Oxidative stress responses in rainbow trout (Oncorhynchus mykiss) hepatocytes exposed to pro-oxidants and a complex environmental sample

Comparative Biochemistry and Physiology, Part C 151 (2010) 431–438

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / c b p c

Oxidative stress responses in rainbow trout (Oncorhynchus mykiss) hepatocytes exposed to pro-oxidants and a complex environmental sample E. Farmen a,b,⁎, P.A. Olsvik c, M.H.G. Berntssen c, K. Hylland a,b, K.E. Tollefsen a a b c

Norwegian Institute for Water Research (NIVA), Gaustadallèen 21, N-0349 Oslo, Norway Department of Biology, University of Oslo, P.O. Box 1066, Blindern, N-0316 Oslo, Norway National Institute of Nutrition and Seafood Research, P.O. Box 176 Sentrum, N-5804 Bergen, Norway

a r t i c l e

i n f o

Article history: Received 4 January 2009 Received in revised form 22 January 2010 Accepted 23 January 2010 Available online 28 January 2010 Keywords: Toxicity Environmental monitoring Glutathione Antioxidant enzymes

a b s t r a c t A wide range of pollutants in the aquatic environment have the capacity to induce toxic effects expressed as cellular oxidative stress. In the current study, the potential of an in vitro toxicity testing system was therefore investigated using rainbow trout (Oncorhynchus mykiss) hepatocytes to assess different endpoints of oxidative stress. The pro-oxidants CuSO4 and paraquat were used as models for comparison to a complex environmental sample. Results following 6, 24, 48 and 96 h exposure to different concentrations of these substances show cellular effects on intracellular ROS formation, glutathione levels and redox status, expression of the antioxidant enzymes superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase, γ-glutamyl-cysteine synthetase (GCS) and thioredoxin, as well as cytotoxicity parameters. The most consistent effects (maximum values within brackets), observed in dose and time parameters for both model compounds and environmental sample, were the depletion of total glutathione (9.4% of control), induced levels of oxidized glutathione (695% of control), and gene expression regulation depicted relative to the control gene beta-actin of GCS mRNA (239% of control) and catalase (29% of control). In conclusion, the responses on several antioxidant defence system parameters demonstrated the validity of the in vitro toxicity testing system. Not only could multiple effects be detected at sub-lethal exposure concentrations, but these effects also gave valuable insight to the toxic mechanisms at the molecular level. © 2010 Elsevier Inc. All rights reserved.

1. Introduction Reactive oxygen species (ROS) such as hydroxyl radicals, hydrogen peroxide and superoxide are natural by-products of aerobic metabolism, but can additionally be produced intracellularly by different xenobiotics (Livingstone 2001). The highly reactive properties of ROS molecules make them a potential threat to normal cellular function. Several macromolecules are sensitive to interactions with ROS, and dysfunctional enzymes, lipid peroxides and DNA damage can in different ways result in malfunctioning, necrotic or apoptotic cells (Halliwell and Gutteridge, 1999). ROS have been linked to the etiology of several diseases, including cancer and neurodegenerative disorders (Frenkel, 1992; Halliwell, 1994; Markesbery 1997; Weisburger, 2001). To maintain homeostasis, the cell therefore possesses different defence mechanisms including antioxidants (i.e. glutathione, vitamin C, and vitamin E) and antioxidant enzymes (AOE) such as superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px). In addition, indirectly acting enzymes such as glutathione reductase (GSSG-R), γ-glutamyl-cysteine synthetase (GCS) and thioredoxin contribute to the cellular processes capable of ⁎ Corresponding author. Ecotoxicology, Norwegian Institute for Water Research, Gaustadalleen 21, N-0349 Oslo, Norway. Tel.: + 47 22 18 51 00. E-mail address: eivind.fi[email protected] (E. Farmen). 1532-0456/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.cbpc.2010.01.008

reducing the total oxidative stress. Induction of these defence systems, and detection of oxidative damage to macromolecules such as DNA, proteins and lipids, have been used with success to assess oxidative stress and cellular damage to various pro-oxidants in aquatic organisms (Stephensen et al., 2002; Rau et al. 2004; Sturve et al., 2006). Several in vivo studies involving exposure to pro-oxidants have shown alterations of antioxidant- and AOE levels, as well as formation of lipid peroxides and protein carbonyls (Stephensen et al., 2002, Almroth et al, 2005). Examples of additional endpoints encountered in the in vitro literature are apoptosis, DNA laddering and cytotoxicity (Liu et al, 2007). The connection between biomarker induction and onset of physiological effect is not always fully understood at the molecular level, but a range of substances present in the aquatic environment can cause oxidative stress including transition metals, polycyclic aromatic hydrocarbons, organochlorine and organophosphate pesticides, polychlorinated biphenyls and dioxins. When biomarkers of oxidative stress are used in concert with other endpoints related to survival or reproduction, there is widespread support in literature that adverse physiological effects can be attributed to the presence of such pollutants in the environment (Myers et al., 1998; Lind et al., 2004; Perceval et al., 2004; Lerner et al., 2007). A complicating factor of environmental monitoring studies is however the fact that most effluents contain multiple unknown toxic chemicals that may act individually and in combination

432

E. Farmen et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 431–438

to produce effects. When applying different sample extraction methods, such as solid-phase extraction, environmental contaminants can be concentrated to levels that facilitate chemical and biological monitoring. Produced water (PW) from oil/gas production platforms is one such complex environmental sample. PW consists of hundreds to thousands of organic and inorganic compounds and effluents result in environmental levels of PAH at concentrations between 25–350 ng/L within 1 km of the discharge (Durell et al., 2006). Some data on cellular redox status exist from in vivo experiments with cod exposed to selected components of PW, which show increased levels of hepatic glutathione and increased activity of glutathione reductase (Hasselberg et al., 2004; Sturve et al., 2006). However, such in vivo studies are time consuming and restrictive in terms of the number of different substances that can be tested, and therefore introduce a need for alternative in vitro methods. The in vitro culturing of primary cells has several advantages for use in toxicity screening, such as cost and time efficiency, small sample requirement and possibilities for high throughput screening (Castaño et al., 2003). Basal cytotoxicity data of fish cells have also showed good agreement with acute toxicity in vivo (see Castaño and Gómez-Lechón, 2005 for review). Natural variation between individuals is present, but total variation is minimized as a consequence of using cells from the same individual as both control and exposed groups. Consequently, this approach has been used for screening single chemicals, mixtures as well as complex environmental samples, utilizing classical biomarkers and effect endpoints (Tollefsen et al., 2003; Tollefsen et al., 2006a; Tollefsen et al., 2006b). The model compounds chosen for this study were representatives of inorganic and organic pro-oxidants, while the environmental sample included was an extract containing organic substances only. Both model compounds are known to produce ROS and have previously been used to provoke oxidative stress in different cells (Rau et al., 2004; Ruiz-Leal and George, 2004). The herbicide PQ has a redox cycling mode of action creating cellular oxidative stress. It undergoes a one-electron reduction to form free radicals which are capable of generating reactive oxygen species (ROS) (Bus et al., 1976). Copper (II) on the other hand contribute to ROS formation through an increase in the rate of the Haber–Weiss reaction, giving rise to several ROS species such as the hydroxyl radical and the superoxide anion. The complex environmental sample, however, consists of multiple chemicals with unknown toxicity. Several reports have been made concerning the chemical contents of produced water (Harman et al., 2009; Utvik, 1999). Of the organic components sampled by the columns used in the solid phase extraction, PAH and alkylphenols are important groups of chemicals that could be suspected to contribute to cellular oxidative stress (Hasselberg et al., 2004; Sturve et al., 2006). This study was performed to assess the suitability of different oxidative stress biomarkers to screen single contaminants and environmental samples using a primary hepatocyte culture model system. The endpoints chosen were intracellular ROS formation as a biomarker of exposure, and reduced/oxidized glutathione alongside gene expression of several antioxidant enzymes as an indication of cellular response. Cytotoxicity was determined in parallel since the biomarkers applied in this study are components of homeostatic cellular defence systems and may thus lose their responsiveness when cells are exposed to cytotoxic levels of contaminants. 2. Materials and methods 2.1. Chemicals All chemicals used (paraquat, CuSO4, and DMSO) were supplied by Sigma-Aldrich (St.Louis, MO, USA) and had a minimum purity of 98%. The environmental samples used were samples of produced water which were subjected to solid phase extraction, using the method described in Thomas et al. (2001). Briefly, produced water was passed

through a glass wool filter to trap oil droplets, and the aqueous phase was extracted by pre-conditioned SPE columns containing the resin ENV + (1 g, IST, Hengoed, UK) and octadecylsilane (C18, 5 g; IST, Hengoed, UK). The glass wool and SPE columns were stored for a maximum of 2 weeks at − 80 °C before being defrosted, eluted with methanol (2 × 5 mL; HPLC grade, Rathburns, Walkerburn, Scotland) and cyclohexane (2 × 5 mL; Ultra resi-analyzed, J.T. Baker, Deventer, Holland). The combined extracts were then reduced in volume, solvent changed to ultrapure DMSO (Sigma-Aldrich) and stored at −20 °C until bioassay testing. 2.2. Fish Juvenile rainbow trout (Oncorhynchus mykiss, Salmonidae) were obtained from a local hatchery (Kili oppdrettsanlegg) and kept in tanks at University of Oslo (Oslo, Norway). The fish was fed daily with commercial fish pellets (EWOS, Bergen, Norway) in amounts corresponding to approximately 0.5% of total body mass. The water temperature was 12 °C, with pH 6.6, and the tanks received artificial illumination (100 lx) with a photoperiod of 12 h:12 h. 2.3. Cell culture and exposure A two step perfusion of the liver was performed as described by Tollefsen et al. (2003). Initially the liver was perfused with a buffer containing the chelator EGTA to destabilize desmosomes and gap junctions followed by a Ca2+ and collagenase containing buffer to disrupt the extracellular matrix binding structures of the liver in order to release single cells into solution. Post perfusion, the cells were plated as a monolayer culture at a density of 5×105 cells/mL in 6 well- (3 mL/well), 24 well- (1 mL/well), or 96 well (0.2 mL/well) Falcon Primaria plates (Becton Dickinson, Franklin Lakes, NJ, USA), using serum free L-15 medium containing 100 U penicillin/mL, 100 μg streptomycin/mL, 0.25 μg Amphotericin/mL, 2 mM L-glutamine and 0.0375 % sodium bicarbonate (all from BioWhittaker, Walkersville, MD, USA). After a 24 h pre-culture period, the cells were exposed to the test chemicals which were prepared in fresh media at 1:500 dilution. Half of the medium was aspirated prior to exposure, thus resulting in a final 1:1000 dilution of the exposure solutions. Stock solutions of CuSO4 and paraquat were prepared in ultrapure (milliQ) water and tested along with appropriate controls (milliQ water or DMSO). 2.4. Biochemical assays Following 6–96 h exposure, cells were harvested and subjected to analysis of cytotoxicity, intracellular ROS formation, total and oxidized glutathione, and gene expression of catalase, Cu/Zn superoxide dismutase, glutathione peroxidase, glutathione reductase, γ-glutamylcysteine synthetase and thioredoxin. 2.5. Cytotoxicity Cytotoxicity was measured directly in the cell culture by the fluorescent dye 5-carboxyfluorescein diacetate acetoxymethyl ester (CFDA-AM) (Molecular Probes, Leiden, Netherlands) and Alamar blue (AB) (BioSource, Nivelles, Belgium) according to the method described by Schreer et al. (2005). Briefly, the exposure media was removed from the wells and exchanged with 100 μL of DMEM (SigmaAldrich) containing 4 μM CFDA-AM and 5% AB. The cells were incubated for 30 min in the dark (20 °C) and the concentrations of the metabolites of the fluorescent probes AB and CFDA-AM were measured simultaneously using the wavelength pairs of 530–590 nm and 485–530 nm (excitation–emission), respectively. The viability of the cells was determined on basis of the fluorescence of cells exposed to the solvent control (no effect) and the maximum toxicity obtained for CuSO4 (10 mM).

E. Farmen et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 431–438

2.6. Intracellular ROS formation Detection of ROS production was performed directly in 96 well plates, using 2′,7′dichlorodihydrofluorescien diacetate (H2DCFDA) and 5-(and6)-chloromethyl-2′,7′ dichlorodihydrofluorescein diacetate acetyl ester (CM-H2DCFDA) as described by Wang and Joseph (1999) with minor modifications. Briefly, cells were washed three times with Krebs– Ringer–Hepes (KRH) buffer pH 7.4 (115 mM NaCl, 5 mM KCl, 1 mM MgSO4, 2 mM CaCl2 1 mM KH2PO4 and 25 mM Hepes) at room temperature and loaded with 200 μM H2DCFDA or 20 μM CMH2DCFDA and incubated for 30 min. The cells were then washed three more times before addition of exposure solutions prepared in KRH buffer. After incubating 1 h at room temperature on a rotating table, the fluorescence was read at 485–530 nm (excitation-emission).

433

determined from the threshold cycle (Ct) value and the slope of the standard curves, after normalisation to the amount of the control gene β-actin. Stability of β-actin cycle threshold (Ct) value was controlled across the different exposure groups. No significant differences were found, with exception of 96 h exposure to 100 µM and 300 µM paraquat (data not shown). Data from these specific exposures was consequently removed from the gene expression data set. 2.9. Statistics and graphical treatment Data were standardised to the control for each exposure and endpoint to minimise effects from using different fish. Untransformed ratios were then tested against control using a two-tailed t-test (Sokal and Rohlf, 1981) under H0: “no difference between groups”. Level of significance for rejection of H0 was set to 0.05.

2.7. Total and oxidized glutathione Total and oxidized glutathione measurements were performed by the Glutathione reductase enzymatic recycling assay, as described by Baker et al. (1990). For this application cell lysate was obtained by aspiration of culture medium and addition of 50 μL 5% SSA to cells in 24 well plates followed by one freezing–thawing cycle to lyse the cells. Samples were kept on ice until the point of analysis. 10 μL of the lysates were used directly for tGSH measurements, while 30 μL was subjected to analysis of oxidized GSH. Samples for measurement of oxidized GSH were incubated with 2 μL of 2-vinylpyridine (45 min, room temperature). All samples were then transferred in triplicates to microtiter plates prior to addition of room temperated 200 μL reaction buffer containing 0.1 M Na–PO4, 143 mM EDTA, 0.08 mM dithio-nitrobenzoic-acid, and 0.25 mM NADPH. Finally 40 μL of 0.1 U glutathione reductase/mL was added, the solutions mixed, and absorbance at 405 nm was monitored for 2 min in a plate spectrophotometer. 2.8. Gene expression Total RNA was isolated and DNAse treated using the E.Z.N.A mini kit and RNase free DNAse kit, both from Omega Bio-tek (Norcross, GA, USA). The RNA was quality controlled both by formaldehyde gel electrophoresis and photometrically by 260/280 nm ratio (data not shown). RNA was then reverse transcribed using High capacity cDNA archive kit (Applied Biosystems, Foster City, CA, USA), before being assayed in an absolute quantification protocol by realtime PCR (ABI 7500, Applied Biosystems). Primer sequences for SOD, CAT and GSH-Px were obtained from previous work of Olsvik et al. (2005), whereas primers for β-actin, GSSG-R, GCS and thioredoxin were designed with PrimerExpress software (Applied Biosystems), using Genbank EST sequences as template. Testing of primers included agarose gel electrophoresis and SYBRgreen melting curve analysis of amplicons. Primers are listed in Table 1. 25 μL Supermix with ROX (BioRad, Hercules, California, USA) PCR reactions were run in triplicate and each reaction contained cDNA from 50 ng of RNA and 300 pmol forward/ reverse primer. Standard curves were run on 200, 100, 25 and 12.5 ng cDNA, and relative expression compared to the control was then

3. Results Screening for intracellular ROS formation using the H2DCFDA probe following 1 h exposure to CuSO4 showed a dose dependent increase of ROS (Fig. 1A). At the 60 μM exposure, ROS formation was increased to a median of 300% compared to control. The CM-H2DCFDA probe also showed a significant induction of ROS formation, but the median response was approximately 150% compared to control, suggesting a higher sensitivity of the H2DCFDA probe. Following exposure to paraquat, no increase of ROS formation could be observed for the tested concentrations (0.3–3000 μM) when measured by either of the two probes (Fig. 1A). Exposure of the cells to the environmental sample (SPE extract of produced water) significantly induced ROS formation by a median of 150% compared to control, as measured by the H2DCFDA probe, but no enhanced ROS formation could be detected by the CM-H2DCFDA probe (Fig. 1A). Total glutathione measurements showed trends of depletion for 24 h exposure to both model compounds and the environmental sample, whereas intracellular GSSG was increased (Fig. 1B). Changes of expression levels of antioxidant enzymes were also recorded, such as a median induction of GSH-Px (148% compared to control) resulting from 180 μM CuSO4 exposure, and GCS (239% compared to control) resulting from 100 μM paraquat (Fig. 1C). Membrane integrity measurements indicated a significant dose-dependent decrease of viability, which is shown for 48 h exposure in Fig. 1D. An exposure to 600 μM of CuSO4 resulted in approximately 80% viability compared to control, whereas exposure to 300 μM paraquat resulted in 85% viability. Exposure of the cells to the concentrated environmental sample reduced cell viability to a median of approximately 80% for the 100-fold concentrated sample. Assessment of metabolic activity resulted in responses similar to membrane disruption, but interestingly, exposure to 300 μM paraquat resulted in a reduction to approximately 50% of control after 48 h of exposure (Fig. 1D), which indicate higher sensitivity for assessment of metabolic activity compared to membrane integrity. For CuSO4 and the environmental sample, there were only minor differences between the two cytotoxicity endpoints. Results were collected following 6, 24, 48 and 96 h of exposure. Generally, the

Table 1 Primer sequences (5′-3′) for singleplex real-time PCR. Transcript

EST acc. no.

Forward primer

Reverse primer

SOD CAT GSH-Px GSSG-R GCS Thioredoxin Β-actin

BG936553 BG935638 BG934453 BG934480 CA050524 CA054594 AF012125

CCACGTCCATGCCTTTG CCGACCGTCCGTAAATGCTA GATTCGTTCCAAACTTCCTGCTA CACCAGTGATGGCTTTTTT TGATGGACAACACATTCATTAATTGA ACCGTGCAGCCTAGAATGCT TACCACCGGTATCGTCATGGA

TCAGCTGCTGCAGTCACGTT GCTTTTCAGATAGGCTCTTCATGTAA GCTCCCAGAACAGCCTGTTG ATATCCGGCCCCCACTATG GCGATGCCCGGAACTTATT GTGATGTCTCTCTTTGCAGTTCCTT CGTAGTCCTCGTAGATGGGTACTGT

434

E. Farmen et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 431–438

Fig. 1. Oxidative stress biomarker responses in rainbow trout hepatocytes following exposure to CuSO4, paraquat, and a complex environmental sample. A) Intracellular ROS formation, B) total and oxidized glutathione, C) expression of antioxidant enzymes glutathione peroxidase (GSH-Px) and γ-glutamyl-cysteine synthetase (GCS) and D) cytotoxicity, expressed as membrane integrity and metabolic inhibition. The results (median with interquartile range) depict data from 3 different cell populations. Asterisks indicate statistically significant difference from the control group (*p < 0.05 , **p < 0.01).

cytotoxicity of each concentration increased with exposure time. Further results from the biomarker effects were evaluated at sub-lethal concentrations or exposure times of 6 or 24 h. An overview of the results, including time and dose–response relationships of the different endpoints is shown in Tables 2 and 3, respectively. Both CuSO4 (60 μM) and PQ (30 μM) exposure resulted in a depletion of tGSH after 96 h of exposure (Table 2). This depletion was accompanied by decrease in cellular metabolic activity. GSSG was significantly increased compared to control already after 6 h exposure to the pro-oxidants. Effects of the exposure could also be detected at the level of antioxidant enzyme expression. When normalized to beta-actin, γ-glutamyl-cysteine synthetase were up-regulated following 24 and 48 h exposure to PQ, but down-regulated following 48 and 96 h exposure to CuSO4. Catalase mRNA was down-redulated after 24 and 48 h PQ exposure, whereas SOD was up-regulated after 48 and 96 h of

PQ exposure. Up-regulation of SOD was also observed after 6 h CuSO4 exposure. GSH-Px was down regulatet after 48 and 96 h CuSO4 exposure, and GSSG-R was down-regulated after 24, 48 and 96 h. Thioredoxin was up-regulated after 24 h PQ exposure, but downregulated following 24–96 h CuSO4 exposure. Exposure to an environmental sample resulted in increased amounts of GSSG and up-regulated SOD expression across 6–96 h, in addition to up-regulated GSH-Px and thioredoxin in 6 and 24 h samples. When focusing at a fixed exposure time and evaluating the different concentrations of each of the prooxidants, several interesting effects were observed (Table 3). Following paraquat exposure GCS was up-regulated in the 30, 100 and 300 µM treatments, and GSH-Px was up-regulated in the 30 and 300 µM treatments. These transcripts were also found induced following CuSO4 exposure; 157% of control for GSH-Px in 60 μM CuSO4 treatment, and 177% for GCS in 600 μM CuSO4 treatment.. Additionally, tGSH were

E. Farmen et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 431–438

435

Table 2 Median temporal response (quartiles indicated in brackets) for selected biomarkers of oxidative stress in hepatocytes during 6–96 h. The cells were exposed to the model compounds Paraquat (30 μM), CuSO4 (60 μM) and a complex environmental sample (100-fold concentrated). Relative expression of antioxidant enzymes were normalized to the control gene β-actin. 6h Paraquat

CuSO4

Env. sample

Membrane integrity Metabolic activity tGSH (%) GSSG (%) Catalase Superoxide dismutase Glutathione peroxidase Glutathione reductase γ-glutamyl-cysteine synthetase Thioredoxin Membrane integrity Metabolic activity tGSH (%) GSSG (%) Catalase Superoxide dismutase Glutathione peroxidase Glutathione reductase γ-glutamyl-cysteine synthetase Thioredoxin Membrane integrity Metabolic activity tGSH (%) GSSG (%) Catalase Superoxide dismutase Glutathione peroxidase Glutathione reductase γ-glutamyl-cysteine synthetase Thioredoxin

91.6 91.0 109.1 151.2** 102.7 88.7 118.6 119.1 117.4 112.2 95.3 98.5 97.4 140.1* 108.9 120.9* 141.7 125.2 112.0 94.8 94.7 95.5 100.6 210.1* 94.3 181.7* 211.5* 127.1 147.8 146.1**

24 h (87.2-100.2) (87.0-92.8) (101.3-114.9) (141.6-183.5) (74.4-113.4) (69.0-95.6) (107.8-139.9) (100.3-165.0) (104.6-122.8) (88.7-124.7) (87.7-99.5) (96.4-99.8) (79.9-102.6) (133.9-246.0) (58.2-125.0) (107.8-182.3) (112.2-255.6) (61.3-145.3) (92.1-131.4) (82.7-108.5) (85.1-106.7) (91.4-99.4) (98.9-111.0) (100.9-268.2) (65.5-127.1) (113.5-738.3) (137.0-348.5) (84.3-180.1) (107.7-189.2) (124.2-207.3)

98.4 96.2 131.5 132.3 59.9* 72.7* 75.4 104.7 142.9* 111.9* 95.8 107.7 120.7 448.2 86.2 99.5 114.6 49.0* 122.7 62.5* 68.5 91.4 62.9** 160.2** 91.8 209.8** 172.8* 152.1 162.0 335.7**

48 h (97.1-100.0) (92.9-101.8) (87.8-143.5) (100.0-177.9) (37.5-74.1) (71.1-89.2) (59.6-105.8) (87.3-126.3) (60.3-150.0) (91.9-162.7) (91.5-99.2) (104.6-117.6) (26.0-130.1) (40.1-702.4) (59.6-116.7) (60.2-110.8) (104.1-128.7) (34.7-60.0) (98.8-169.4) (32.9-90.5) (62.7-72.9) (89.4-96.3) (56.9-90.6) (148.4-184.9) (49.7-242.9) (117.8-533.7) (161.0-246.5) (78.8-202.0) (90.8-258.4) (108.7-467.4)

96.7 94.8 101.2 184.1 71.5* 121.3* 97.1 66.4 161.2* 137.8 98.0 115.8 120.5 695.7 86.4 90.6 64.9** 55.8* 53.9* 43.0** 84.3 98.8 101.0 284.6** 65.1 194.6** 93.4 46.4 41.8 138.8

96 h (87.6-104.0) (89.6-102.3) (79.5-124.7) (66.9-1223.7) (50.4-89.4) (106.9-136.6) (89.2-98.7) (47.6-182.5) (104.2-187.4) (69.4-172.8) (94.2-98.9) (108.0-118.0) (12.3-136.7) (22.7-849.2) (33.0-123.8) (53.2-98.5) (49.5-71.7) (14.0-66.3) (40.2-84.9) (16.2-58.3) (73.9-86.9) (98.0-99.5) (90.6-113.5) (228.0-420.8) (27.1-135.8) (135.1-218.4) (82.6-94.4) (45.3-129.5) (25.6-109.5) (81.5-162.5)

72.3 (53.5-92.8) 66.5 (48.1-85.4) 12.3** (10.8–26.9) 100.3 (67.8-115.0) 30.4 (21.2-72.1) 135.2** (116.9-166.2) 119.1 (112.2-122.7) 65.3 (54.9-98.7) 115.2 (98.2-119.9) 123.5 (117.1-160.2) 61.3 (50.0-73.4) 53.6 (40.4-66.2) 9.4** (8.8-34.6) 40.9 (14.2-193.0) 29.4 (10.4-518.9) 63.1* (37.8-102.5) 48.8* (23.9-73.7) 36.9** (30.2-57.0) 51.0** (44.3-53.4) 50.4** (34.5-61.9) 79.9 (75.3-81.9) 105.3 (102.0-110.4) 124.6** (117.4-151.9) 630.3** (183.0-652.0) 499.2* (177.3-516.3) 238.7** (173.6-405.0) 145.0** (143.4-185.1) 62.7 (35.6-86.4) 61.3* (37.6-86.5) 144.3 (140.7-165.5)

Asterisks indicate statistically significant difference from the control group (*p < 0.05, **p < 0.01).

observed to be depleted following exposure to 180 and 600 µM CuSO4, whereas GSSG were elevated throughout the concentration span tested. Results following exposure to the environmental sample showed effects in many of the same parameters as for model compound exposure. tGSH were depleted and GSSG levels increased in exposure to 100-fold concentrated extract. In addition, the environmental sample significantly suppressed the expression of CAT compared to control, whereas the expression of GSH-Px, and GCS was increased. 4. Discussion Due to the proposed link between oxidative stress and early stages of cancer development, biomarkers of oxidative stress have been investigated and applied by others (Ahmad et al., 2006; Almroth et al., 2005; Hansen et al., 2006a; Hansen et al., 2006b). Antioxidant enzymes such as CAT and SOD have been especially well characterized, since they contribute directly to ROS elimination. Other components of the antioxidant system that have been attributed central roles in reducing oxidative stress are the glutathione (glutathione/glutathione peroxidase) and the thioredoxin systems (thioredoxin/thioredoxin reductase). These systems have complementary and sometimes overlapping roles in cellular protection (Casagrande et al., 2002) by maintaining the cellular redox status. To evaluate different components of these two systems and to achieve in depth understanding of the state of oxidative stress, a broad range of biomarker responses were included in the current study. The different parameters were intended to reflect a spectrum of cellular events, starting from ROS production, elimination, and cellular protection at different levels. Results from applying the ROS activated fluorescent probes H2DCFDA and CM-H2DCFDA in cells exposed to the pro-oxidant CuSO4, showed increase in intracellular ROS formation following 1 h exposure.. At a nominal concentration of 6 µM CuSO4, the ROS formation measured by H2DCFDA was more than 2-fold higher than control, with an increase of

up to 3-fold induction at 60 µM. This response seemed to be in accordance with previous work with this probe, such as an approximate 1.5-fold ROS induction by low µM concentrations of Cu in experiments with gill cells from rainbow trout (Bopp et al., 2008). H2DCFDA was indicated to be the more sensitive of the two fluorescent probes used in the current experiment. After 60 µM CuSO4 exposure, both probes indicated increased ROS formation, but the response measured by H2DCFDA was approximately twice as high compared to that of CM-H2DCFDA. Similar observations have been reported by Hempel et al. (1999), and the difference between the two probes was shown to be related to higher efficiency in the loading process. For paraquat exposure ROS induction could not be detected at the concentration interval 0.3–3000 µM with any of the two probes. This was somewhat surprising, because ROS formation has previously been detected by H2DCFDA in paraquat exposed carp cells (Ruiz-Leal and George, 2004). However, even if ROS formation caused by PQ could not be detected in the current study, effects seen on other endpoints at longer exposure times indicated that PQ indeed were causing effects consistent with oxidative stress. The glutathione measurements were performed with the rationale to discover subsequent effects of ROS formation. Results for tGSH showed a large degree of variation in responses between individual cell isolations, but a significant dose dependent depletion following 24 h exposure to CuSO4 was clearly identified. For PQ, no significant time or dose response pattern could be recognized, but after exposure for 96 h, depletion of tGSH was apparent even here. Oxidized glutathione were increased at 6 h following 30 µM paraquat and 60 µM CuSO4 exposure. The oxidation of GSH following pro-oxidant exposure was in line with observations reported in a hepatic fish cell line exposed for 24 h to 500 µM CuSO4 (Rau et al., 2004). Furthermore, a recent study showed that 24 h exposure to both CuSO4 (∼800 µM) and PQ (2700–28,000 µM) caused depletion of GSH in two different fish cell lines (Jos et al., 2009). The concentrations used in the current experiment were lower than the two mentioned studies, which may indicate greater sensitivity of primary

436

E. Farmen et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 431–438

Table 3 Median dose–response (quartiles indicated in brackets) for selected biomarkers of oxidative stress in hepatocytes following exposure to the model compounds, CuSO4 and a complex environmental sample (100 L/L medium. Results shown for metabolic activity, tGSH, GSSG, CAT, and GCS, were from experiments where cells were exposed for 24 h. SOD, GSH-Px, GR and thioredoxin data were from experiments where cells were exposed for 6 h. Relative expression of antioxidant enzymes were normalized to the control gene β-actin. 30 μM Paraquat

Membrane integrity Metabolic activity tGSH (%) GSSG (%) Catalase Superoxide dismutase Glutathione peroxidase Glutathione reductase γ-glutamyl-cysteine synthetase Thioredoxin

CuSO4

Membrane integrity Metabolic activity tGSH (%) GSSG (%) Catalase Superoxide dismutase Glutathione peroxidase Glutathione reductase γ-glutamyl-cysteine synthetase Thioredoxin

Env. sample

Membrane integrity Metabolic activity tGSH (%) GSSG (%) Catalase Superoxide dismutase Glutathione peroxidase Glutathione reductase γ-glutamyl-cysteine synthetase Thioredoxin

91.6 96.2 129.4 149.7 74.1 93.0 113.1* 124.5 150.0* 108.7

100 μM (87.2–100.2) (92.9–101.8) (89.1–149.3) (117.1–160.3) (64.6–101.6) (88.1–104.5) (107.8–138.3) (100.3–137.7) (60.3–212.0) (88.7–119.3)

60 μM 95.8 107.7 114.9 448.4 100.5 100.5 156.7* 121.0 148.0 94.5

96.6 98.3 112.3 223.4 88.6 110.6 107.3 127.9 239.0** 113.3

300 μM (94.8–99.2) (88.5–104.5) (50.6–127.7) (79.6–243.8) (55.3–116.5) (102.6–122.4) (104.1–154.5) (96.2–155.1) (130.4–306.6) (106.4–125.9)

180 μM (91.5–99.2) (104.6–117.6) (25.9–137.5) (36.1–692.5) (59.6–121.9) (59.6–121.9) (106.2–216.9) (62.5–181.3) (88.2–169.4) (86.8–108.5)

98.9 106.8 60.3* 360.3 114.0 114.0 138.5* 107.2 125.0 103.9

89.7 79.2 93.1 273.4 85.3 99.6 142.8** 145.2 135.0** 137.8**

(77.1–103.6) (73.3–86.0) (19.5–103.1) (32.2–2106.7) (62.3–106.1) (92.0–114.6) (123.2–181.8) (115.9–205.6) (128.0–169.8) (106.4–139.0)

600 μM (92.0–106.7) (105.5–107.3) (13.8–82.5) (18.4–980.7) (70.7–165.3) (70.7–165.3) (99.4–164.9) (87.3–128.6) (89.7–158.3) (74.3–126.5)

116.7 86.7 12.6** 496.4 96.2 96.2 98.4 97.9 176.9** 91.6

(100.2–122.7) (80.3–92.0) (10.3–32.5) (15.3–647.9) (62.2–125.9) (62.2–125.9) (80.2–102.5) (72.4–138.6) (146.8–370.5) (77.7–119.7)

10-fold concentrated

30-fold concentrated

100-fold concentrated

83.7 91.4 82.0 87.0** 42.4* 157.7 292.1** 99.8 132.0* 110.3

87.9 89.1 91.6 84.3** 60.3 168.8 314.2** 107.1 211.9** 111.6

68.5 (62.7–72.9) 77.8 (74.3–81.3) 62.9** (56.9–90.6) 160.2** (148.4–184.9) 57.6* (43.3–71.6) 187.9 (118.7–195.9) 282.7** (157.4–379.3) 94.7 (89.4–111.1) 46.9** (34.7–70.2) 146.1**(124.2–207.3)

(80.9–85.8) (89.4–96.3) (76.4–102.3) (78.8–92.7) (39.7–80.5) (87.6–191.4) (208.1–326.5) (82.3–136.5) (104.7–174.5) (91.6–123.6)

(74.0–98.1) (86.8–90.2) (86.4–106.0) (76.0–91.3) (53.5–76.5) (148.4–236.4) (183.1–405.1) (82.5–137.6) (110.6–307.3) (94.5–117.2)

Asterisks indicate statistically significant difference from the control group (*p < 0.05, **p < 0.01).

hepatocytes compared to continuous fish cell lines. As a complement to glutathione measurements, gene expression of GCS was assayed in these cells. The induction of GCS mRNA following Cu and PQ exposure that was observed in our experiments was in line with previous findings in rainbow trout hepatocytes exposed to paraquat (Finne et al., 2007). In fact, the induction of GCS could be a general response to GSH depleting agents, as supported by non-fish models (Poot et al. 1987; Kawabata et al. 1989; Darley-Usmar et al. 1991). However, since GCS is known to be the rate limiting step in GSH biosynthesis (Meister and Anderson, 1983), a concurrent increase in tGSH should have been expected. This was not observed for either of the pro-oxidants in the current study, but may be explained by processes other than de novo synthesis. For instance, the simultaneous depletion of tGSH and GCS induction could reflect an imbalance between glutathione synthesis and cellular export, with net result of tGSH loss as a result. Concentration of glutathione in the cell medium was not measured to confirm this, but increased GSSG export from liver has been documented after administration of paraquat (Lauterburg et al., 1984). For copper, Freedman et al. (1989) found that a majority of the cytoplasmic copper was complexed to GSH and that this complex was formed prior to metallothionein storage. Furthermore, it was indicated that metal resistant cell strains owe their insensitivity to increases in intracellular GSH and metallothionein (Freedman et al. 1989). It may therefore be speculated that cells with the majority of the GSH pool used for protection against copper exposure will have increased expression of GCS. As additional biomarkers of oxidative stress, gene expression of CAT, SOD, GSSG-R, GSH-Px, and thioredoxin were assessed. The results in Table 3 showed that GSH-Px was expressed at elevated levels already after 6 h exposure to both 60 and 180 µM CuSO4 as well

as 30 and 300 µM PQ. Although extrapolation to in vivo exposed fish was complicated, the induction of GSH-Px was found to be in line with elevated levels of GSH-Px transcripts reported in the liver of trout (Salmo trutta) living in metal polluted areas (Hansen et al., 2006b) or increased GSH-Px activity in trout exposed in vivo to paraquat (Stephensen et al., 2002). The specific responses following exposure of the hepatocytes to the produced water extract showed several similarities to those elicited by the model compounds. Total glutathione was depleted and GSSG was increased following 24 h exposure to 100-fold concentrated produced water. Furthermore, GCS and GSH-Px mRNA levels were up-regulated after exposure to 10 and 30-fold concentrated produced water, and thioredoxin was up-regulated after exposure to 100-fold concentrated extract. Thioredoxin have previously been reported up-regulated to various pro-oxidants in fish (Finne et al., 2007; Sheader et al., 2006). Clear dose–response patterns in tGSH was absent; depletion was observed at 24 h exposure, in contrast to the significant induction seen at 96 h exposure. Interestingly, a similar bi-modal pattern has been reported in rainbow trout in vivo by Steadman et al. (1991) who studied the GSH response after sub-lethal exposure of rainbow trout to a fuel oil. They reported an initial 25–50% depletion of GSH after 3 days, but by day 7 and onwards, the cellular glutathione levels exceeded the reference by 50–100%. Together with the current study, it is clear that both concentration and exposure length, as well as balance between glutathione synthesis and export will determine the response measured at tGSH level. An increase of tGSH levels in hepatocytes exposed to the produced water was also supported by a study screening different oxidative stress parameters in a range of different North Sea produced water samples (Farmen et al., in press MPB).

E. Farmen et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 431–438

For measurements of cytotoxicity, two different assays were used in this work. In most of the exposure scenarios, measurements of membrane integrity and metabolic inhibition seem to result in quite similar responses. However with exposure to paraquat for 24 h (Fig. 1D), a higher sensitivity of Alamar Blue (AB) was clearly demonstrated. Because AB detects disruption of organelle membranes rather than the cellular membrane (which is the case for CFDA-AM), this difference in sensitivity may be explained by the order of onset of the events of toxicity. The disruption of mitochondrial membranes has been shown as a more sensitive measure than disruption of the plasma membrane (Schreer et al., 2005; Tollefsen et al., 2008). The difference of cytotoxicity between the pro-oxidants Cu and PQ, refers to Cu as the more cytotoxic of the two. This effect may be caused by a higher relative dose compared to PQ, or might be explained by differences in toxicokinetics. The latter argument is strengthened by the ROS formation data. Importantly, the lack of clear dose and time responses in some of the parameters presented here may be due to masking effects caused by supra-physiological atmospheric oxygen partial pressure. Untreated in vitro cultured hepatocytes did in fact increase their tGSH content almost 2-fold during a time span of 96 h, and expression of several antioxidant enzymes were induced (Finne et al., 2008). This effect of oxygen partial pressure would clearly affect studies of oxidative stress, such as the current paper, since cells would already be in a state of oxidative stress before the start of pro-oxidant exposure. Several other reports in the literature support the hypothesis of oxidative stress caused by hyperoxygenation (Halliwell, 2003). However, several responses reported herein were in agreement with other studies performed with pro-oxidants in fish, both in vivo and in vitro. In conclusion, model compounds and the environmental sample exerted dose–responsive effects on ROS formation and other parameters of the antioxidant defence system. The different antioxidant enzymes included in the study differed in sensitivity, but GCS and GSHPx seemed to be the most potent markers on the transcription level. Overall, the interplay between the glutathione amounts, its redox status and biosynthesis seemed to give important information concerning the cellular oxidative stress status. GSH-Px seemed to be induced at early stages of oxidative stress, preceding the response of GCS. The different sub-lethal effects reported in this study further show that the environmental sample in fact contains substances that induce oxidative stress to the cells. Similarities in the health consequences between mammals and fish exposed to such compounds might be suggested on the basis of similar metabolism of redox cycling xenobiotics in aquatic organisms (Winston, 1991). This study clearly demonstrates the importance of a multiple endpoint approach when assessing oxidative stress. In conclusion, interpretation of cellular events, such as regulation of antioxidant levels and transcriptional responses might be aided by evaluating early effects such as ROS formation. References Ahmad, I., Pacheco, M., Santos, M.A., 2006. Anguilla anguilla L. oxidative stress biomarkers: an in situ study of freshwater wetland ecosystem (Pateira de Fermentelos, Portugal). Chemosphere 65, 952–962. Almroth, B.C., Sturve, J., Berglund, A., Förlin, L., 2005. Oxidative damage in eelpout (Zoarces viviparus), measured as protein carbonyls and TBARS, as biomarkers. Aquat. Toxicol. 73, 171–180. Baker, M.A., Cerniglia, G.J., Zaman, A., 1990. Microtiter plate assay for the measurement of glutathione and glutathione disulfide in large numbers of biological samples. Anal. Biochem. 190, 360–365. Bopp, S.K., Abicht, H.K., Knauer, K., 2008. Copper-induced oxidative stress in rainbow trout gill cells. Aquat. Toxicol. 86, 197–204. Bus, J.S., Aust, S.D., Gibson, J.E., 1976. Paraquat toxicity: proposed mechanism of action involving lipid peroxidation. Environ. Health Perspect. 16, 139–416. Casagrande, S., Bonetto, V., Fratelli, M., Gianazza, E., Eberini, I., Massignan, T., Salmona, M., Chang, G., Holmgren, A., Ghezzi, P., 2002. Glutathionylation of human thioredoxin: a possible crosstalk between the glutathione and thioredoxin systems. Proc. Natl Acad. Sci. USA 99, 9745–9749. Castaño, A., Gómez-Lechón, M.J., 2005. Comparison of basal cytotoxicity data between mammalian and fish cell lines: a literature survey. Toxicol. In Vitro 19, 695–705.

437

Castaño, A., Bols, N., Braunbeck, T., Dierickx, P., Halder, M., Isomaa, B., Kawahara, K., Lee, L.E., Mothersill, C., Pärt, P., Repetto, G., Sintes, J.R., Rufli, H., Smith, R., Wood, C., Segner, H., 2003. ECVAM Workshop 47. The use of fish cells in ecotoxicology. The report and recommendations of ECVAM Workshop 47. Altern. Lab. Anim. 3, 317–351. Darley-Usmar, V.M., Severn, A., O'Leary, V.J., Rogers, M., 1991. Treatment of macrophages with oxidized low-density lipoprotein increases their intracellular glutathione content. Biochem. J. 278, 429–434. Durell, G., Utvik, T.R., Johnsen, S., Frost, T., Neff, J., 2006. Oil well produced water discharges to the North Sea. Part I: comparison of deployed mussels (Mytilus edulis), semi-permeable membrane devices, and the DREAM model predictions to estimate the dispersion of polycyclic aromatic hydrocarbons. Mar. Environ. Res. 62, 194–223. Farmen E., Hylland K., Harman C., Tollefsen K.E., in press. Produced water extracts from North Sea oil production platforms result in cellular oxidative stress in a rainbow trout in vitro bioassay. Mar Poll Bull. doi:10.1016/j.marpolbul.2010.01.015. Finne, E.F., Cooper, G.A., Koop, B.F., Hylland, K., Tollefsen, K.E., 2007. Toxicogenomic responses in rainbow trout (Oncorhynchus mykiss) hepatocytes exposed to model chemicals and a synthetic mixture. Aquat. Toxicol. 81, 293–303. Finne, E.F., Olsvik, P.A., Berntssen, M.H., Hylland, K., Tollefsen, K.E., 2008. The partial pressure of oxygen affects biomarkers of oxidative stress in cultured rainbow trout (Oncorhynchus mykiss) hepatocytes. Toxicol. In Vitro 22, 1657–1661. Freedman, J.H., Ciriolo, M.R., Peisach, J., 1989. The role of glutathione in copper metabolism and toxocity. J. Biol. Chem. 264, 5598–5605. Frenkel, K., 1992. Carcinogen-mediated oxidant formation and oxidative DNA damage. Pharmacol. Ther. 53, 127–166. Halliwell, B., 1994. Free radicals and antioxidants: a personal view. Nutr. Rev. 52, 253–265. Halliwell, B., 2003. Oxidative stress in cell culture: an under-appreciated problem? FEBS Lett. 540, 3–6. Halliwell, B., Gutteridge, J.C.M., 1999. Free Radicals in Biology and Medicine, 3rd ed. Oxford Science Publications. Hansen, B.H., Romma, S., Softeland, L.I., Olsvik, P.A., Andersen, R.A., 2006a. Induction and activity of oxidative stress-related proteins during waterborne Cu-exposure in brown trout (Salmo trutta). Chemosphere 65, 1707–1714. Hansen, B.H., Romma, S., Garmo, O.A., Olsvik, P.A., Andersen, R.A., 2006b. Antioxidative stress proteins and their gene expression in brown trout (Salmo trutta) from three rivers with different heavy metal levels. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 143, 263–274. Harman, C., Thomas, K.V., Tollefsen, K.E., Meier, S., Bøyum, O., Grung, M., 2009. Monitoring the freely dissolved concentrations of polycyclic aromatic hydrocarbons (PAH) and alkylphenols (AP) around a Norwegian oil platform by holistic passive sampling. Mar. Pollut. Bull. 58, 1671–1679. Hasselberg, L., Meier, S., Svardal, A., 2004. Effects of alkylphenols on redox status in first spawning Atlantic cod (Gadus morhua). Aquat. Toxicol. 69, 95–105. Hempel, S.L., Buettner, G.R., O'Malley, Y.Q., Wessels, D.A., Flaherty, D.M., 1999. Dihydrofluorescein diacetate is superior for detecting intracellular oxidants: comparison with 2′, 7′-dichlorodihydrofluorescein diacetate, 5(and 6)-carboxy-2′, 7′dichlorodihydrofluorescein diacetate, and dihydrorhodamine 123. Free Radic. Biol. Med. 27, 146–159. Jos, A., Cameán, A.M., Pflugmacher, S., Segner, H., 2009. The antioxidant glutathione in fish cells lines EPC and GCF-2: response to model pro-oxidants as measured by three different fluorescent dyes. Toxicol. In Vitro 23, 546–553. Kawabata, T., Ogino, T., Awai, M., 1989. Protective effects of glutathione against lipid peroxidation in chronically iron-loaded mice. Biochim. Biophys. Acta 1004, 89–94. Lauterburg, B.H., Smith, C.V., Hughes, H.H., Mitchell, J.R., 1984. Biliary excretion of glutathione and glutathione disulfide in the rat: regulation and response to oxidative stress. J. Clin. Invest. 73, 124–133. Lerner, D.T., Bjornsson, B.T., McCormick, S.D., 2007. Effects of aqueous exposure to polychlorinated biphenyls (Aroclor 1254) on physiology and behavior of smolt development of Atlantic salmon. Aquat. Toxicol. 81, 329–336. Lind, P.M., Milnes, M.R., Lundberg, R., 2004. Abnormal bone composition in female juvenile American alligators from a pesticide-polluted lake (Lake Apopka, Florida). Environ. Health Perspect. 112, 359–362. Liu, C., Yu, K., Shi, X., Wang, J., Lam, P.K., Wu, R.S., Zhou, B., 2007. Induction of oxidative stress and apoptosis by PFOS and PFOA in primary cultured hepatocytes of freshwater tilapia (Oreochromis niloticus). Aquat. Toxicol. 82, 135–143. Livingstone, D.R., 2001. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms. Mar. Pollut. Bull. 42, 656–666. Markesbery, W.R., 1997. Oxidative stress hypothesis in Alzheimer's disease. Free Radic. Biol. Med. 23, 134–147. Meister, A., Anderson, M.E., 1983. Glutathione. Annu. Rev. Biochem. 82, 711–760. Myers, M.S., Johnson, L.L., Hom, T., 1998. Toxicopathic hepatic lesions in subadult English sole (Pleuronectes vetulus) from Puget Sound, Washington, USA: relationships with other biomarkers of contaminant exposure. Mar. Environ. Res. 45, 47–67. Olsvik, P.A., Kristensen, T., Waagbo, R., 2005. mRNA expression of antioxidant enzymes (SOD, CAT and GSH-Px) and lipid peroxidative stress in liver of Atlantic salmon (Salmo salar) exposed to hyperoxic water during smoltification. Comp. Biochem. Physiol. C. 141, 314–323. Perceval, O., Couillard, Y., Pinel-Alloul, B., 2004. Metal-induced stress in bivalves living along a gradient of Cd contamination: relating sub-cellular metal distribution to population-level responses. Aquat. Toxicol. 69, 327–345. Poot, M., Verkerk, A., Koster, J.F., Esterbauer, H., Jongkind, J.F., 1987. Influence of cumene hydroperoxide and 4-hydroxynonenal on the glutathione metabolism during in vitro ageing of human skin fibroblasts. Eur. J. Biochem. 162, 287–291. Rau, M.A., Whitaker, J., Freedman, J.H., Di Giulio, R.T., 2004. Differential susceptibility of fish and rat liver cells to oxidative stress and cytotoxicity upon exposure to prooxidants. Comp. Biochem. Physiol. C. 137, 335–342.

438

E. Farmen et al. / Comparative Biochemistry and Physiology, Part C 151 (2010) 431–438

Ruiz-Leal, M., George, S., 2004. An in vitro procedure for evaluation of early stage oxidative stress in an established fish cell line applied to investigation of PHAH and pesticide toxicity. Mar. Environ. Res. 58, 631–635. Schreer, A., Tinson, C., Sherry, J.P., Schirmer, K., 2005. Application of Alamar blue/5carboxyfluorescein diacetate acetoxymethyl ester as a noninvasive cell viability assay in primary hepatocytes from rainbow trout. Anal. Biochem. 344, 76–85. Sheader, D.L., Williams, T.D., Lyons, B.P., Chipman, J.K., 2006. Oxidative stress response of European flounder (Platichthys flesus) to cadmium determined by a custom cDNA microarray. Mar. Environ. Res. 62, 33–44. Sokal, R.R., Rohlf, F.J., 1981. Biometry. W. H. Freeman, New York. Steadman, B.L., Farag, A., Bergman, H.L., 1991. Exposure related patterns of biochemical indicators in rainbow trout exposed to No. 2 fuel oil. Environ. Toxicol. 10, 365–374. Stephensen, E., Sturve, J., Förlin, L., 2002. Effects of redox cycling compounds on glutathione content and activity of glutathione-related enzymes in rainbow trout liver. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 133, 435–442. Sturve, J., Hasselberg, L., Fälth, H., Celander, M., Förlin, L., 2006. Effects of North Sea oil and alkylphenols on biomarker responses in juvenile Atlantic cod (Gadus morhua). Aquat. Toxicol. 78, S73–S78. Thomas, K.V., Hurst, M.R., Matthiessen, P., Sheahan, D., Williams, R.J., 2001. Toxicity characterisation of organic contaminants in stormwaters from an agricultural headwater stream in south east England. Water Res. 35, 2411–2416.

Tollefsen, K.E., Mathisen, R., Stenersen, J., 2003. Induction of vitellogenin synthesis in an Atlantic salmon (Salmo salar) hepatocyte culture: a sensitive in vitro bioassay for the oestrogenic and anti-oestrogenic activity of chemicals. Biomarkers 8, 394–407. Tollefsen, K.E., Bratsberg, E., Bøyum, O., Finne, E.F., Gregersen, I.K., Hegseth, M.N., Sandberg, C., Hylland, K., 2006a. Use of fish in vitro hepatocyte assays to detect multi-endpoint toxicity in Slovenian River sediments. Mar. Environ. Res. 62, S356–S359. Tollefsen, K.E., Goksøyr, A., Hylland, K., 2006b. Assessment of cytotoxic, CYP1A inducing and estrogen activity in waters from the German Bight and the Statfjord area of the North Sea by a suite of fish in vitro bioassays. Proceedings of the ICES BECPELAG Workshop. Tollefsen, K.E., Blikstad, C., Eikvar, S., Finne, E.F., Gregersen, I.K., 2008. Cytotoxicity of alkylphenols and alkylated non-phenolics in a primary culture of rainbow trout (Onchorhynchus mykiss) hepatocytes. Ecotoxicol. Environ. Saf. 69, 64–73. Utvik, T.I.R., 1999. Chemical characterisation of produced water from four offshore oil production platforms in the North Sea. Chemosphere 39, 2593–2606. Wang, H., Joseph, J.A., 1999. Quantifying cellular oxidative stress by dichlorofluorescein assay using microplate reader. Free Radic. Biol. Med. 27, 612–616. Weisburger, J.H., 2001. Antimutagenesis and anticarcinogenesis, from the past to the future. Mutat. Res. 480–481, 23–35. Winston, G.W., 1991. Oxidants and antioxidants in aquatic animals. Comp. Biochem. Physiol. C. 100, 173–176.