Oxidative stress and pro-inflammatory responses induced by silica nanoparticles in vivo and in vitro

Toxicology Letters 184 (2009) 18–25

Contents lists available at ScienceDirect

Toxicology Letters journal homepage: www.elsevier.com/locate/toxlet

Oxidative stress and pro-inflammatory responses induced by silica nanoparticles in vivo and in vitro Eun-Jung Park, Kwangsik Park ∗ College of Pharmacy, Dongduk Women’s University, 23-1 Wolgok-dong, Seongbuk-gu, Seoul 136-714, Republic of Korea

a r t i c l e

i n f o

Article history: Received 27 June 2008 Received in revised form 25 September 2008 Accepted 15 October 2008 Available online 30 October 2008 Keywords: Silica nanoparticles Oxidative stress Inflammation Cytokines

a b s t r a c t Oxidative stress and inflammatory responses induced by silica nanoparticles were evaluated both in mice and in RAW264.7 cell line. Single treatment of silica nanoparticles (50 mg/kg, i.p.) led to the activation of peritoneal macrophages, the increased blood level of IL-1␤ and TNF-␣, and the increased level of nitric oxide released from the peritoneal macrophages. mRNA expressions of inflammation-related genes such as IL-1, IL-6, TNF-␣, iNOS, and COX-2 were also elevated in the cultured peritoneal macrophages harvested from the treated mice. When the viability of splenocytes from the mice treated with silica nanoparticles (50 mg/kg, 100 mg/kg, and 250 mg/kg, i.p.) was measured, the viability of splenocytes was significantly decreased in the higher dose-treated groups (100 mg/kg, 200 mg/kg i.p.). However, cell proliferation without cytotoxicity was shown in group treated with relatively low dose of 50 mg/kg i.p. When leukocyte subtypes of mouse spleen were evaluated using flow cytometry analysis, it was found that the distributions of NK cells and T cells were increased to 184.8% and 115.1% of control, respectively, while that of B cells was decreased to 87.7%. To elucidate the pro-inflammatory mechanism of silica nanoparticles in vivo, in vitro study using RAW 264.7 cell line which is derived from mouse peritoneal macrophage was done. Treatment of silica nanoparticles to the cultured RAW264.7 cells led to the reactive oxygen species (ROS) generation with a decreased intracellular GSH. In accordance with ROS generation, silica nanoparticles increased the level of nitric oxide released from the cultured macrophage cell line. These results suggested that silica nanoparticles generate ROS and the generated ROS may trigger the pro-inflammatory responses both in vivo and in vitro. © 2008 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Silicas (SiO2 ) are the most abundant compounds in the earth’s crust except carbon and they can be divided into crystalline or noncrystalline (amorphous) silica. Amorphous silicas are divided into naturally occurring amorphous silicas and synthetic forms. Synthetic amorphous silicas (SAS) are intentionally manufactured and it has been known that SAS do not contain measurable levels of crystalline silica which causes adverse health effects such as silicosis (Arts et al., 2007). Based on this knowledge, SAS are used in various industrial fields and are being used as the materials for nanoparticles. Various nanoparticles made from SAS are also widely used in chemical and biomedical products such as printer toners, varnishes, cancer therapy, DNA delivery, and enzyme immobilization (Barik et al., 2008). With the rapid increase of nanoparticle applications, the concerns on the health impacts caused by amorphous silica nanoparticles are also increasing.

∗ Corresponding author. Tel.: +82 29404522; fax: +82 29404159. E-mail address: [email protected] (K. Park). 0378-4274/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.toxlet.2008.10.012

Regarding the toxicity of crystalline silica particles, inhalation of the crystalline form of silica has been a well-known exposure route and historically associated with the development of a severe respiratory disease, silicosis which is lung-pneumoconiosis characterized by alveolar proteinosis and diffused fibrosis (Hamilton et al., 2008; Iyer et al., 1996). Based on the evidence obtained from both animal models and epidemiological studies, the IARC (International Agency for Research on Cancer) has concluded that there are sufficient evidences that inhaled crystalline silica from occupational sources, in the form of quartz, cristobalite or tridymite is carcinogenic to humans (IARC, 1997; Cocco et al., 2007). There are many reports on the pathogenesis of silicosis induced by crystalline silica. Investigators have studied the effects of crystalline silica particles on the induction of cytokines such as IL-1␤, IL-6, IL-10, TNF-␣ and transforming growth factor (TGF); chemokines such as monocyte chemoattractant protein-1 (MCP-1) and macrophage inflammatory protein-2(MIP-2); the reactive oxygen species (ROS), reactive nitrogen species (RNS) and nitric oxide (NO)-generated mainly through iNOS (Rimal et al., 2005; Øvrevik et al., 2006). However, the toxicities of the amorphous synthetic silica particles, micro-sized particles, and nano-sized particles, have not been

E.-J. Park, K. Park / Toxicology Letters 184 (2009) 18–25

widely studied (Cho et al., 2007). Recently, data on the growth inhibition of silica nanoparticles on the green alga Pseudokirchneriella subcapitata were published (Van Hoecke et al., 2008). Silica nanoparticles also showed cytotoxicity in different types of cultured mammalian cell lines (Chang et al., 2007; Jin et al., 2007; Lin et al., 2006). As in vivo studies, the acute and subacute lung toxicities of ultrafine colloidal silica particles were assessed using mice. When cellular and biochemical parameters in bronchoalveolar lavage fluid (BALF) were assessed in the mice intratracheally instilled with ultrafine silica particles, moderate to severe pulmonary inflammation was observed (Kaewamatawong et al., 2006). It seems that pro-inflammatory responses induced by nanoparticles have been focused as one of the toxic mechanisms. Recently, a few types of nanoparticles such as titanium dioxide and carbon black showed pro-inflammatory effects on epithelial cells in vitro (Monteiller et al., 2007). But, information on the pro-inflammatory responses induced by amorphous silica nanoparticles has not been fully released yet. In this study, we investigated the oxidative stress and proinflammatory responses both in mice and in RAW 264.7 cell line to evaluate the toxicity and possible mechanisms of amorphous silica nanoparticles. 2. Materials and methods 2.1. Maintenance of animals, cell culture and nanoparticle treatment ICR mice were purchased from Orient-Bio Animal Company (Seongnam, Gyeonggi, Korea) and were maintained for adaptation in animal room before the study. The environmental conditions of animal room are maintained as follows; temperature, 23 ± 1 ◦ C; relative humidity, 55 ± 5%; 12 h light/dark cycle. Silica nanoparticles was intraperitoneally treated to the mice with the dosages of 50 mg/kg, 100 mg/kg, and 250 mg/kg for the splenocytes proliferation test. For the test of macrophage activation, NO synthesis, cytokine secretion, and phenotype analysis, mice were treated with 50 mg/kg dose which showed proliferating activity on mouse splenocytes. RAW 264.7 cell line, which is derived from a mouse peritoneal macrophage cell line, was purchased from Korean Cell Line Bank (Seoul, Korea). RAW264.7 cell lines were maintained in Dulbecco’s-modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS), penicillin 100 IU/ml, and streptomycin 100 ␮g/ml. Cells were grown in cell culture dish at 37 ◦ C in a 5% CO2 humidified incubator. The silica nanoparticles (SiO2 particles, average size; 12 nm) used in this study was supplied by Degussa Co. (Parsippany, NJ, USA). According to the information provided by the manufacturer, the purity of silica dioxide was more 99.8%. Impurities of Al2 O3 , Fe2 O3 , TiO2 were less than 0.05%, 0.003%, and 0.03%, respectively. The suspension of silica dioxide nanoparticles was prepared in the culture media and dispersed for 20 min by using a sonicator (Branson Inc., Danbury, CT, USA) to prevent aggregation. 2.2. Preparation of peritoneal macrophages and splenocytes Macrophages were harvested from peritoneal lavage at 3 days after intraperitoneal injection of 200 ␮l of 3% Brewer thioglycollate broth (Sigma–Aldrich, St. Louis, MO, USA). The cells were washed with DMEM twice and resuspended in DMEM supplemented with 10% FBS, and then incubated again at 37 ◦ C for 2 h. The adherent cells were used for the tests (Byun et al., 2006). For the isolation of splenocytes, the spleen was aseptically removed from ICR mouse, and suspended by passage through sterile plastic strainer in DMEM with 2% FBS. After centrifugation at 1500 rpm for 3 min, the supernatant was removed, and briefly vortexed in distilled water 500 ␮l, resuspended in DMEM with 2% FBS. Finally, cells were filtered through nylon mesh (Byun et al., 2006; Vendrame et al., 2006). 2.3. Measurement of nitric oxide (NO) NO production in cell culture medium was quantified spectrophotometrically using the Greiss reagent (1% sulfanilamide, 2.5% H3 PO4 , 0.1% N-1-naphthylethylenediamine dihydrochloride). The absorbance at 540 nm was measured and the nitrite oxide concentration was determined using a calibration curve with sodium nitrite as a standard chemical (Chen et al., 1995). 2.4. Gene expression analysis The RT-PCR reaction was done with 1 ␮g of total RNA, 1 ␮l of 20-␮M oligo-dT primer, and 18 ␮l of reaction mixture which was provided by AccuPower RT/PCR

19

Table 1 Primer sequences of inflammation-related genes used in this study. Primer name

Primer sequences

IL-1␤

R: CAGGATGAGGACATGACACC L: CTCTGCAGACTCAAACTCCAC

iNOS

R: AGCTCCTCCCAGGACCACAC L: ACGCTGAGTACCTCATTGGC

TNF-␣

R: TTGACCTCAGCGCTGAGTTG L: CCTGTAGCCCACGTCGTAGC

COX-2

R: AAGAAGAAAGTTCATTCCTGATCCC L: TGACTGTGGGAGGATACATCTCTC

IL-6

R: GTACTCCAGAAGACCAGAGG L: TGCTGGTGACAACCACGGCC

PreMix(Bioneer, Daejeon, Korea) at 42 ◦ C for 60 min. Then PCR was performed in a 20-␮l total mixture volume for 25–28 cycles at 95 ◦ C for 1 min, 55 ◦ C for 1 min, and 72 ◦ C for 1 min. Amplified cDNA products were separated on 1.5% agarose gel by electrophoresis. The primer sequences of amplified genes are shown in Table 1 (Park et al., 2008). Actin mRNA was also amplified as a loading control. 2.5. Measurement of IL-1ˇ and TNF-˛ The blood was collected from retro-orbital venous plexus using heparinized capillary tube after treatment of silica nanoparticles. The serum concentration of each cytokine was determined by using ELISA kits commercially available from eBioscience (San diego, CA, USA). Briefly, microplates were coated with 100 ␮l of capture antibody, and incubated overnight at 4 ◦ C. After washing and blocking with assay diluent, serum was added to each well and the plates were maintained for 2 h at RT. The plates were washed and biotin-conjugated detecting mouse antibody was added to each well and incubated at room temperature for 1 h. The plate were washed and further incubated with avidin-HRP for 30 min before detection using the TMB solution. Absorbances were measured at 450 nm with an ELISA reader (Molecular Devices, Sunnyvale, CA, USA). The amounts of cytokines were calculated from the linear portion of the standard curve (Byun et al., 2006). 2.6. Immunophenotyping of splenocytes Specific leukocyte subtypes of cells derived from mouse spleen were also determined by immunofluorescent antibody staining and analyzed with flow cytometry analysis. Lymphocyte subpopulations were identified and gated using forward versus side scatter characteristics. All monoclonals were directly conjugated and were obtained from eBioscience (San diego, CA, USA). T cells (CD3, 1:50), B cells (CD19, 1:50) and NK cells (DX5, 1:100) were identified using anti-mouse. Briefly, cells of 3–5 × 103 cells were resuspended in flow cytometry buffer (2% FBS, 0.02% sodium azide in PBS) containing Fc-block (eBioscience, San diego, CA, USA) to reduce nonspecific antibody binding. Cells were then incubated in the dark with the appropriate fluorochrome-conjugated antibody (10 ␮l) for 20 min at 4 ◦ C. Afterwards, cells were washed two times with 500 ␮l FACS (Fluorescence Activated Cell Sorter) buffer and flow cytometry analysis was performed on the FACSCalibur system (BD Biosciences, Franklin Lakes, NJ, USA). Control samples matched for each fluorochrome. Data were analyzed using CellQuest software (Becton Dickinson, Franklin Lakes, NJ, USA) (Vendrame et al., 2006). 2.7. Measurement of ROS and GSH To measure ROS generation, a fluorometric assay using intracellular oxidation of 2,7-dichlorohydrofluoroscein diacetate (DCFH-DA) was performed (Elbekai and El-Kadi, 2005; Fotakis et al., 2005). Cells grown to confluence at 24 h after seeding were pretreated with different concentrations (5, 10, 20, 40 ppm) of nanoparticles for 24 h, and then incubated with 40 ␮M DCFH-DA for 15 min. At the end of DCFH-DA incubation, cells were washed with PBS, lysed with NaOH, and aliquots were transferred to the black well plate. Then the fluorescence of dichlorofluoroscein (DCF), which is the oxidized product of DCFH-DA, was measured using the microplate spectrofluorometer (GeminiXPS, Molecular Devices, Sunnyvale, CA, USA) with excitation and emission wavelengths of 485 nm and 530 nm, respectively. Protein assays performed by Lowry method. The visual image of ROS generation in cells was made using a fluorescent microscope (Nicon, Tokyo, Japan) with an excitation of 485 nm and an emission of 530 nm. To investigate the relationship between the increased ROS and the level of antioxidant materials in cells, the intracellular GSH level was determined (Elbekai and El-Kadi, 2005; Fotakis et al., 2005). The cells treated with nanoparticles (5 ppm, 10 ppm, 20 ppm, and 40 ppm) in six-well plates for 24 h were washed with PBS,

20

E.-J. Park, K. Park / Toxicology Letters 184 (2009) 18–25

and 1% perchloric acid was added to the cell pellet and left for 10 min on ice. The cell lysates were centrifuged at 13,000 rpm at 4 ◦ C for 5 min prior to analysis in order to remove precipitated protein. Cell lysates, KH2 PO4 /EDTA buffer, and ophthaldialdehyde were put in 96-black well plates and incubated in the dark at RT for 30 min. Fluorescence was measured using a fluorescence multi-well plate reader with excitation and emission wavelengths of 350 nm and 420 nm, respectively (Hissin and Hilf, 1976). Results were calculated as nmol of glutathione per mg of protein and presented as a percentage of the control group. Protein assays in the cell lysate were performed using a BCA protein assay kit (Pierce, Rockfold, IL, USA).

2.8. Measurement of cell viability and caspase-3 activity Cell viability was measured by the MTT (3-(4-5-Dimethylthiazol-2-yl)-2,5diphenyltetrazolium bromide) assay. Cells were seeded on 96-well tissue culture plates with 2 × 103 to 1 × 104 cells in 100 ␮l media per well. After a 24-h stabilization of the cells, they were treated with 5 ppm, 10 ppm, 20 ppm, and 40 ppm concentrations of the particles for 24 h, 48 h, 72 h, and 96 h, respectively. At the end of exposure, 40 ␮l of MTT solution (2 mg/ml) was added and the cells were incubated for 4 h at 37 ◦ C. Cells were solubilized with 150 ␮l of DMSO and absorbance was quantified in 540 nm using the microplates spectrophotometer system (VersaMax, Molecular Devices, Sunnyvale, CA, USA). The viability of the treated group was expressed as the percentage of control group which was assumed to be 100%. The activity of caspase-3 was determined using a colorimetric assay kit (R & D system, Minneapolis, MN, USA). Briefly, cells were incubated with different concentrations of nanoparticles (5, 10, 20, 40 ppm) for 24 h. The cells were first lysed by the solution provided in the assay kit to collect their intracellular contents. The cell lysates was to be tested for their enzyme activity by the addition of a caspase-specific peptide which is conjugated to the color reporter molecules of pnitroanaline. The cleavage of the peptide by the caspase, released the chromophore pNA, which can be quantitated spectrophotometrically at a 450-nm. Protein assays in the cell lysate were performed using a BCA protein assay kit (Pierce, Rockfold, IL, USA).

2.9. Statistical analysis The results of the chemically treated groups were compared to those of the control group and represented as the percentage of the control value. The values were compared using the Student’s t-test, and levels of significance were represented for each result.

3. Results 3.1. Activation of peritoneal macrophages in mice Mice were treated with silica nanoparticles 50 mg/kg through intraperitoneal injection, and were sacrificed at 12 h, 24 h, 48 h, 72 h after treatments, respectively. Macrophages were harvested from the peritoneal cavity of mouse and were incubated in CO2 incubator for 3 h to observe the morphological changes. Activated macrophages, which showed the cytoplasmic spreading, were observed in the mice sacrificed at 12 h after silica nanoparticle treatment. However, cytotoxic effect was also shown in the activated macrophages harvested at 24 h, 48 h, and 72 h after treatment, which was shown by the observed vacuoles in the cytoplasm of the activated macrophages (Fig. 1). 3.2. Increased NO synthesis and expression of inflammation-related genes in mice Activation of macrophages was related with the increased level of NO which is second messenger in inflammatory signal. Macrophages harvested from the non-treated control and 50 mg/kg silica nanoparticles-treated groups, were cultured in 96 well-plates for 24 h and NO released from the cells to the supernatant was measured. As a result, NO was increased in a time-dependent manner. Especially, at 72 h after peritoneal injection, the level reached to 16.4 ␮M and the increase ratio to non-treated control group was reached to 29.4-fold (Fig. 2A). The mRNA expressions of inflammatory-related genes in the macrophages harvested from the mice treated with silica nanoparticles 50 mg/kg were determined. As shown in Fig. 2B, the mRNA expressions of inflammation-related genes such as IL-1 ␤, TNF ␣, IL-6, iNOS, and COX-2 were upregulated in a time-dependent manner.

Fig. 1. Activation of peritoneal macrophages by silica nanoparticles. Mice were intraperitoneally injected with silica nanoparticle 50 mg/kg and were sacrificed at 12 h, 24 h, 48 h, and 72 h after injection. Peritoneal macrophages were harvested from the mice of treated or non-treated control group (n = 3) and were incubated in CO2 incubator for 2 h. And then, adherent cells were collected, re-incubated in 6 cm Petri-dish for 3 h. Changes of morphology were observed using phase-contrast microscope (200×) and representative photos are shown.

E.-J. Park, K. Park / Toxicology Letters 184 (2009) 18–25

21

Fig. 2. Effects of silica nanoparticles on NO level and gene expressions. (A) Mice were intraperitoneally injected with silica nanoparticle 50 mg/kg and were sacrificed at 12 h, 24 h, 48 h, and 72 h after injection. Peritoneal macrophages were harvested from the mice (n = 3) and were incubated in CO2 incubator for 2 h. And then, adherent cells were collected, re-incubated in 96-well plates for 12 h. The nitric oxide of supernatant reacted with Greiss reagent, and absorbance was determined at 540 nm. Results represent the means of three separate experiments, and error bars represent the standard error of the mean. Statistical significance was shown in all treated groups by the Student’s t-test (* p < 0.05; ** p < 0.01). (B) RNA was extracted from the peritoneal macrophages and amplified by RT-PCR using the respective primers described in Table 1. Results were confirmed by several separate experiments and representative images were shown.

Fig. 3. Effect of silica nanoparticles on the blood level of IL-1␤ and TNF-␣. Blood was collected from retro-orbital venous plexus of mice treated with silica nanoparticles and sacrificed at the designated time. The concentration of each cytokine in the culture supernatants was determined by using ELISA. Results represent the means of four separate experiments, and error bars represent the standard error of the mean. Statistical significance was shown in all treated groups by the Student’s t-test (** p < 0.01). (A) IL-1 beta and (B) TNF alpha.

3.3. Increased level of pro-inflammatory cytokines in mice

3.4. Splenocyte proliferation and change of phenotypes in mice

The levels of pro-inflammatory cytokines (IL-1␤ and TNF-␣) released to the serum in treated mice were also elevated after i.p. injection of silica nanoparticles 50 mg/kg. IL-1␤ reached to maximum at 12–24 h after treatment (18.9 pg/ml) and the level was decreased gradually in a time-dependent manner to 72 h. The increased ratio to the non-treated control group were 25.4-fold at 12 h, 25.1-fold at 24 h, 21.6-fold at 48 h, and 5.5-fold at 72 h after treatment, respectively (Fig. 3A). Also, TNF-␣ reached to maximum at 24 h after treatment (11.2 pg/ml) and the level was decreased gradually in a time-dependent manner. The increased ratio to the non-treated control group were 14.2-fold at 12 h, 17.6-fold at 24 h, 15.9-fold at 48 h and 9.5-fold at 72 h, respectively (Fig. 3B).

When mice were intraperitoneally treated with silica nanoparticles 50 mg/kg, the number of splenocytes was greatly increased to about 180% of control group as shown in Fig. 4A. This means that silica nanoparticles proliferates the splenocytes in vivo. However, the number of viable cells was decreased by the increase of dosage to 100 mg/kg and 250 mg/kg i.p., which means cytotoxicity of silica nanoparticles in vivo treatment with high doses. The distribution of the three major types of lymphocytes (T cells, B cells, and NK cells) was determined using FACS in spleen of the mice treated with 50 mg/kg i.p. As shown in Fig. 4B, NK cell and T cell distribution were increased to 184.8% and 115.1% of control,

22

E.-J. Park, K. Park / Toxicology Letters 184 (2009) 18–25

Fig. 4. Effect of silica nanoparticles on the splenocyte proliferation and phenotype alternation of lymphocytes in spleen. (A) Trypan blue exclusion test was done for the count of viable splenocytes prepared from treated or non-treated control mice (n = 3). Result represents the mean of three separate experiments, and error bars represent the standard error of the mean. Statistical significance was shown in all treated groups by the Student’s t-test (** p < 0.01). (B) Specific leukocyte subtypes of splenocytes were determined by immunofluorescent antibody staining and flow cytometry analysis. Lymphocyte subpopulations were identified and gated using forward vs. side scatter characteristics. Results were confirmed by several separate experiments and representative images were shown.

respectively, while B cell distribution was decreased to 87.7% of control. 3.5. Generation of ROS and decreased GSH in RAW264.7 cells To investigate mechanism of pro-inflammatory responses and proliferation of splenocytes which were shown in in vivo tests, in vitro tests were performed using RAW264.7 cell line which was originated mouse peritoneal macrophage. The level of ROS and intracellular GSH were determined in cultured RAW264.7 cells treated with silica nanoparticles 5 ppm, 10 ppm, 20 ppm, and 40 ppm, respectively. The fluorescence intensity of oxidized DCF was increased in a dose-dependent manner in RAW264.7 cells which means the ROS generation (Fig. 5A). When cells were treated with silica nanoparticle 40 ppm for 24 h, ROS generation was increased to 139.1% of non-treated control. Image of ROS generation made by the fluorescent microscope was shown in Fig. 5B. The intensity of green color means ROS generation and it was intensified in silica nanoparticles-treated group. As ROS level was increased, antioxidant GSH level was decreased as shown in Fig. 5C. The level of intracellular GSH in the group treated with silica nanoparticles 40 ppm was about 75% of the control group at 24 h after treatment.

Fig. 5. Effects of silica nanoparticles on the level of ROS and GSH in RAW264.7 cells. (A) Cells were treated with silica nanoparticles of 5 ppm, 10 ppm, 20 ppm, 40 ppm for 24 h, incubated with 40 ␮M DCFH-DA, and then washed with phosphate-buffered saline. The cells were lysed with 1 M NaOH and the fluorescence of aliquot was measured. Results represent the means of three separate experiments, and error bars represent the standard error of the mean. Treated groups showed statistically significant differences from the control group by the Student’s t-test (* p < 0.05, ** p < 0.05). Data were expressed as the percentage of the ROS level in the control group. (B) Cells were treated with silica nanoparticles of 40 ppm for 24 h. Cells were stained with DCFH-DA and observed with a fluorescent microscope (200×). (C) A fluorometric method using o-phthaldialdehyde was used to measure GSH. GSH was calculated as nmol of glutathione per mg of protein and then was presented as a percentage of control. Results represent the means of three separate experiments, and error bars represent the standard error of the mean. All groups treated with nanoparticles showed statistically significant differences from the control group (* p < 0.05, ** p < 0.01). Data are represented as the percentage of the GSH level in control group.

E.-J. Park, K. Park / Toxicology Letters 184 (2009) 18–25

23

Fig. 6. Effects of silica nanoparticles on the levels of nitric oxide in RAW264.7 cells. Cells were treated with silica nanoparticles of 5 ppm, 10 ppm, 20 ppm, 40 ppm for 24 h. The nitric oxide of supernatant reacted with Greiss reagent, and absorbance was determined at 540 nm. Results represent the means of five separate experiments, and error bars represent the standard error of the mean. Statistical significance was shown in treated groups by the Student’s t-test (* p < 0.05, ** p < 0.01).

3.6. Generation of pro-inflammatory NO in RAW264.7 cells Generation of oxidative stress and NO are very closely correlated in inflammatory responses in cells. The generation of oxidative stress by silica nanoparticles may cause the induction of NO in RAW 264.7 cells in this study. Although the induction levels were not same as those of ROS levels, NO was increased in RAW264.7 cells in a concentration-manner when treated with silica nanoparticles 5 ppm, 10 ppm, 20 ppm, and 40 ppm (Fig. 6). The increase level in the treated group with nanoparticles 40 ppm was 118.6% of non-treated control group. 3.7. Cytotoxicity and caspase-3 activation in RAW264.7 cells ROS generated by silica nanoparticles caused cytotoxicity to the cultured RAW264.7 and viability was decreased in a concentrationand time-dependent manner as shown in Fig. 7A. Cytotoxicity was appeared in all the concentrations and exposure-durations except low concentration of 5 ppm where viability was not significantly decreased. With the cytotoxicity of silica nanoparticles, the activities of caspase-3 which plays a key role in the apoptotic pathway of cells were increased as shown in Fig. 7B. The activity was significantly elevated to about 160% in the cells treated with silica nanoparticles 40 ppm, where cell viability was dropped to about 50% of control group at 24 h after treatment. By the activation of caspase-3, cytotoxicity of silica nanoparticles in RAW 264.7 cells seemed to be caused by apoptotic process. 4. Discussion Toxicological studies are rapidly increasing both in engineered nanomaterials and in naturally occurring particles (Kipen and Laskin, 2005; Kagan et al., 2005; Curtis et al., 2006; Hardman, 2006). As one of the toxic mechanisms of nanoparticles, ROS generation may be the most widely studied. Recently, ROS generation in cultured cells treated with C60 fullerenes, single-walled nanotubes (SWNTs), cerium oxide nanoparticles, and other metal

Fig. 7. Effects of silica nanoparticles on the viability and caspase-3 activity in RAW264.7 cells. (A) Cell viability was assessed by MTT assays and results are presented as a percentage of control group viability. Cells (2 × 103 to 1 × 104 cells) were treated with the indicated concentrations of silica nanoparticles (10 nm) for 24, 48, 72, and 96 h. Cell viability was greatly reduced in a concentration-dependent and time-dependent manner by nanoparticle exposure. All treated groups except one (the 5 ppm for 24 h-treated group) showed statistically significant differences from the control group by the Student’s t-test (p < 0.01). Results represent the means of three separate experiments, and error bars represent the standard error of the mean. (B) Caspase-3 activity was measured using a colorimetric caspase-specific substrate. Results represent the means of three separate experiments, and error bars represent the standard error of the mean. Statistical significance was shown in treated groups by the Student’s t-test (* p < 0.05, ** p < 0.01).

particles have been reported (Hussain et al., 2005; Park et al., 2008; Limbach et al., 2007). Furthermore, effects of nanoparticles on proinflammatory responses have been reported. It was reported that TiO2 nanoparticles and carbon black nanoparticles produced much stronger pro-inflammatory responses than the same mass dose of fine TiO2 and carbon black particles (Niwa et al., 2008; Monteiller et al., 2007; Renwick et al., 2004). Carbon black also caused cytotoxic injury/inflammation, inhibits cell growth in vascular endothelial cells, and induces type II epithelial cells to release chemotaxins for alveolar macrophages (Yamawaki and Iwai, 2006; Barlow et al., 2005). Regarding the crystalline silica, many publications have been released on the oxidative stress and pro-inflammatory responses as described before but only a few data exist in case of amorphous silica nanoparticles. Furthermore, full reports on the

24

E.-J. Park, K. Park / Toxicology Letters 184 (2009) 18–25

pro-inflammatory responses induced by amorphous silica nanoparticles have not been released yet. In this study, we investigated pro-inflammatory effects of amorphous silica nanoparticles in vivo and in vitro. At first, activation of macrophage in peritoneal cavity was observed by treatment of silica nanoparticles 50 mg/kg. As a shown in Fig. 1, cytoplasm of macrophage from treated mice spread out while macrophages from non-treated group showed no cytoplasmic spreading. The macrophage activation was occurred at 12 h after treatment in this study as shown in Fig. 1. But it seems that macrophage activation may be occurred earlier (data not shown). Long time exposure of silica nanoparticles to the macrophages seemed to cause cytotoxicity with many vacuoles as shown in the cytoplasm of cell (Fig. 1, 48, 72 h). The activated macrophages released NO in a time-dependent manner when they were cultured for 24 h after injection of silica nanoparticles 50 mg/kg (Fig. 2A). When silica nanoparticles were injected intraperitoneally, a part of the particles was transferred to other tissue through the bloodstream and a part of them may retained in the peritoneal cavity. Then, the particles remained in the peritoneal cavity could attract the macrophages from the bloodstream to the peritoneal cavity and stimulated them. It is the reason why macrophages harvested from the mice sacrificed 72 h after a single injection of silica nanoparticles, still released a high level of NO. Nitric oxide is a signaling molecule that plays a key role in the pathogenesis of inflammation and it is overproduced in abnormal physiological conditions (Sharma et al., 2007). Therefore, the increase of NO by silica nanoparticles may induce pro-inflammatory response and related diseases. With the generation of NO, blood levels of IL-1␤ and TNF-␣ were increased after intraperitoneally injection of silica nanoparticles 50 mg/kg. IL-1␤ and TNF-␣ reached to maximum at 12–24 h and the increase ratio to the control level were 25.4-fold and 17.6-fold, respectively (Fig. 3A and B). IL-1␤, TNF-␣, and other cytokines play an important role in the pathogenesis of silicosis and other chronic inflammatory lung (Rojanasakul et al., 1999). The induction patterns of IL-1␤ and TNF-␣ seemed to be similar but very different with that of NO. IL-1␤ and TNF-␣ reached maximal level earlier than NO did. Differences between the time-course of cytokine induction and NO generation could not be explained exactly. Lymphocytes in blood may be stimulated maximally from 12 to 24 h but peritoneal macrophages may be stimulated for 72 h after injection. As mentioned before, some of silica nanoparticles not absorbed but remained in the peritoneum may still stimulate the macrophages to generate NO. As shown in Fig. 2B, silica nanoparticles induced the mRNA expression of pro-inflammatory cytokines (IL-1␤, TNF-␣ and IL-6) or other inflammatory-related enzymes (iNOS, COX-2) in a time-dependent manner in peritoneal macrophages for 72 h after treatment. Although the blood level of cytokines (IL-1␤ and TNF-␣) were decreased after 24 h, the mRNA expressions of IL-1␤ and TNF-␣ in peritoneal macrophages were maximal level at 72 h after treatment. The increase of gene expression of pro-inflammatory cytokine such as IL-1␤ and TNF-␣ may trigger the expression of iNOS (inducible NO synthetase), and iNOS may trigger the generation of NO. IL-6 acts as both a pro-inflammatory and anti-inflammatory cytokine and is secreted from T cell and macrophages. Metal oxide nanoparticles and carbon black nanoparticles showed pro-inflammatory responses and inflammatory mediators of cytokines were reported to be induced by the nanoparticles (Niwa et al., 2008; Monteiller et al., 2007; Renwick et al., 2004). Many papers were published that cytokines such as IL-1␤, TNF-␣, and IL-6 were increased by silica particles of crystalline form (Rojanasakul et al., 1999; Balduzzi et al., 2004; Rao et al., 2004). Comparing in vitro measurements to in vivo pulmonary toxicity profiles was done (Sayes et al., 2007). In

the report, rats were treated with amorphous silica nanoparticles by intratracheal instillation (5 mg/kg), and neutrophil number in BAL fluid was found to be increased. In vitro test, TNF-␣ and IL-6 were not induced in cultured macrophage but induced in the coculture of macrophage and L2 cells at the concentration over 0.52 ␮g/cm2 . In our study, IL-1␤ and TNF-␣ were increased in both peritoneal macrophage (mRNA level) and in blood (protein level). As shown in Fig. 4A, silica nanoparticles showed biphasic effect on splenocytes proliferation. When mice were treated with silica nanoparticles 50 mg/kg, cell proliferation effects was shown at 24 h after treatment. This effect of silica nanoparticles seemed to be related with the activation of macrophages, cytokine induction, and generation of NO. These pro-inflammatory mediators may trigger the proliferation of splenocytes. However, cytotoxicity was shown in treated group with higher doses of silica nanoparticles 100 mg/kg and 250 mg/kg. Regarding the proliferating effect of silica nanoparticles on splenocytes, phenotypic alterations of lymphocytes derived from spleen were analyzed by FACS. As shown Fig. 4B, NK cell and T cell distribution increase to 184.8% and 115.1% of control, respectively, while B cell distribution was decreased to 87.7% of control. It suggested that inflammatory responses induced by silica nanoparticles are related with the cellular immunity not with the humoral immunity. Many reports have been released on the relationship between oxidative stress and inflammation. The role of oxidative stress in inflammatory diseases is still unclear but it is a main research area in particle toxicology (Donaldson et al., 2005; Li et al., 2008; Stone et al., 2007; Lubos et al., 2008). Oxidative stress induces signaling pathways of MAPK, transcription factors such as NFkB, AP-1. These transcription factors-induced mRNA expression of pro-inflammatory mediators, and finally cause inflammation and related diseases. In our study, ROS generation and GSH depletion were shown by silica nanoparticle treatment in RAW264.7 cells. The responses caused by the particles were reversely related as shown in Fig. 5A and C. Similar effects were observed in the cells treated with nanoparticles such as single-wall carbon nanotubes (SWCNTs), semiconductor quantum dots and cerium oxide (Li et al., 2008; Park et al., 2008). As described before, NO is very critical in proinflammatory responses and ROS may trigger the generation of NO. The generation of NO by silica nanoparticles was occurred both in vivo and in vitro (Fig. 2A and Fig. 6). With the increased generation of ROS and NO, cytotoxicity was shown in RAW264.7 cells. There are many evidences that nanoparticles generate ROS and can cause cell death in different types of cultured cells (Peters et al., 2007; Pulskamp et al., 2007; Lin et al., 2006). Cell viability was decreased by silica nanoparticles in a time- and concentrationdependent manner (Fig. 7A). Cell viability of the group treated with silica nanoparticles 40 ppm for 48 h was about 40% of control. When A549 cells were treated with 15-nm silica nanoparticle 50 ppm for 48 h, the viability was decreased to 76.0% of control (Lin et al., 2006). Cell death by silica nanoparticles was closely related with the activation of caspase-3, which plays a key role in the apoptotic pathway of cells. The activity of caspase-3 was increased by the treatment of silica nanoparticles in a concentration-dependent manner and was increased to about 164% of control group in the treated group with silica nanoparticles 40 ppm for 24 h exposure (Fig. 7B). Although direct evidences of genotoxicity were not provided in this study, there is a possibility that caspase-3 activation by silica nanoparticles may increase DNA degradability to cause genotoxicity. Recently, negative result on genotoxicity by comet assay was reported (Barnes et al., 2008). But it may not be conclusive because genotoxicity was determined only by comet assay without further tests.

E.-J. Park, K. Park / Toxicology Letters 184 (2009) 18–25

In summary, silica nanoparticles-induced pro-inflammatory responses in vivo/in vitro, and the pro-inflammatory responses may be triggered by ROS generation. Conflict of interest statement None. References Arts, J.H., Muijser, H., Duistermaat, E., Junker, K., Kuper, C.F., 2007. Five-day inhalation toxicity study of three types of synthetic amorphous silicas in Wistar rats and post-exposure evaluations for up to 3 months. Food Chem. Toxicol. 45, 1856–1867. Balduzzi, M., Diociaiuti, M., De Berardis, B., Paradisi, S., Paoletti, L., 2004. In vitro effects on macrophages induced by noncytotoxic doses of silica particles possibly relevant to ambient exposure. Environ. Res. 96, 62–71. Barik, T.K., Sahu, B., Swain, V., 2008. Nanosilica-from medicine to pest control. Parasitol. Res. 103 (2), 253–258. Barlow, P.G., Clouter-Baker, A., Donaldson, K., Maccallum, J., Stone, V., 2005. Carbon black nanoparticles induce type II epithelial cells to release chemotaxins for alveolar macrophages. Part Fibre Toxicol. 2, 11. Barnes, C.A., Elsaesser, A., Arkusz, J., Smok, A., Palus, J., Lesniak, A., Salvati, A., Hanraha, P.J., Jong, W.H., Dziubaltowska, E., Stepnik, M., Rydzynski, K., Mckerr, G., Lynch, I., Dawson, K.A., Howard, C.V., 2008. Reproducible comet assay of amorphous silica nanoparticles detects no genotoxicity. Nano Lett. 9 (9), 3069–3074. Byun, J.A., Ryu, M.H., Lee, J.K., 2006. The immunomodulatory effects of 3monochloro-1,2-propanediol on murine splenocyte and peritoneal macrophage function in vitro. Toxicol. In Vitro 20, 272–278. Chang, J.S., Chang, K.L., Hwang, D.F., Kong, Z.L., 2007. In vitro cytotoxicity of silica nanoparticles at high concentrations strongly depends on the metabolic activity type of the cell line. Environ. Sci. Technol. 41, 2064–2068. Chen, F., Sun, S.C., Kuh, D.C., Gaydos, L.J., Demers, L.M., 1995. Essential role of NF-kB activation in silica-induced inflammatory mediator production in macrophages. Biochem. Biophys. Res. Commun. 214, 985–992. Cho, W.S., Choe, M.N., Han, B.S., Cho, M., Oh, J.H., Park, K.D., Kim, S.J., Kim, S.H., Jeong, J.Y., 2007. Inflammatory mediators induced by intratracheal instillation of ultrafine amorphous silica particles. Toxicol. Lett. 175, 24–33. Cocco, P., Dosemeci, M., Rice, C., 2007. Lung cancer among silica-exposed workers: the quest for truth between chance and necessity. Med. Lav. 98 (1), 3–17. Curtis, J., Greenberg, M., Kester, J., Phillips, S., Krieger, G., 2006. Nanotechnology and nanotoxicology: a primer for clinicians. Toxicol. Rev. 25 (4), 245–260. Donaldson, K., Tran, L., Jimenez, L.A., Duffin, R., Newby, D.E., Mills, N., MacNee, W., Stone, V., 2005. Combustion-derived nanoparticles: a review of their toxicology following inhalation exposure. Park Fibre Toxicol. 2, 10. Elbekai, R.H., El-Kadi, A.O.S., 2005. The role of oxidative stress in the modulation of aryl hydrocarbon receptor-regulated genes by As3+ , Cd2+ , and Cr6+ . Free Radical Biol. Med. 39, 1499–1511. Fotakis, G., Cemeli, E., Anderson, D., Timbrell, J.A., 2005. Cadmium chloride-induced DNA and lysosomal damage in a hepatoma cell line. Toxicol. In Vitro 19, 481–489. Hamilton Jr., R.F., Thakur, S.A., Holian, A., 2008. Silica binding and toxicity in alveolar macrophages. Free Radical Biol. Med. 44, 1246–1258. Hardman, R., 2006. A Toxicological review of quantum dots: toxicity depends on physicochemical and environmental factors. Environ. Health Perspect. 114 (2), 165–172. Hissin, P.J., Hilf, R., 1976. Fluorometric method for determination of oxidized and reduced glutathione in tissues. Anal. Biochem. 74, 214–226. Hussain, S.M., Hess, K.L., Gearhart, J.M., Geiss, K.T., Schlager, J.J., 2005. In vitro toxicity of nanoparticles in BRL 3A rat liver cells. Toxicol. In Vitro 19, 975–983. IARC, 1997. IARC summary and evaluation (Silica), vol. 67. Iyer, R., Hamilton, R.F., Li, L., Holian, A., 1996. Silica-induced apoptosis mediated via scavenger receptor in human alveolar macrophage. Toxicol. Appl. Pharmacol. 141, 84–92. Jin, Y., Kannan, S., Wu, M., Zhao, J.X., 2007. Toxicity of luminescent silica nanoparticles to living cells. Chem. Res. Toxicol. 20, 1126–1133.

25

Kagan, V.E., Bayer, H., Shvedova, A.A., 2005. Nanomedicine and nanotoxicology: two sides of the same coin. Nanomedicine 1 (4), 313–316. Kaewamatawong, T., Shimada, A., Okajima, M., Inoue, H., Morita, T., Inoue, K., Takano, H., 2006. Acute and subacute pulmonary toxicity of low dose of ultrafine colloidal silica particles in mice after intratracheal instillation. Toxicol. Pathol. 34, 958–965. Kipen, H.M., Laskin, D.L., 2005. Smaller is not always better: nanotechnology yields nanotoxicology. Am. J. Physiol. Lung Cell Mol. Physiol. 289, L696–L697. Li, N., Xia, T., Nel, A.E., 2008. The role of oxidative stress in ambient particulate matter-induced lung diseases and its implications in the toxicity of engineered nanoparticles. Free Radical Biol. Med. 44, 1689–1699. Limbach, L.K., Wick, P., Manser, P., Grass, R.N., Bruinink, A., Stark, W.J., 2007. Exposure of engineered nanoparticles to human lung epithelial cells: influence of chemical composition and catalytic activity on oxidative stress. Environ. Sci. Technol. 41, 4158–4163. Lin, W., Huang, Y., Zhou, X.D., Ma, Y., 2006. In vitro toxicity of silica nanoparticles in human lung cancer cells. Toxicol. Appl. Pharmacol. 217, 252–259. Lubos, E., Handy, D.E., Loscalzo, J., 2008. Role of oxidative stress and nitric oxide in atherothrombosis. Front. Biosci. 13, 5323–5344. Monteiller, C., Tran, L., MacNee, W., Faux, S., Jones, A., Miller, B., Donaldson, K., 2007. The pro-inflammatory effects of low-toxicity low-solubility particles, nanoparticles and fine particles, on epithelial cells in vitro: the role of surface area. Occup. Environ. Med. 64, 609–615. Niwa, Y., Hiura, Y., Sawamura, H., Iwai, N., 2008. Inhalation exposure to carbon black induces inflammatory response in rats. Circ. J. 72, 144–149. Øvrevik, J., Refsnes, M., Namork, E., Becher, R., Sandnes, D., Schwarze, P.E., Låg, M., 2006. Mechanisms of silica-induced IL-8 release from A549 cells: initial kinaseactivation does not require EGFR activation or particle uptake. Toxicology 227, 105–116. Park, E.J., Choi, J., Park, Y., Park, K., 2008. Oxidative stress induced by cerium oxide nanoparticles in cultured BEAS-2B cells. Toxicology 245 (1–2), 90–100. Peters, K., Unger, R.E., Gatti, A.M., Sabbioni, E., Tsaryk, R., Kirkpatrick, C.J., 2007. Metallic nanoparticles exhibit paradoxical effects on oxidative stress and proinflammatory response in endothelial cells in vitro. Int. J. Immunopathol. Pharmacol. 20, 685–695. Pulskamp, K., Diabate, S., Krug, H.F., 2007. Carbon nanotubes show no sign of acute toxicity but induce intracellular reactive oxygen species in dependence on contaminants. Toxicol. Lett. 168, 58–74. Rao, Porter, Meighan, T., Castranova, V., 2004. The sources of inflammatory mediators in the lung after silica exposure. Environ. Health. Perspect. 112, 1679–1686. Renwick, C., Brown, D., Clouter, A., Donaldson, K., 2004. Increased inflammation and altered macrophage chemotactic responses caused by two ultrafine particle types. Occup. Environ. Med. 61, 442–447. Rimal, B., Greenberg, A.K., Rom, W.N., 2005. Basic pathogenetic mechanisms in silicosis: current understanding. Curr. Opin. Pulm. Med. 11, 169–173. Rojanasakul, Y., Ye, J., Chen, F., Wang, L., Cheng, N., Castranova, V., Vallyathan, V., Shi, X., 1999. Dependence of NF-kappaB activation and free radical generation on silica-induced TNF-alpha production in macrophages. Mol. Cell. Biochem. 200 (1–2), 119–125. Sayes, C.M., Reed, K.L., Warheit, D.B., 2007. Assessing toxicity of fine and nanoparticles: comparing in vitro measurements to in vivo pulmonary toxicity profiles. Toxicol. Sci. 97 (1), 163–180. Sharma, J.N., Al-Omran, A., Parvathy, S.S., 2007. Role of nitric oxide in inflammatory diseases. Inflammopharmacology 15, 252–259. Stone, V., Johnston, H., Clift, M.J., 2007. Air pollution, ultrafine and nanoparticle toxicology: cellular and molecular interactions. IEEE Trans. Nanobiosci. 6, 331–340. Van Hoecke, K., De Schamphelaere, K.A., Van der Meeren, P., Lucas, S., Janssen, C.R., 2008. Ecotoxicity of silica nanoparticles to the green alga Pseudokirchneriella subcapitata: importance of surface area. Environ. Toxicol. Chem. 27 (9), 1948–1957. Vendrame, M., Gemma, C., Pennypacker, K.R., Bickford, P.C., Davis, S.C., Sanberg, P.R., Willing, A.E., 2006. Cord blood rescues stroke-induced changes in splenocyte phenotype and function. Exp. Neurol. 199, 191–200. Yamawaki, H., Iwai, N., 2006. Mechanisms underlying nano-sized air-pollutionmediated progression of atherosclerosis: carbon black causes cytotoxic injury/inflammation and inhibits cell growth in vascular endothelial cells. Circ. J. 70 (1), 129–140.