOXP3␣ [31]. The new isoform, FOXP3␣, lacks a region of 105 nucleotides from position 213 to 317, which corresponds to the entire exon 3 of the FOXP3 gene (GenBank Accession #014009). FOXP3 expression analysis, by RT-PCR, in unprimed and primed T-cell subsets indicated that FOXP3␣ was expressed together with FOXP3 in unprimed CD4⫹CD25⫹ natural TR and alloantigen-specific CD8⫹CD28⫺ TS and CD4⫹CD25⫹ TR. However, CD4⫹CD25⫺, CD8⫹CD28⫺, and CD8⫹CD28⫹ T-cell subsets isolated from fresh peripheral blood as well as CD4⫹CD25⫺ T cells and CD8⫹CD28⫹ TC isolated from TCL did not express either FOXP3 or FOXP3␣ (Figure 3).

FIGURE 2 Analysis of gene expression in T-cell subsets. Unprimed CD8⫹CD28⫺, naturally occurring CD4⫹ CD25⫹ regulatory T cells (TR), and alloantigen-specific CD8⫹CD28⫺ T suppressor cells and CD4⫹ CD25⫹ TR cells were examined for the expression of candidate regulatory genes by semiquantitative reverse transcriptase–polymerase chain reaction. To control for sample loading, GAPDH cDNA was amplified from the same RNA sample.

Molecular Markers in Regulatory T Cells

FIGURE 3 Expression analysis of FOXP3 in unprimed and primed T-cell subsets. Fractionated T-cell subsets were examined for FOXP3 and FOXP3␣ expression by semiquantitative reverse transcriptase–polymerase chain reaction. To control for sample loading, GAPDH was amplified from the same RNA sample.

Study of the Suppressor Activity of CD8ⴙ CD28ⴚ CD62Lⴙ TS Recent studies have shown that CD4⫹CD25⫹ natural TR which express CD62L display a significantly stronger suppressor activity than CD4⫹CD25⫹CD62L⫺ TR [38]. We explored the possibility that a similar association between CD62L expression and increased suppressive activity may exist within the CD8⫹CD28⫺ Ts population. The frequency of CD62L⫹T cells within CD8⫹CD28⫺ Ts from five different TCL ranged from 64% to 77% as measured by flow cytometric analysis (data not shown). CD8⫹CD28⫺ CD62L⫹ and CD8⫹CD28⫺ CD62L⫺ TS were sorted from the same TCL (A primed to B) and tested at different concentrations for their effect on the proliferative response of autologous CD4⫹CD25⫺ T cells (5 ⫻ 104) to allogeneic dendritic cells (1 ⫻ 104/well) from stimulator B used for priming. CD4⫹ TH proliferation was measured after 5 days. Although both the CD62L⫹ and CD62L⫺ subsets inhibited CD4⫹ TH alloreactivity in a dose-dependent manner, CD62L⫹ TS were more potent suppressors on a per-cell basis (Figure 4A). Addition to the cultures of various concentrations of mAb to CD62L had no effect on suppression indicating that CD62L is not directly involved in the inhibitory activity of CD8⫹CD28⫺ TS cells. RT-PCR studies of CD62L⫹ and CD62L⫺ TS showed no differences in mRNA expression of FOXP3, FOXP3␣, GITR, and CTLA4 (data not shown). Flow cytometric analysis of the CD8⫹CD28⫺ CD62L⫹ and CD8⫹CD28⫺ CD62L⫺ subsets showed no intracellular expression of IL-10, TGF-␤, or IFN-␥. Transwell assays in which mixtures of CD62L⫹ or CD62L⫺ TS and APC (upper chamber) were separated from the mixtures of CD4⫹, TH, and APC (lower chamber) showed no inhibition of TH proliferation by either of these subsets, indicating that both CD62L⫹ and CD62L⫺ TS subsets require cell contact to suppress. This

1303

result is consistent with previous studies of unfractionated CD8⫹CD28⫺ allospecific TS [23]. Because we have previously shown that CD8⫹CD28⫺ TS act directly on APC, inducing the upregulation of the inhibitory receptors ILT3 and ILT4 and the downregulation of costimulatory molecules (such as CD80 and CD86), we compared the capacity of CD8⫹CD28⫺CD62L⫹ and CD8⫹CD28⫺CD62L⫺ cells to induce such changes in APC (monocytes and DCs). When CD8⫹CD28⫺ CD62L⫹ TS were coincubated with CD14⫹ monocytes from the allostimulating donor, they were consistently more potent inducers of tolerogenic changes such as downregulation of CD86 (data not shown) and upregulation of ILT3 and ILT4 than CD8⫹CD28⫺ CD62L⫺ T cells (Figure 4B). DISCUSSION The resurgence of interest in regulation of antigen-specific immune responses has led to the identification of

FIGURE 4 CD8⫹CD28⫺FOXP3⫹CD62L⫹ T cells display stronger suppressor activity compared with CD8⫹ CD28⫺FOXP3⫹CD62L⫹ T cells. (A) Inhibition of T-helper cell proliferation by CD62L⫹ and CD62L⫺CD8⫹CD28⫺ Tsuppressor cells. (B) Induction of immunoglobulin-like transcript (ILT)3 and ILT4 on allostimulatory monocytes by alloantigen-specific CD8⫹CD28⫺CD62L⫹ and CD62L⫺ T-suppressor cells.

1304

T-cell subsets that have suppressive properties. The best characterized populations of regulatory cells are naturally occurring CD4⫹CD25⫹ TR from which a growing list of phenotypic markers, presumed to allow the unequivocal identification of regulatory cells, has been derived [45]. In the present study, we demonstrate that these genes are expressed at relatively equal levels in naturally occurring CD4⫹CD25⫹ TR, alloantigen-specific ⫹ CD8 CD28⫺ TS, and CD4⫹CD25⫹ TR cells. Of notice, CD4⫹CD25⫹ natural TR exert their function by acting directly on other T cells, whereas antigen-specific CD8⫹CD28⫺ TS and CD4⫹CD25⫹ TR acquire and exert their function via direct interaction with APC. Antigen-specific TS and TR recognize MHC peptide complexes on the cell surface of APC and trigger the upregulation of inhibitory receptors and downregulation of costimulatory molecules, rendering the APC tolerogenic [28, 30]. This implies that, regardless of their mechanism of action, T cells with contact-dependent suppressor activity show elevated expression of the same set of genes. This set of genes include CTLA-4 a coinhibitory molecule that belongs to the B7-CD28 family; which is involved in the control of T-cell immunity [35, 36]; FOXP3, which encodes a transcription repressor involved in the generation and function of TR [11, 13, 37]; and genes encoding cell adhesion molecules such as CD62L [38] and CD103, which bind to epithelial cadherins [39]. Comparison of global gene expression in CD8⫹CD28⫺ and CD8⫹CD28⫹ T-cell subsets suggests a role for some members of the KIR family in the function of the CD8⫹ TS subset. The KIRs regulate the inhibition and activation of natural killer cell responses through recognition of HLA class I molecules on target cells. Some of the KIRs receptors (i.e., KIR2DL3) have been previously found on a subset of CD8⫹ T cells with a memory phenotype [46 – 48]. The biologic significance of KIRs has been elucidated only recently. In vitro experiments using T-cell clones showed that the expression of KIRs inhibits the effector functions of cytotoxic T cells. In vivo studies suggest that the biologic function of KIRs resides in downregulation of activation-induced cell death and promotion of cell survival [47, 48]. It is possible, therefore, that the specific upregulation of some of the KIRs in allospecific CD8⫹CD28⫺ TS blocks their cytotoxic capacity, accounting for the inability of these cells to kill their target cells. It is also possible that Lyn, a tyrosine kinase that is essential for establishing ITIMdependent signaling and for activation of specific protein tyrosine phosphatases within myeloid cells, is also involved in this phenomenon [34]. As with other inhibitory KIRs, KIR3DL1, KIR3DL2, and KIR2DL3 harbor intracytoplasmic ITIMs that recruit and activate protein tyrosine phosphatases SHP-1 or SHP-2 [34]. The higher

L. Scotto et al.

expression of the tyrosine kinase Lyn in CD8⫹ CD28⫺ TS cells may be required for establishing ITIM-dependent signaling through KIRs. Recent findings suggest that the CD4⫹CD25⫹ TR represent a heterogeneous population with respect to their proliferative and suppressive capacity [38]. Functional analysis of CD62L⫹ and CD62L⫺ T cells within the CD8⫹CD28⫺ T-cell population indicates the existence of a similar heterogeneity. Although both CD62L⫹ and CD62L⫺ subsets do not produce IL-10, TGF-␤, and IFN-␥, the CD8⫹CD28⫺ CD62L⫹ TS cells are more potent suppressors of THproliferation and inducers of tolerogenic changes in APC compared with CD8⫹CD28⫺CD62L⫺ TS cells. This finding suggests that CD62L, an adhesion molecule, strengthens the interaction between TS and APC. This study, which is the first report on molecular markers expressed by antigenspecific TS and TR, emphasizes the need to further dissect the mechanisms of immunosuppression. ACKNOWLEDGMENT

This work was supported by grants from the NIH (AI2521018, AI55234-02) and the Interuniversitary Organ Transplantation Consortium, Rome, Italy.

REFERENCES 1. Sakaguchi S, Sakaguchi N, Asano M, Itoh M, Toda M: Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151, 1995. 2. Suri-Payer E, Amar AZ, Thornton AM, Shevach EM: CD4⫹CD25⫹ T cells inhibit both the induction and effector function of autoreactive T cells and represent a unique lineage of immunoregulatory cells. J Immunol 160:1212, 1998. 3. Sakaguchi S, Sakaguchi N, Shimizu J, Yamazaki S, Sakihama T, Itoh M, Kuniyasu Y, Nomura T, Toda M, Takahashi T: Immunologic tolerance maintained by CD25⫹ CD4⫹ regulatory T cells: their common role in controlling autoimmunity, tumor immunity, and transplantation tolerance. Immunol Rev 182:18, 2001. 4. Itoh M, Takahashi T, Sakaguchi N, Kuniyasu Y, Shimizu J, Otsuka F, Sakaguchi S: Thymus and autoimmunity: production of CD25⫹CD4⫹ naturally anergic and suppressive T cells as a key function of the thymus in maintaining immunologic self-tolerance. J Immunol 162:5317, 1999. 5. Shevach EM: Regulatory T cells in autoimmunity*. Annu Rev Immunol 18:423, 2000. 6. Asano M, Toda M, Sakaguchi N, Sakaguchi S: Autoimmune disease as a consequence of developmental abnormality of a T cell subpopulation. J Exp Med 184:387, 1996. 7. Thornton AM, Shevach EM: Suppressor effector function

Molecular Markers in Regulatory T Cells

8.

9.

10.

11.

12.

13.

14.

15.

16.

17. 18.

19.

20.

21.

of CD4⫹CD25⫹ immunoregulatory T cells is antigen nonspecific. J Immunol 164:183, 2000. Stephens LA, Mottet C, Mason D, Powrie F: Human CD4(⫹)CD25(⫹) thymocytes and peripheral T cells have immune suppressive activity in vitro. Eur J Immunol 31:1247, 2001. Levings MK, Sangregorio R, Roncarolo MG: Human cd25(⫹)cd4(⫹) t regulatory cells suppress naive and memory T cell proliferation and can be expanded in vitro without loss of function. J Exp Med 193:1295, 2001. Jonuleit H, Schmitt E, Stassen M, Tuettenberg A, Knop J, Enk AH: Identification and functional characterization of human CD4(⫹)CD25(⫹) T cells with regulatory properties isolated from peripheral blood. J Exp Med 193: 1285, 2001. Fontenot JD, Gavin MA, Rudensky AY: Foxp3 programs the development and function of CD4⫹CD25⫹ regulatory T cells. Nat Immunol 4:330, 2003. Hori S, Nomura T, Sakaguchi S: Control of regulatory T cell development by the transcription factor Foxp3. Science 299:1057, 2003. Khattri R, Cox T, Yasayko SA, Ramsdell F: An essential role for Scurfin in CD4⫹CD25⫹ T regulatory cells. Nat Immunol 4:337, 2003. Walker MR, Kasprowicz DJ, Gersuk VH, Benard A, Van Landeghen M, Buckner JH, Ziegler SF: Induction of FoxP3 and acquisition of T regulatory activity by stimulated human CD4⫹CD25- T cells. J Clin Invest 112: 1437, 2003. Chen W, Jin W, Hardegen N, Lei KJ, Li L, Marinos N, McGrady G, Wahl SM: Conversion of peripheral CD4⫹CD25- naive T cells to CD4⫹CD25⫹ regulatory T cells by TGF-beta induction of transcription factor Foxp3. J Exp Med 198:1875, 2003. Groux H, O’Garra A, Bigler M, Rouleau M, Antonenko S, de Vries JE, Roncarolo MG: A CD4⫹ T-cell subset inhibits antigen-specific T-cell responses and prevents colitis. Nature 389:737, 1997. Hayday A, Tigelaar R: Immunoregulation in the tissues by gammadelta T cells. Nat Rev Immunol 3:233, 2003. Zeng D, Lewis D, Dejbakhsh-Jones S, Lan F, GarciaOjeda M, Sibley R, Strober S: Bone marrow NK1.1(-) and NK1.1(⫹) T cells reciprocally regulate acute graft versus host disease. J Exp Med 189:1073, 1999. Cosmi L, Liotta F, Lazzeri E, Francalanci M, Angeli R, Mazzinghi B, Santarlasci V, Manetti R, Vanini V, Romagnani P, Maggi E, Romagnani S, Annunziato F: Human CD8⫹CD25⫹ thymocytes share phenotypic and functional features with CD4⫹CD25⫹ regulatory thymocytes. Blood 102:4107, 2003. Zhang ZX, Yang L, Young KJ, DuTemple B, Zhang L: Identification of a previously unknown antigen-specific regulatory T cell and its mechanism of suppression. Nat Med 6:782, 2000. Sutmuller RP, Offringa R, Melief CJ: Revival of the

1305

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

regulatory T cell: new targets for drug development. Drug Discov Today 9:310, 2004. Liu Z, Tugulea S, Cortesini R, Suciu-Foca N: Specific suppression of T helper alloreactivity by allo-MHC class I-restricted CD8⫹CD28⫺ T cells. Int Immunol 10:775, 1998. Ciubotariu R, Colovai AI, Pennesi G, Liu Z, Smith D, Berlocco P, Cortesini R, Suciu-Foca N: Specific suppression of human CD4⫹ Th cell responses to pig MHC antigens by CD8⫹CD28⫺ regulatory T cells. J Immunol 161:5193, 1998. Jiang S, Tugulea S, Pennesi G, Liu Z, Mulder A, Lederman S, Harris P, Cortesini R, Suciu-Foca N: Induction of MHCclass I restricted human suppressor T cells by peptide priming in vitro. Hum Immunol 59:690, 1998. Liu Z, Tugulea S, Cortesini R, Lederman S, Suciu-Foca N: Inhibition of CD40 signaling pathway in antigen presenting cells by T suppressor cells. Hum Immunol 60:568, 1999. Li J, Liu Z, Jiang S, Cortesini R, Lederman S, Suciu-Foca N: T suppressor lymphocytes inhibit NF-kappa B-mediated transcription of CD86 gene in APC. J Immunol 163:6386, 1999. Colovai AI, Liu Z, Ciubotariu R, Lederman S, Cortesini R, Suciu-Foca N: Induction of xenoreactive CD4⫹ T-cell anergy by suppressor CD8⫹CD28⫺ T cells. Transplantation 69:1304, 2000. Chang CC, Ciubotariu R, Manavalan JS, Yuan J, Colovai AI, Piazza F, Lederman S, Colonna M, Cortesini R, DallaFavera R, Suciu-Foca N: Tolerization of dendritic cells by T(S) cells: the crucial role of inhibitory receptors ILT3 and ILT4. Nat Immunol 3:237, 2002. Colovai AI, Mirza M, Vlad G, Wang S, Ho E, Cortesini R, Suciu-Foca N: Regulatory CD8⫹CD28⫺ T cells in heart transplant recipients. Hum Immunol 64:31, 2003. Manavalan JS, Rossi PC, Vlad G, Piazza F, Yarilina A, Cortesini R, Mancini D, Suciu-Foca N: High expression of ILT3 and ILT4 is a general feature of tolerogenic dendritic cells. Transpl Immunol 11:245, 2003. Manavalan JS, Kim-Schulze S, Scotto L, Naiyer AJ, Vlad G, Colombo PC, Marboe C, Mancini D, Cortesini R, SuciuFoca N: Alloantigen specific CD8⫹CD28⫺ FOXP3⫹ T suppressor cells induce ILT3⫹ ILT4⫹ tolerogenic endothelial cells, inhibiting alloreactivity. Int Immunol 16:1055, 2004. Suciu-Foca Cortesini N, Piazza F, Ho E, Ciubotariu R, LeMaoult J, Dalla-Favera R, Cortesini R: Distinct mRNA microarray profiles of tolerogenic dendritic cells. Hum Immunol 62:1065, 2001. Moretta L, Biassoni R, Bottino C, Mingari MC, Moretta A: Human NK-cell receptors. Immunol Today 21:420, 2000. Harder KW, Parsons LM, Armes J, Evans N, Kountouri N, Clark R, Quilici C, Grail D, Hodgson GS, Dunn AR, Hibbs ML: Gain- and loss-of-function Lyn mutant mice

1306

35.

36.

37.

38.

39.

40.

41.

define a critical inhibitory role for Lyn in the myeloid lineage. Immunity 15:603, 2001. Takahashi T, Tagami T, Yamazaki S, Uede T, Shimizu J, Sakaguchi N, Mak TW, Sakaguchi S: Immunologic selftolerance maintained by CD25(⫹)CD4(⫹) regulatory T cells constitutively expressing cytotoxic T lymphocyteassociated antigen 4. J Exp Med 192:303, 2000. Read S, Malmstrom V, Powrie F: Cytotoxic T lymphocyteassociated antigen 4 plays an essential role in the function of CD25(⫹)CD4(⫹) regulatory cells that control intestinal inflammation. J Exp Med 192:295, 2000. Brunkow ME, Jeffery EW, Hjerrild KA, Paeper B, Clark LB, Yasayko SA, Wilkinson JE, Galas D, Ziegler SF, Ramsdell F: Disruption of a new forkhead/winged-helix protein, scurfin, results in the fatal lymphoproliferative disorder of the scurfy mouse. Nat Genet 27:68, 2001. Fu S, Yopp AC, Mao X, Chen D, Zhang N, Mao M, Ding Y, Bromberg JS: CD4⫹ CD25⫹ CD62⫹ T-regulatory cell subset has optimal suppressive and proliferative potential. Am J Transplant 4:65, 2004. Lehmann J, Huehn J, de la Rosa M, Maszyna F, Kretschmer U, Krenn V, Brunner M, Scheffold A, Hamann A: Expression of the integrin alpha Ebeta 7 identifies unique subsets of CD25⫹ as well as CD25- regulatory T cells. Proc Natl Acad Sci U S A 99:13031, 2002. Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakaguchi S: Stimulation of CD25(⫹)CD4(⫹) regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3:135, 2002. McHugh RS, Whitters MJ, Piccirillo CA, Young DA, Shevach EM, Collins M, Byrne MC: CD4(⫹)CD25(⫹) immunoregulatory T cells: gene expression analysis re-

L. Scotto et al.

42.

43.

44.

45. 46.

47.

48.

veals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16:311, 2002. Takeda I, Ine S, Killeen N, Ndhlovu LC, Murata K, Satomi S, Sugamura K, Ishii N: Distinct roles for the OX40-OX40 ligand interaction in regulatory and nonregulatory T cells. J Immunol 172:3580, 2004. Choi BK, Bae JS, Choi EM, Kang WJ, Sakaguchi S, Vinay DS, Kwon BS: 4-1BB-dependent inhibition of immunosuppression by activated CD4⫹CD25⫹ T cells. J Leukoc Biol 75:785, 2004. Annunziato F, Cosmi L, Liotta F, Lazzeri E, Manetti R, Vanini V, Romagnani P, Maggi E, Romagnani S: Phenotype, localization, and mechanism of suppression of CD4(⫹)CD25(⫹) human thymocytes. J Exp Med 196: 379, 2002. Wood KJ, Sakaguchi S: Regulatory T cells in transplantation tolerance. Nat Rev Immunol 3:199, 2003. Mingari MC, Vitale C, Cambiaggi A, Schiavetti F, Melioli G, Ferrini S, Poggi A: Cytolytic T lymphocytes displaying natural killer (NK)-like activity: expression of NK-related functional receptors for HLA class I molecules (p58 and CD94) and inhibitory effect on the TCR-mediated target cell lysis or lymphokine production. Int Immunol 7:697, 1995. Young NT, Uhrberg M: KIR expression shapes cytotoxic repertoires: a developmental program of survival. Trends Immunol 23:71, 2002. Ugolini S, Arpin C, Anfossi N, Walzer T, Cambiaggi A, Forster R, Lipp M, Toes RE, Melief CJ, Marvel J, Vivier E: Involvement of inhibitory NKRs in the survival of a subset of memory-phenotype CD8⫹ T cells. Nat Immunol 2:430, 2001.