Oxandrolone blocks glucocorticoid signaling in an androgen receptor-dependent manner

Steroids 69 (2004) 357–366

Oxandrolone blocks glucocorticoid signaling in an androgen receptor-dependent manner Jingbo Zhao a,b , William A. Bauman a,b,d , Ruojun Huang a , Avrom J. Caplan d , Christopher Cardozo a,b,c,∗ a

Rehabilitation and Research Development Center of Excellence for the Medical Consequences of Spinal Cord Injury, VA Medical Center, Bronx, NY, USA b Department of Medicine, Mount Sinai School of Medicine, 1 Gustave L. Levy Place, New York, NY 10029, USA c Department of Pharmacology and Biological Chemistry, Mount Sinai School of Medicine, 1 Gustave L. Levy Place, New York, NY 10029, USA d Department of Rehabilitation Medicine, Mount Sinai School of Medicine, 1 Gustave L. Levy Place, New York, NY 10029, USA Received 11 August 2003; received in revised form 10 December 2003; accepted 16 January 2004 Available online 2 June 2004

Abstract The anabolic steroid oxandrolone is increasingly used to preserve or restore muscle mass in those with HIV infection or serious burns. These effects are mediated, in part, by the androgen receptor (AR). Anti-glucocorticoid effects have also been reported for some anabolic steroids, and the goal of our studies was to determine whether oxandrolone had a similar mechanism of action. Studies with in vitro translated glucocorticoid receptor (GR), however, showed no inhibition of cortisol binding by oxandrolone. Conversely, experiments in cell culture systems demonstrated significant antagonism of cortisol-induced transcriptional activation by oxandrolone in cells expressing both the AR and GR. Inhibition was not overcome by increased cortisol concentration, and no inhibition by oxandrolone was observed in cells expressing GR alone, confirming that non-competitive mechanisms were involved. AR-dependent repression of transcriptional activation by oxandrolone was also observed with the synthetic glucocorticoids dexamethasone and methylprednisolone. Furthermore, the AR antagonists 2-hydroxyflutamide and DDE also repressed GR transactivation in an AR-dependent manner. A mutant AR lacking a functional nuclear localization signal (AR4RKM ) was active in oxandrolone-mediated repression of GR even though oxandrolone-bound AR4RKM failed to enter the nucleus and did not affect nuclear import of GR. These data indicate a novel action of oxandrolone to suppress glucocorticoid action via crosstalk between AR and GR. © 2004 Elsevier Inc. All rights reserved. Keywords: Glucocorticoids; Anabolic steroids; Androgen receptor antagonists; Polychlorobiphenyl xenobiotics; Steroid hormone receptors; Crosstalk

1. Introduction Anabolic steroids represent a family of synthetic androgens with tissue-selective activity. This class of medications promotes skeletal growth, increases mass and strength of skeletal muscle, and leads to nitrogen retention while having reduced virulizing and behavioral effects as compared to testosterone. Anabolic steroids are used increasingly to preAbbreviations: AR, androgen receptor; CDS, charcoal-dextran stripped fetal bovine serum; DDE, p2,2-bis(4-chlorophenyl)-1,1-dichloroethane; GFP, green fluorescent protein; GR, glucocorticoid receptor; NLS, nuclear localization sequence; PBS, phosphate buffered saline ∗ Corresponding author. Present address: Spinal Cord Damage Research Center, Room 1E-02, Bronx VA Medical Center, 130 West Kingsbridge Road, Bronx, NY 10468, USA. Tel.: +1-718-584-9000x1828; fax: +1-718-733-5291. E-mail address: [email protected] (C. Cardozo). 0039-128X/$ – see front matter © 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.steroids.2004.01.006

serve or restore skeletal muscle mass and promote wound healing [1–3]. The anabolic steroid oxandrolone has been one of the most widely studied agents. Oxandrolone has been reported to reverse the cachexia associated with HIV infection [4], and, in those with severe burns, decreases cachexia and speeds wound healing [1,5]. In uncontrolled trials in tetraplegic subjects, oxandrolone appeared to improve respiratory function as measured by spirometry, and in case studies, to promote healing of chronic pressure ulcers [6,7]. Despite the increasing use of anabolic steroids, the mechanisms of action of these testosterone analogs remain incompletely defined. The assumed mechanism of action involves binding to and activation of the androgen receptor (AR), which is a ligand-activated transcription factor belonging to the nuclear receptor superfamily. However, emerging evidence suggests that anabolic steroids may act through additional mechanisms acting in parallel with AR activation. For

358

J. Zhao et al. / Steroids 69 (2004) 357–366

example, evidence from studies of receptor binding in crude tissue lysates indicates that some anabolic steroids, such as nandrolone and R1881, are also competitive antagonists for the glucocorticoid receptor (GR) [8]. Antagonism of the GR is of particular interest because cortisol is required for muscle catabolism in clinical conditions such as renal failure, and because excess glucocorticoids, whether endogenous or exogenous, induce muscle catabolism [9,10]. Despite the increasing use of oxandrolone, its ability to antagonize corticosteroid action has not been characterized. The experiments described herein provide evidence for a novel, non-competitive mechanism by which oxandrolone blocks transcriptional activation by GR via interactions of this receptor with oxandrolone-bound AR.

2. Experimental 2.1. Materials Oxandrolone was kindly provided by Savient Pharmaceuticals, Iselen, NJ. [H3 ]-cortisol was from Amersham Biosciences (Piscataway, NJ). Rabbit anti-AR antiserum was a gift of Dr. Dianne M. Robbins (University of Michigan). R1881 was from Perkin-Elmer Life Sciences (Boston, MA). 2-Hydroxyflutamide was a gift from Schering Plough, and DDE was from Sigma–Aldrich (St. Louis, MO). 2.2. Plasmids The XG 46 TL (GRE-Luc) [11] and pMMTV.luciferase (ARE-Luc) [12] reporters were a generous gift of Dr. Micheal Garabedian (New York University). The pT7-rGR and pCMV5.rGR constructs encoding rat GR, were generously provided by Dr. Diane M. Robbins (University of Michigan Medical School), as was the 3xHRE-luciferase reporter (HRE-Luc). A plasmid encoding human androgen receptor in pREP4 was as described [13]. The GFP-tagged GR construct was a generous gift of Dr. William Pratt (University of Michigan). The construct expressing the mutant AR defective for nuclear translocation (AR4RKM ) was a gift from Dr. Elizabeth M. Wilson (University of North Carolina). 2.3. In vitro translation of GR and determination of oxandrolone binding Rat GR mRNA was synthesized with T7 polymerase after linearization of the pT7.rGR vector by cleavage with Spa1. Rat GR was synthesized using this mRNA by in vitro translation using nuclease-treated rabbit reticulocyte lysates (Promega, Madison, WI). Fifty microliter aliquots containing in vitro translated GR were then placed on ice and used for hormone binding assays. Aliquots of the translation mixture were supplemented with 1 ␮l of 1 ␮M tritiated

cortisol (20 nM final), and other additives as indicated in the figure, then incubated on ice for 2 h. One hundred microliters of hydroxylapatite slurry containing 50% w/v in 50 mM Tris–HCl pH 7.4 and 1 mM EDTA were added, and translation mixtures were incubated on ice an additional 15 min with mixing every 5 min. One milliliter of wash buffer was added (40 mM Tris–HCl pH 7.4, 100 mM KCl, 1 mM EDTA, 1 mM EGTA), and the hydroxylapatite was pelleted by centrifugation after mixing. Hydroxylapatite was washed twice with wash buffer, then hormone was eluted with 400 ␮l of ethanol. The radioactive material in the eluate was quantified by liquid scintillation counting after adding 350 ␮l of the ethanol fraction to tubes containing 5 ml of Ecolite liquid scintillant (ICN, Irvine, CA). Preliminary experiments indicated that concentrations of GR in this system are 1 pM (yielding a ratio of ligand to receptor in excess of 1000:1 under all conditions tested) and that the Kd for cortisol under the conditions of the assay was 0.35 nM. 2.4. Tissue culture, transfections, and luciferase assays CV-1 and COS7 cells (American Tissue Type Collection) were maintained in RPMI 1640 supplemented with 10% fetal bovine serum. For determination of effects of hormones on expression of firefly luciferase from reporter genes, 5 × 104 CV-1 cells were seeded into wells of 24-well plates containing medium supplemented with 10% charcoal-dextran stripped fetal bovine serum (CDS), as above. The following morning, cells were transfected with a total of 0.2 ␮g DNA per well using Lipofectamine Plus. After 3 h, 0.8 ml of growth medium containing 10% CDS was added and supplemented with hormones or ethanol, as indicated in the figures. Ethanol concentrations were less than 0.2% in all cases. After overnight incubation, cells were washed once with PBS, after which luciferase was quantified in cell lysates and normalized with respect to protein concentration (Lowry). 2.5. Localization of AR and of GFP-tagged GR in cultured cells COS7 cells were seeded at 5 × 105 per well into wells of six-well plates containing coverslips, and maintained overnight in RPMI1640 supplemented with 10% CDS. Cells were transfected as indicated in the figures using Lipofectamine Plus, and, 3 h after adding the transfection mixture, cells were covered with fresh RPMI 1640 containing 10% CDS supplemented with additives as indicated in the figures. Cells were fixed with 2.5% paraformaldehyde, blocked by incubation with 3% bovine serum albumin in PBS, incubated with rabbit polyclonal anti-AR, and then with Texas Red conjugated goat–anti-rabbit IgG (ICN). Coverslips were mounted using Vectashield (Vector Labs, Burlingame, CA), and cells were inspected by fluorescence microscopy.

J. Zhao et al. / Steroids 69 (2004) 357–366

359

2.6. Measurement of cortisol binding in cultured cells Six-well plates were seeded with 5 × 105 cells per well and maintained overnight in media supplemented with RPMI-1640 containing 10% CDS. Cells were transfected with plasmids as indicated in the figure legends, then incubated overnight in RPMI-1640 containing 10% CDS. The following morning, medium was replaced with 1 ml per well of the same medium supplemented with tritiated cortisol (20 nM) alone or combined with unlabeled cortisol (2 ␮M). Three hours later, cells were washed with PBS and lysed with 200 ␮l of 2% SDS. Lysates were passed through a 26 g needle to shear DNA. Radioactivity present in the lysates was quantified by liquid scintillation counting and normalized relative to protein concentrations of the lysates as determined by the BCA method (Pierce, Rockford, IL). The difference between counts obtained with labeled cortisol versus labeled plus unlabelled cortisol was taken as specific binding to GR.

Fig. 1. Analysis of oxandrolone binding to glucocorticoid receptors. In vitro translated glucocorticoid receptors were incubated with tritiated cortisol alone or in combination with unlabeled steroid hormones or their analogs as indicated in the figure. Binding of tritiated cortisol was then determined and expressed as a percentage of that for tritiated cortisol alone (first bar). Data are mean±S.E.M. for three separate determinations.

2.7. Assessment of AR mRNA levels in cultured cells Total RNA was extracted (RNAEasy, Quiagen, Valencia, CA), treated with RNAse-free DNAse I (Qiagen) to remove residual genomic DNA, and quantified by absorbance at 260 nM. Two ␮g total RNA were utilized for synthesis of a cDNA library using oligo-dT primers and an Omniscript RT kit (Qiagen). Analysis of human AR mRNA levels was performed using these libraries. Primers for PCR were: human AR forward, CCTACGGCTACACTCG; human AR reverse, CAGTCTCCAAACGCAT; human GAPDH forward, TGCACCACCAACTGCTTAGC; human GAPDH reverse, GGCATGGACTGTGGTCAT. Each reaction for PCR contained 1 ␮l of a cDNA library. PCR amplification was performed for 35 cycles using FastTaq (Roche, Indianapolis, IN).

3. Results We began our analysis by determining whether oxandrolone competed with cortisol for binding to the GR. Our approach was based on measurement of binding of labeled cortisol, the physiological ligand for this receptor, to GR that had been in vitro translated in rabbit reticulocyte lysates. Addition of excess unlabeled cortisol suppressed binding by approximately 98% indicating that the assay measured primarily binding of cortisol to the GR (Fig. 1). Consistent with prior reports [14], decreased cortisol binding was observed when the synthetic anabolic steroid R1881 was added (Fig. 1). However, oxandrolone had no effect on cortisol binding at concentrations as high as 5 ␮M (Fig. 1). This concentration corresponds to the peak plasma concentration predicted for oxandrolone during long-term oral administration calculated from the published concentrations observed after a single dose [15].

The GR is a ligand-activated transcription factor, which raised the possibility that oxandrolone could interfere with glucocorticoid-dependent transcriptional activation, as well as binding of cortisol to the GR. Interactions of oxandrolone with GR, or events downstream of binding of oxandrolone to GR, were further investigated in a cell culture system. We utilized a transient transfection approach based on the ability of liganded GR to induce expression of firefly luciferase under the control of a hormone response element. This analysis is sensitive to interactions at all steps from binding of hormone to receptor through folding of luciferase. A cell line lacking functional AR and GR would be convenient for this analysis; CV1 cells were chosen for this purpose. To confirm that these cells do not express functional AR or GR, we transfected them with an ARE-Luc reporter in which expression of luciferase is driven by the androgen and glucocorticoid responsive MMTV promotor. Expression of luciferase from this construct is stimulated by binding of liganded AR or GR, although GR induces about five-fold greater expression. As shown in Fig. 2A and B, when untransfected cells were analyzed, there was no appreciable increase in luciferase activity when cells were stimulated with oxandrolone or dihydrotestosterone (DHT), and mRNA for AR was present at levels too low to detect by 35 cycles of amplification by RT-PCR. Also, cortisol elicited no luciferase expression in these cells (Fig. 2B), in which levels of mRNA for GR were very low (not shown). Co-transfection with a vector encoding human AR restored androgen responsiveness associated with a dramatic increase in levels of AR mRNA detected by RT-PCR (Fig. 2A and C). Co-transfection with a vector expressing GR also restored responsiveness to cortisol (Fig. 2C). The data indicate that CV1 cells contain at most very low levels of AR and GR, and that transfection with vectors encoding these receptors causes their expression in adequate levels to assure activation of reporter genes.

360

J. Zhao et al. / Steroids 69 (2004) 357–366

Fig. 2. Characteristics of CV1 cells: (A) CV1 cells were transiently transfected with a vector encoding ␤-galactosidase (lane 1) or human AR (lane 2). Twenty four hours later, total RNA was extracted and subjected to RT-PCR using primers for human AR or GAPDH. Products formed by PCR were analyzed after electrophoresis on agarose gels and staining with ethidium bromide. (B) CV1 cells were transiently transfected with the ARE-Luc reporter and a plasmid encoding ␤-galactosidase (plasmids were used at a 1:2 ratio then covered with growth medium supplemented with 10% CDS. Cells were incubated overnight as indicated with ethanol, cortisol (20 nM), oxandrolone (5 ␮M) or dihydrotestosterone (DHT, 5 nM). Luciferase expression was then determined and normalized for protein concentration. Data are mean values for two representative experiments (results similar in five separate experiments) each performed in triplicate. Individual replicates were within ±10% of the mean values in each case. (C) Cells were co-transfected with the ARE-Luc reporter together with plasmids encoding AR and GR (ratio 1:1:1). Experiments were otherwise as in B. Data are mean values for two representative experiments (results similar among numerous experiments as shown in the subsequent figures) each performed in triplicate. Individual replicates were within ±10% of the mean values in each case.

To test effects of oxandrolone on activation of GR by cortisol in an intact cell system, CV-1 cells were co-transfected with the luciferase reporter construct together with plasmids encoding the GR and ␤-galactosidase (included as a DNA control for later comparisons). In cells expressing the GR without the AR (Fig. 3A, light gray bars), oxandrolone alone (5 ␮M) caused a negligible increase in luciferase activity. More importantly, without AR present, oxandrolone had no effect on cortisol-induced luciferase expression. Using an intact cell system, these findings provide further evidence against competition between oxandrolone and cortisol for binding to GR.

The effects of oxandrolone in cells expressing both the AR and GR were also examined. Co-expression of AR repressed cortisol-dependent luciferase expression by, on average, about two-fold in the absence of oxandrolone (Fig. 3A, dark gray bars). Similar repression has been reported by other investigators [16]. Consistent with these prior studies, repression was seen at GR:AR ratios from 3:1 to 1:3, with the greatest repression occurring at ratios of 1:1 (data not shown), arguing against competition between AR and GR for chromatin binding. Experiments in cells co-transfected with AR and a GFP-tagged version of GR found no appreciable inhibition of GR nuclear migration by AR (not shown). To test for possible effects of co-expression of AR on pathways for synthesis and maturation of GR, we characterized the effects of co-expression of AR on binding of radiolabeled cortisol to GR. We chose this approach because it tests levels of functionally competent GR. The experiments compared amounts of GR-bound cortisol in HeLa cells co-transfected with GR, ␤-Gal and the GRE-Luc compared with those for cells transfected with GR, AR, and the GRE-Luc reporter. The experiments showed that cortisol binding in cells expressing AR and GR was on average 101.2% of that for cells expressing GR and ␤-galactosidase (average of two experiments with at least two replicates each). These data indicate that co-expression of AR does not alter levels of functional GR in this experimental system. Taken together, the above findings are consistent with repression by unliganded AR of GR-mediated transactivation via a form of crosstalk. When effects of oxandrolone were tested on cells expressing AR and GR together with the reporter, oxandrolone depressed cortisol-induced luciferase expression by approximately 70% (Fig. 3A, dark gray bars). To ensure that the results could not be attributed to an unexpected property of the GRE-luciferase construct, the experiments were repeated using two other reporter constructs. As shown in Fig. 3B (HRE-Luc) and Fig. 3C (ARE-Luc), experiments employing these other reporters also showed oxandrolone-dependent inhibition of cortisol-induced luciferase expression, but only when AR was co-expressed with the GR. Experiments testing how the relative concentrations of AR and GR affected oxandrolone-induced repression were also performed and revealed that the greatest repression was found at a ratio of AR and GR plasmids of 1:1 (data not shown). When the experiments were repeated using HeLa cells, oxandrolone also repressed cortisol-induced luciferase expression significantly (51%, S.E.M. ± 3.5%, five separate determinations) in cells in which AR was expressed while no significant repression was found in cells lacking AR. The same transient transfection approach used above was employed to test the ability of oxandrolone to block GR-dependent transactivation by two synthetic glucocorticoids, dexamethasone and methylprednisolone. One rationale for such studies comes from the early studies of the ability of anabolic steroids to antagonize binding to GR [8] in which it was shown that receptor antagonist activity was significantly greater when dexamethasone was used as

J. Zhao et al. / Steroids 69 (2004) 357–366

361

Fig. 3. Repression of GR signaling in an AR-dependent manner. (A) CV1 cells were transiently transfected with the GRE-Luc reporter together with plasmids encoding either the GR and ␤-galactosidase (open bars) or GR and AR (filled bars). The ratio of the three plasmids was 1:1:1 in each case. Cells were then covered with medium containing 10% CDS. Luciferase activity was determined after overnight incubation with cortisol (Cort, 20 nM), oxandrolone (Ox, 5 ␮M) or ethanol (Eth, vehicle control) as indicated in the figure and expressed as arbitrary units per mg protein. Data are mean ±S.E.M. for at least three determinations, each performed in triplicate. () P < 0.05 vs. cortisol-treated cells expressing GR and ␤-Gal; (∗) P < 0.05 vs. cells treated with cortisol expressing GR and AR (t-test). (B) Experiments used the HRE-Luc reporter and were otherwise as in A. (C) Experiments used the ARE-Luc and were otherwise as in A.

a ligand as compared to cortisol. Concentrations of cortisol, dexamethasone and methylprednisolone were selected from dose–response curves (data not shown) to yield luciferase expression corresponding to approximately 95% of maximum in each case. As shown in Fig. 4, oxandrolone markedly depressed luciferase expression induced by both methylprednisolone and dexamethasone to a similar degree as was found for cortisol, but only when the AR and GR were both expressed. These findings led us to ask whether the inhibition observed reflected a general property of the liganded AR, and, whether AR antagonists might cause a similar form of sup-

pression of GR transactivation. This possibility was tested for 2-hydroxyflutamide, a potent competitive AR antagonist, and DDE, a xenobiotic agent with weak estrogenic and anti-androgenic activity derived by environmental breakdown of DDT [17,18]. The ability of the antagonists to interfere with GR transactivation was tested in the same transient transfection system described above. The data revealed that both DDE and 2-hydroxyflutamide significantly depressed GR-transactivation (Fig. 5). 2-Hydroxyflutamide and DDE appeared to be less effective in repressing cortisol action than oxandrolone, with DDE being the least active agent in this regard.

362

J. Zhao et al. / Steroids 69 (2004) 357–366

Fig. 4. Oxandrolone represses GR-transactivation induced by synthetic corticosteroids. (A) CV1 cells were transiently transfected with the GRE-Luc reporter together with plasmids encoding AR, GR or ␤-galactosidase, then covered with medium containing 10% CDS and incubated overnight with dexamethasone (Dex, 25 nM), oxandrolone (Ox, 5 ␮M) or ethanol (Eth, vehicle control) as indicated. Data are mean ±S.E.M. for three determinations each performed in triplicate. () P < 0.05 vs. cortisol-treated cells expressing GR and ␤-Gal; (∗) P < 0.05 vs. cells treated with cortisol expressing GR and AR (t-test). (B) As in A except that methylprednisolone (MP, 25 nM) was used.

To gain further insight into the mechanisms of oxandrolone suppression of cortisol signaling we asked whether oxandrolone effects could be reversed by increasing cortisol concentrations. The same transient transfection approach employed above was used for these experiments. As shown in Fig. 6, increases in cortisol concentrations from below physiological concentrations (20 nM) to maximal physiological concentrations (500 nM) were unable to overcome the oxandrolone-induced inhibition of GR cells. This finding provides additional evidence that the inhibition is not due to competition between oxandrolone and cortisol for binding to GR. The non-competitive nature of the inhibition and its dependence upon the presence of AR are consistent with crosstalk between the two receptors. Such functional interactions could occur in the cytoplasm, nucleus, or both. This is because, in their unliganded form, both AR and GR reside in the cytoplasm in association with molecular chaperones, and undergo translocation to the nucleus after binding of ligands, such as testosterone. To confirm that oxandrolone induced a similar nuclear translocation of AR, the effect of oxandrolone on AR localization was assessed by immunocytochemistry. As shown in Fig. 7A, when hormone was absent, AR was cytoplasmic and concentrated

Fig. 5. Inhibition of GR-mediated transactivation by AR antagonists. (A) CV1 cells were transiently transfected with the GRE-Luc reporter together with plasmids encoding the GR and AR and, after addition of media supplemented with 10% CDS, incubated overnight with cortisol (Cort, 20 nM), 2-hydroxyflutamide (Flut, 10 ␮M) or ethanol (Eth, vehicle control) as indicated. Data are mean ± S.E.M. for at least three separate experiments. (∗) P < 0.05 vs. cells treated with cortisol alone (t-test). (B) As in A except that DDE (10 ␮M) was used.

in the perinuclear region. Oxandrolone induced essentially complete migration of AR to the nucleus. The nuclear co-localization of AR and GR, together with reports that AR–GR receptor heterodimers are transcriptional repressors [16,19], raised the question of whether nuclear localization of AR is needed for repression to occur. To address this question, a version of the AR with a mutated nuclear localization signal (AR4RKM ) was used. This mutant

Fig. 6. Oxandrolone effects are not overcome by increased steroid concentration. CV1 cells were transiently transfected with the GRE-Luc reporter and plasmids encoding AR and GR, after which medium containing 10% CDS was added together with cortisol at the concentrations shown in the figure, and either oxandrolone (Ox, 5 ␮M) or vehicle (ethanol) as indicated in the legend. Luciferase activity in cell lysates was determined and normalized for cellular protein. Data are mean ± S.E.M. for three determinations.

J. Zhao et al. / Steroids 69 (2004) 357–366

Fig. 7. AR-dependent antagonism of GR-transactivation can occur independently of the AR-NLS. (A) Oxandrolone induces nuclear translocation of wild-type AR. COS7 cells were transfected with a construct expressing wild-type AR, incubated with oxandrolone (5 ␮M) or ethanol as indicated, and stained for AR by immunocytochemistry. (B) CV-1 cells were transiently transfected with the GRE-Luc reporter together with plasmids encoding the GR and AR4RKM , covered with medium containing 10% CDS, then incubated overnight with cortisol (20 nM), oxandrolone (5 ␮M) or ethanol as indicated, at which time luciferase activities were determined. Data are mean±S.E.M. for at least three separate experiments. (∗) P < 0.05 vs. cortisol alone (t-test). (C) As in B except that DDE (10 ␮M) was used. (D) As in B except that 2-hydroxyflutamide (10 ␮M) was used.

363

as discussed in greater detail below. Oxandrolone repressed cortisol-induced luciferase expression significantly. Similar results were observed with 2-hydroxyflutamide and DDE (Fig. 7C and D), although these agents appeared to be less effective in repressing cortisol-induced luciferase expression. Repression by oxandrolone of GR-transactivation in cells expressing AR4RKM could occur by at least two mechanisms: (1) retention of GR in the cytoplasm as an AR4RKM –GR complex; (2) formation of AR4RKM GR complexes that migrate to the nucleus (via the GR-NLS) and repress transcription. To distinguish between these possibilities, COS7 cells were transiently transfected with plasmids encoding a GFP-tagged version of the GR, and AR4RKM , followed by incubation with steroid hormones. COS7 cells were used instead of CV-1 cells because of the low levels of expression in the latter. The localization of the mutant AR was characterized by immunocytochemistry, while that of the GFP-GR was analyzed by fluorescence microscopy. As expected, when AR4RKM was expressed together with a GFP-tagged version of the GR (GFP-GR), AR4RKM was distributed diffusely throughout the cytoplasm, both in the absence and presence of cortisol (Fig. 8A), and the GR underwent near-complete migration to the nucleus in the presence of cortisol (Fig. 8B), as previously reported [20,21]. The GR remained primarily cytoplasmic in its distribution after incubation of cells with oxandrolone (Fig. 8B). As expected AR4RKM remained in the cytoplasm (Fig. 7A) after incubation in the presence of oxandrolone, although some cytoplasmic AR was distributed in a punctate manner. When oxandrolone and cortisol were co-administered, the distribution of GFP-GR and of AR4RKM was similar to that observed when either steroid was given alone. Importantly, under these conditions nuclear import of GFP-GR was unimpeded, and AR4RKM retained its cytoplasm localization. In cells expressing GFP-GR incubated with cortisol and oxandrolone, cytoplasmic fluorescence was indistinguishable from that of untransfected cells, indicating that most GR had migrated to the nucleus under these conditions. To exclude interactions that might have been missed by this initial analysis, the fluorescence images from cells expressing both proteins that had been treated with cortisol and oxandrolone were examined after merging the GFP-GR and Texas Red (AR) images (Fig. 8C). No evidence of co-localization of GFP-GR and AR4RKM was evident in these images.

4. Discussion cannot enter the nucleus but has normal hormone binding properties [20]. CV-1 cells were transiently transfected with plasmids encoding the GR, AR4RKM , and the GRE-Luc reporter, then assayed for luciferase activity after exposure to cortisol and/or oxandrolone (Fig. 7B). When used alone, oxandrolone did not induce luciferase expression, consistent with the failure of the liganded receptor to enter the nucleus

Anti-catabolic properties have been ascribed to anabolic steroids based on the ability of some agents in this class to competitively antagonize the GR and to reduce expression of corticosteroid-responsive genes in cultured cells [8,14]. Higer doses of glucocorticoids induce muscle loss, and several lines of evidence indicate that glucocorticoids are necessary for muscle loss to occur. Adrenalectomy

364

J. Zhao et al. / Steroids 69 (2004) 357–366

Fig. 8. Co-expression of AR4RKM does not alter GR cellular localization. Cells were co-transfected with GFP-GR and AR4RKM , covered with medium containing 10% CDS, supplemented with ethanol, cortisol (20 nM), oxandrolone (5 ␮M), or both. Localization of AR4RKM and GFP-GR were determined by fluorescence microscopy after staining with anti-AR. The bars represent 100 ␮m. (A) Texas Red fluorescence representing staining with anti-AR. (B) GFP-GR localization. (C) Cells transfected as in A were incubated overnight with cortisol (20 nM) and oxandrolone (5 ␮M), then immunostained with anti-AR antibodies and examined by fluorescence microscopy.

blocks muscle wasting in renal failure and other disorders [10], while RU486, a progesterone antagonist that also acts as an antagonist of the GR, blocks muscle catabolism in sepsis [22]. Our findings indicate that oxandrolone also exerts anti-corticosteroid actions, but that these involve a mechanism other than competitive antagonism of the GR which has been previously documented for agents such as nandrolone and R1881 [8,14]. Four types of evidence support this conclusion: oxandrolone did not block cortisol binding to the GR (Fig. 1), oxandrolone did not alter cortisol-induced luciferase expression when AR was absent (Figs. 3 and 4), oxandrolone effects were not overcome by increases in cortisol concentration (Fig. 4), and oxandrolone effects required the presence of the AR (Fig. 3). Another difference between oxandrolone effects and those for nandrolone and R1881 relates to their relative abilities to block the action of cortisol as opposed to synthetic glucocorticoids. In prior studies, both nandrolone and R1881 were much more effective in antagonizing binding of dexamethasone as opposed to cortisol [8]. By contrast, oxandrolone reduced transcriptional activation by each of these naturally

occurring and synthetic corticosteroids to a similar degree when these corticosteroids were used at equivalent doses on the dose–response curve (Figs. 3 and 4). The dependence upon AR for inhibition by oxandrolone of GR transactivation indicates a form of crosstalk between AR and GR. Consistent with this interpretation, androgens and corticosteroids are well recognized as having opposing effects on cell growth and expression of the AR [23,24]. In addition, anabolic steroids have been shown to overcome adverse effects of high dose corticosteroids on the diaphragm [25], and to restore lean body mass in those with advanced chronic obstructive lung disease (COPD), of whom at least 60% were also treated with some form of corticosteroid [26,27]. While our findings do not specifically identify a mechanisms for repression of GR-transactivation, several insights into mechanism can be derived from these data. First, several mechanisms can be excluded. Molecular chaperones are important for folding of GR and facilitate its nuclear import [21] and also participate in folding and activation of AR [28,29]. Evidence against competition between AR

J. Zhao et al. / Steroids 69 (2004) 357–366

and GR for these folding pathways was provided by the finding that co-expression of AR had no effect on cortisol binding to GR. Findings that repression was greatest when concentrations of plasmids for AR and GR were similar argue against simple competition between AR and GR for common chromatin binding sites, where AR-dependent repression of GR action should increase as the ratio of AR:GR rises. In addition, the finding that GR nuclear import is unimpeded by oxandrolone-bound wild-type AR argues against interference at this step. In agreement with our findings, AR-dependent repression of GR-transactivation has been reported using DHT as the ligand for AR [16,19]. In these reports, repression was attributed to formation of AR–GR heterodimers. Evidence for formation of such heterodimers was based upon mutational analysis showing that repression was lost when salt bridges stabilizing dimmers were disrupted, and on gel-shift studies performed using the DNA binding domain of each receptor. We propose that oxandrolone induces the formation of such heterodimers. The finding that AR antagonists caused a similar repression of GR transactivation (Fig. 5) and that AR antagonists induce nuclear localization of AR and induce recruitment of corepressors upon chromatin binding [30] suggest that heterodimers formed in the presence of oxandrolone mediate transcriptional repression via the recruitment of co-repressors as well. While a mechanism involving heterodimer formation is attractive and consistent with findings in the literature, the studies described in this report raise the possibility that the anti-glucocorticoid actions of oxandrolone may also involve additional mechanisms. The major evidence supporting this conclusion comes from the studies with the AR4RKM mutant, which showed that this variant retained the ability to repress GR-transactivation even though the GR migrated to the nucleus normally, leaving the mutant AR behind in the cytoplasm (Figs. 7 and 8). Although the mechanisms underlying this surprising finding remain to be defined, these data indicate that repression can occur even when the two receptors are localized in different subcellular compartments. A leading candidate for alternative mechanisms by which oxandrolone-bound AR could repress GR transactivation is squelching, by competition between AR and GR for binding to transcriptional co-activators present at limiting concentrations. Examples of squelching have been reported for nuclear receptors, e.g. competition for GRIP-1 between estrogen and CAR receptors [31]. The finding that AR antagonists also repress GR-transactivation (Fig. 5) is of particular interest for DDE, a xenobiotic agent derived from environmental breakdown of the insecticide DDT. DDE has been found to be a weak estrogen and anti-androgen [17,18]. Exposure to DDE is linked to multiple abnormalities of sexual development in diverse vertebrates [32,33]. Our findings suggest that adverse effects of DDE and other xenobiotics capable of binding to steroid hormone receptors may involve mechanisms beyond simple agonism or antagonism, including

365

the formation of AR–GR heterodimers with the attendant downstream consequences. Mechanisms for repression by antagonists may be distinct from those for agonists. Like agonists, antagonists cause relocalization of AR to the nucleus and promote binding of the receptor to chromatin. Whereas agonists induce recruitment of both co-activators and co-repressors in a context-dependent manner, antagonists appear to exclusively mediate recruitment of transcriptional co-repressors [34] which in the presence of DDE may lead to inappropriate gene silencing and endocrinological dysfunction. Taken together, the findings presented above and in the literature indicate that oxandrolone has the capacity to alter transcriptional regulation via multiple pathways. It seems likely that oxandrolone action involves direct modulation of gene expression mediated through the action of the AR, and indirect effects on transcriptional regulation involving formation of AR–GR heterodimers. Additional mechanisms may also be involved, including squelching. We suggest that the negative regulation of glucocorticoid-modulated gene expression by oxandrolone represents a new paradigm for drug mechanism. It should be noted that the anti-corticosteroid actions of oxandrolone described herein occur at clinically achieved concentrations of this anabolic steroid. We propose that anti-corticosteroid actions of oxandrolone have important consequences for the treatment and prevention of muscle loss, and to facilitating the healing of both acute and chronic wounds.

Acknowledgements The research reported here was supported by the Department of Veterans Affairs, Rehabilitation Research and Development Service, by NIH DK60598, and by NIEHS P4207384. Microscopy was performed at the MSSM-Microscopy Shared Resource Facility, supported, in part, with funding from NIH-NCI shared resources grant R24 CA095823-01. We are grateful to Dr. Diane Robbins for providing the pT7-rGR, pCMV5-rGR and ARE-Luc plasmids, to Dr. William Pratt for the GFP-GR construct, to Dr. Elizabeth Wilson for the AR4RKM expression vector, and to Dr. Micheal Garabedian for the GRE-Luc and HRE-Luc reporters. We also wish to thank Dr. Scott Henderson for assistance with the fluorescence microscopy, and the late Ms. Charlene Michaud for her excellent technical assistance over many years, including performing the in vitro translation of GR and hormone binding studies.

References [1] Demling RH, Orgill DP. The anticatabolic and wound healing effects of the testosterone analog oxandrolone after severe burn injury. J Crit Care 2000;15:12–7.

366

J. Zhao et al. / Steroids 69 (2004) 357–366

[2] Chang DW, DeSanti L, Demling RH. Anticatabolic and anabolic strategies in critical illness: a review of current treatment modalities. Shock 1998;10:155–60. [3] Strawford A, et al. Resistance exercise and supraphysiologic androgen therapy in eugonadal men with HIV-related weight loss: a randomized controlled trial. JAMA 1999;281:1282–90. [4] Earthman CP, et al. Body cell mass repletion and improved quality of life in HIV-infected individuals receiving oxandrolone. JPEN J Parenter Enteral Nutr 2002;26:357–65. [5] Hart DW, et al. Anabolic effects of oxandrolone after severe burn. Ann Surg 2001;233:556–64. [6] Spungen AM, et al. Treatment with an anabolic agent is associated with improvement in respiratory function in persons with tetraplegia: a pilot study. Mt Sinai J Med 1999;66:201–5. [7] Spungen AM, Koehler KM, Modeste-Duncan R, Rasul M, Cytryn AS, Bauman WA. 9 clinical cases of nonhealing pressure ulcers in patients with spinal cord injury treated with an anabolic agent: a therapeutic trial. Adv Skin Wound Care 2001;14:139–44. [8] Mayer M, Rosen F. Interaction of anabolic steroids with glucocorticoid receptor sites in rat muscle cytosol. Am J Physiol 1975;229:1381–6. [9] Hasselgren PO. Glucocorticoids and muscle catabolism. Curr Opin Clin Nutr Metab Care 1999;2:201–5. [10] Price SR, Bailey JL, England BK. Necessary but not sufficient: the role of glucocorticoids in the acidosis-induced increase in levels of mRNAs encoding proteins of the ATP-dependent proteolytic pathway in rat muscle. Miner Electrolyte Metab 1996;22:72–5. [11] Rogatsky I, Hittleman AB, Pearce D, Garabedian MJ. Distinct glucocorticoid receptor transcriptional regulatory surfaces mediate the cytotoxic and cytostatic effects of glucocorticoids. Mol Cell Biol 1999;19:5036–49. [12] Markus SM, Taneja SS, Logan W, Rogatsky SK, Li W, Ha S, Hittelman AB, et al. Identification and characterization of ART-27, a novel coactivator for the androgen receptor N terminus. Mol Biol Cell 2002;13:670–82. [13] Cardozo CP, Michaud C, Ost MC, Fliss AE, Yang E, Patterson C, et al. C-terminal Hsp-interacting protein slows androgen receptor synthesis and reduces its rate of degradation. Arch Biochem Biophys 2003;410:134–40. [14] Danhaive PA, Rousseau GG. Binding of glucocorticoid antagonists to androgen and glucocorticoid hormone receptors in rat skeletal muscle. J Steroid Biochem 1986;24:481–7. [15] Karim A, Ranney RE, Zagrella J, Maibach HI. Oxandrolone disposition and metabolism in man. Clin Pharmacol Ther 1973;14:862–9. [16] Chen S, Wang J, Yu G, Liu W, Pearce D. Androgen and glucocorticoid receptor heterodimer formation. A possible mechanism for mutual inhibition of transcriptional activity. J Biol Chem 1997;272:14087–92. [17] Sohoni P, Sumpter JP. Several environmental oestrogens are also anti-androgens. J Endocrinol 1998;158:327–39. [18] Maness SC, McDonnell DP, Gaido KW. Inhibition of androgen receptor-dependent transcriptional activity by DDT isomers and methoxychlor in HepG2 human hepatoma cells. Toxicol Appl Pharmacol 1998;151:135–42. [19] Yen PM, Liu Y, Palvimo JJ, Triff M, Whang J, Pinsky L, et al. Mutant and wild-type androgen receptors exhibit cross-talk on androgen-, glucocorticoid-, and progesterone-mediated transcription. Mol Endocrinol 1997;11:162–71.

[20] Zhou ZX, Sar M, Simental JA, Lane MV, Wilson EM. A ligand-dependent bipartite nuclear targeting signal in the human androgen receptor. Requirement for the DNA-binding domain and modulation by NH2 -terminal and carboxyl-terminal sequences. J Biol Chem 1994;269:13115–23. [21] Galigniana MD, Scruggs JL, Herrington J, Welsh MJ, Carter-Su C, Housely PR, et al. Heat shock protein 90-dependent (geldanamycininhibited) movement of the glucocorticoid receptor through the cytoplasm to the nucleus requires intact cytoskeleton. Mol Endocrinol 1998;12:1903–13. [22] Tiao G, Fagan J, Rogener V, Liberman M, Wang JJ, Fischer JE, et al. Energy-ubiquitin-dependent muscle proteolysis during sepsis in rats is regulated by glucocorticoids. J Clin Invest 1996;97:339– 48. [23] Smith RG, Syms AJ, Norris JS. Differential effects of androgens and glucocorticoids on regulation of androgen receptor concentrations and cell growth. J Steroid Biochem 1984;20:277–81. [24] Syms AJ, Nag A, Norris JS, Smith RJ. Glucocorticoid effects on growth, and androgen receptor concentrations in DDT1MF-2 cell lines. J Steroid Biochem 1987;28:109–16. [25] van Balkom RH, Dekhuijzen PN, van der Heijden HF, Flogering HT, Fransen JA, van Herwaarden CL. Effects of anabolic steroids on diaphragm impairment induced by methylprednisolone in emphysematous hamsters. Eur Respir J 1999;13:1062–9. [26] Yeh SS, DeGuzman B, Kramer T. Reversal of COPD-associated weight loss using the anabolic agent oxandrolone. Chest 2002; 122:421–8. [27] Schols AM, Soeters PB, Mostert R, Pluymers RJ, Wouters EF. Physiologic effects of nutritional support and anabolic steroids in patients with chronic obstructive pulmonary disease. A placebocontrolled randomized trial. Am J Respir Crit Care Med 1995;152:1268–74. [28] Rao J, Lee P, Benzeno S, Cardozo C, Albertus J, Robbins DM, et al. Functional interaction of human Cdc37 with the androgen receptor but not with the glucocorticoid receptor. J Biol Chem 2001;276:5814– 20. [29] Caplan AJ. Hsp90’s secrets unfold: new insights from structural and functional studies. Trends Cell Biol 1999;9:262–8. [30] Dotzlaw H, Moehren U, Mink S, Cato AC, Iniguez Lluhi JA, Baniahamad A. The amino terminus of the human AR is target for corepressor action and antihormone agonism. Mol Endocrinol 2002;16:661–73. [31] Min G, Kim H, Bae Y, Petz L, Kemper JK. Inhibitory crosstalk between estrogen receptor (ER) and constitutively activated androstane receptor (CAR). CAR inhibits ER-mediated signaling pathway by squelching p160 coactivators. J Biol Chem 2002; 277:34626–33. [32] Gray Jr LE. Xenoendocrine disrupters: laboratory studies on male reproductive effects. Toxicol Lett 1998;102/103:331–5. [33] Sultan C, Balaguer P, Terouanne B, Georget V, Paris F, Jeandel C, et al. Environmental xenoestrogens, antiandrogens and disorders of male sexual diffrentiation. Mol Cell Endocrinol 2001;178:99– 105. [34] Warriar N, Page N, Koutsilieris M, govinadan MV. Interaction of antiandrogen–androgen receptor complexes with DNA and transcription activation. J Steroid Biochem Mol Biol 1993;46:699– 711.