Ozone treatment of conditioned wastewater selects antibiotic resistance genes, opportunistic bacteria, and induce strong population shifts

Science of the Total Environment 559 (2016) 103–112

Contents lists available at ScienceDirect

Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv

Ozone treatment of conditioned wastewater selects antibiotic resistance genes, opportunistic bacteria, and induce strong population shifts Johannes Alexander a, Gregor Knopp b, Andreas Dötsch a, Arne Wieland c, Thomas Schwartz a,⁎ a Karlsruhe Institute of Technology (KIT) - Campus North, Institute of Functional Interfaces (IFG), Microbiology at Natural and Technical Interfaces Department, P.O. Box 3640, 76021, Karlsruhe, Germany b Technische Universität Darmstadt, Institute IWAR, Wastewater Technology, Franziska-Braun-Straße 7, 64287, Darmstadt, Germany c Xylem Services GmbH, Boschstraße 4 – 14, 32051, Herford, Germany

H I G H L I G H T S

G R A P H I C A L

A B S T R A C T

• Ozone treatment selects vancomycinand imipenem-resistant bacteria. • Ozone impact depends on bacterial species. • Strong population shifts in the spectrum of living bacteria. • Ozone treatment reduces bacterial diversity. • Ozone treatment selects bacteria with GC-rich genomes.

a r t i c l e

i n f o

Article history: Received 22 February 2016 Received in revised form 21 March 2016 Accepted 21 March 2016 Available online xxxx Editor: D. Barcelo Keywords: Ozone antibiotic resistance opportunistic bacteria population analysis wastewater

a b s t r a c t An ozone treatment system was investigated to analyze its impact on clinically relevant antibiotic resistant bacteria (ARB) and antibiotic resistant genes (ARGs). A concentration of 0.9 ± 0.1 g ozone per 1 g DOC was used to treat conventional clarified wastewater. PCR, qPCR analyses, Illumina 16S Amplicon Sequencing, and PCR-DGGE revealed diverse patterns of resistances and susceptibilities of opportunistic bacteria and accumulations of some ARGs after ozone treatment. Molecular marker genes for enterococci indicated a high susceptibility to ozone. Although they were reduced by almost 99%, they were still present in the bacterial population after ozone treatment. In contrast to this, Pseudomonas aeruginosa displayed only minor changes in abundance after ozone treatment. This indicated different mechanisms of microorganisms to cope with the bactericidal effects of ozone. The investigated ARGs demonstrated an even more diverse pattern. After ozone treatment, the erythromycin resistance gene (ermB) was reduced by 2 orders of magnitude, but simultaneously, the abundance of two other clinically relevant ARGs increased within the surviving wastewater population (vanA, blaVIM). PCRDGGE analysis and 16S-Amplicon-Sequencing confirmed a selection-like process in combination with a substantial diversity loss within the vital wastewater population after ozone treatment. Especially the PCR-DGGE results demonstrated the survival of GC-rich bacteria after ozone treatment. © 2016 Elsevier B.V. All rights reserved.

1. Introduction ⁎ Corresponding author. E-mail address: [email protected] (T. Schwartz).

http://dx.doi.org/10.1016/j.scitotenv.2016.03.154 0048-9697/© 2016 Elsevier B.V. All rights reserved.

The need for additional wastewater treatment processes to reduce contaminations of adjacent water systems is subject of many

104

J. Alexander et al. / Science of the Total Environment 559 (2016) 103–112

discussions worldwide. The occurrence of newly emerging chemical and microbiological contaminants in the aquatic environment has become an issue of increasing environmental concern. Different wastewater treatment processes were developed to achieve an adequate wastewater quality based on chemical reference values not mentioning the microbiology status. Especially the dissemination of clinically relevant bacteria is of high priority to public health (bathing waters or surface waters containing purified wastewater). Regulations concerning wastewater quality which are currently based on chemical discharges underestimate the risk of a microbiological contamination. Recent studies found increased abundance of clinically relevant antibiotic resistant bacteria in the sediments near the outlets of wastewater treatment plants (WWTPs) and adjacent downstream aquatic habitats (Schwartz et al., 2003; Czekalski et al., 2012; Rizzo et al., 2013). In addition to secondary and tertiary wastewater treatment processes, which were primarily designed to remove nitrogen, well biodegradable organic compounds, ammonia, nitrate, phosphate, another treatment step is needed to efficiently reduce micropollutants and microbiological contaminants. Ozonation is an efficient process to remove organic micropollutants and also considered adequate to reduce or inactivate pathogens via in situ production of highly reactive radicals (e.g.Dodd, 2012; Zimmermann et al., 2011; Hollender et al., 2009; Lüddeke et al., 2014; Zhuang et al., 2014). The disinfection mechanism includes the destruction of the bacterial cell walls followed by leakages of cellular constituents out of the cell, damages of nucleic acids (breaking aromatic structure), and disruption of carbon-nitrogen bonds of proteins leading to depolymerization. The efficiency of inactivation depends on the susceptibility of the target organism, contact time, and concentration of the radicals. Concerns about toxic effects of emerging transformation products on aquatic and terrestrial organisms were recently analyzed by Michael et al. (2013); Ternes et al. (2015), and Funke et al. (2015). Recent studies indicated a removal capacity of only two ARGs (sul1, tetG) with 1.68 and 2.55 log at elevated ozone concentrations of 177.6 mg L-1 (Zhuang et al., 2014). However, selection of only two widespread antibiotic resistance genes is not adequate to discuss the hygienic relevance of the results. Furthermore, the applied ozone concentrations were much higher compared to those of European wastewater plant systems. In addition, a culture-based study showed that antibiotic resistant strains of Escherichia coli, enterococci, and staphylococci are more likely to survive ozonation, in comparison to their respective antibiotic sensitive versions (Lüddeke et al., 2014). Although this study was conducted under real conditions at a German wastewater treatment plant with adequate ozone concentrations, knowledge about the impacts of ozonation on ARBs and ARGs is limited to cultivable bacteria not mentioning the whole wastewater community. A number of studies only covered the impacts of ozone on cultivable indicator bacteria like E. coli, fecal coliform bacteria or fecal streptococci in reals systems or on the pilot scale without taking into account antibiotic resistances (Mezzanotte et al., 2007; Blatchley et al., 2012; Ostoich et al., 2013). Hence, consideration of whole community is very important to assess the load of the aquatic system with clinically relevant ARGs, since a number of ARGs are located on mobile genetic elements, which can pass the species or genus barriers. This horizontal gene transfer contributes to the increasing widespread of antibiotic resistant bacteria in clinics as well as in aquatic environment (Bellanger et al., 2014; Bennett, 2008) Therefore, the present study covers more opportunistic bacteria (enterococci, Pseudomonas aeruginosa, staphylococci, and enterobacteria) together with their clinically relevant ARGs (vanA, blaVIM, ermB, ampC) in extracted DNA from the whole communities before and after ozone treatment as well as subsequent aerated and non-aerated biofilters and granular active carbon filters. Molecular biology methods were used to quantify the target genes in total DNA from the whole bacterial community, which includes the detection of cultivable and

also non-cultivable ARG carriers as well as possible horizontal gene transfer of ARGs via mobile genetic elements. To evaluate the impacts of ozone treatment on the whole bacterial wastewater communities methods were applied to discriminate between living and inactivated bacteria prior to PCR quantification. In addition to the quantification of taxonomic and antibiotic-resistance specific marker genes a whole community analyses (PCR-DGGE and Illumina 16S Amplicon Sequencing) were performed to study selective impacts of ozonation. As a consequence, this study is of far more comprehensive character, the objective being to evaluate the antibiotic resistance situation in natural wastewater populations after ozonation.

2. Experiments Over two years, 48 24h-composite samples of wastewater were analyzed to determine the ARGs and opportunistic bacteria before and after ozone treatment. Samples were taken once every two weeks and were processed immediately for DNA extraction.

2.1. Sampling Locations Different sampling points were chosen to investigate the impact of ozone treatment on the abundance of ARGs and opportunistic bacteria. An ozone treatment system was used to process the final wastewater of the local WWTP (population equivalents 43,000; average sewage quantity 6,400 m3 per day; pH 7.25; COD 21 – 25 mg L-1; NH4\\N 0.14 mg L-1) (Fig. 1). A microstrainer (pore size 10 μm) was installed upstream of the ozone system to reduce the particulate matter for ozone application. The ozone system (WEDECO, type GSO) comprises two bubble columns operating in parallel flow. The ozone was injected in reverse flow by a ceramic-diffusor into the first bubble column. A bubble column is used as reaction chamber. The hydraulic retention time was 18 ± 2 min depending on the flow rate. Ozone concentration was adjusted to 0.9 ± 0.1 g ozone per 1 g DOC according to the dissolved organic carbon (DOC, average 10.0 ± 2.3 mg L-1) present in the wastewater. This ozone concentration was specified by the operation company for further reduction of the organic load of treated wastewater. More than 90% of the contaminants that are marginally affected by conventional wastewater treatment are oxidized by ozonation doses between 0.8 and 1.5 g O3 per g DOC (e.g., diclofenac, carbamazepine, metoprolol) (Prasse et al., 2015; Hollender et al., 2009; Huber et al., 2005; Ternes et al., 2015). Wastewater was sampled downstream of the microstrainer to determine the ARGs and opportunistic bacteria abundance before entering the ozone system, the ozone outlet, and the outlet of the connected four parallel filter systems (aerated and non-aerated biofilter/granulated active carbon (GAC) filter, filtration rate both 4-5 m h-1, empty bed contact time of 25-30 min) (Fig. 1). In case of biofilters expanded clay was used. The filter unit sizes were 4 meters high with a diameter of 19 cm. The filling volumes were 0.113 m3 each.

2.2. Sample Preparation for Molecular Biology Analyses Wastewater samples were filtered using polycarbonate membranes with a diameter of 47 mm and a pore size of 0.2 μm (Whatman Nuclepore Track-Etched Membranes, Sigma-Aldrich, Munich, Germany). Up to 300 mL of conventional and ozone-treated wastewater were filtered for biomass separation. DNA extraction was performed using the Fast DNA spin kit for soil (MP Biomedical, Illkrich, France) utilizing the lysing matrix E and the manufacturer’s protocol for wastewater. The quantities and purities of the DNA extracts were measured by means of the NanoDrop ND-1000 instrument (Peqlab Biotechnology, Erlangen, Germany).

J. Alexander et al. / Science of the Total Environment 559 (2016) 103–112

105

Fig. 1. Organization of wastewater clarification including the investigated pilot scale ozone system and downstream filter settings at the WWTP. Sampling points are indicated at the inlet and outlet of the ozone pilot scale and at the outlets of the filters.

2.3. Propidium Monoazide (PMA) Treatment

2.5. Quantitative PCR Analysis

The protocol is in accordance with that of our previous study (Varela-Villarreal et al., 2013) and based on the publications of Nocker et al. (2007a, 2007b); Nocker and Camper (2009), where the method was optimized also for natural mixed populations. To separate the surviving bacterial population from inactivated bacteria after ozone treatment, the PhAST Blue Photo-Activation System (GenIUL, Barcelona, Spain) was used. After filtration of the wastewater samples, polycarbonate membranes (Nucleopore) were submerged in 300 μL of a 25 μM propidium monoazide (PMA; Biotium, Hayward, California, USA) solution and put into a 1.5 mL colorless tubes (SafeSeal tubes, Carl Roth, Karlsruhe, Germany). After incubation in the dark at 4 °C for 5 minutes, samples were exposed to the LED light of the photoactivation system at 100% intensity for 15 min. After PMA treatment, samples were prepared for DNA extraction using the Fast DNA spin kit for soil according to the manufacturer’s protocol for wastewater.

To quantify the ARGs and genetic markers of opportunistic microorganisms in the bacterial community, a SYBR Green qPCR approach was used. Reactions were run in volumes of 20 μL, containing 10 μL KAPA SYBR FAST Abi Prism 2x qPCR Master Mix (peqlab, Erlangen, Germany), 7 μL of nuclease-free water (Ambion, Life technologies, Karlsbad, Germany), 1 μL of the respective primers (final concentration 0.25 μM, Table 1), and 1 μL of template DNA (30 ng μL-1). Each sample was measured 3 times. The qPCR protocol comprised 3 minutes at 95 °C for activation of the DNA polymerase, followed by 40 cycles of 15 seconds at 95 °C and 30 seconds at 60 °C for primer annealing and elongation. To determine the specificity of amplification, a melting curve was recorded by raising the temperature from 60 to 95 °C (1 °C every 10 seconds). Data analysis was performed by using the Bio\\Rad CFX Manager software. To calculate the gene copy number of the respective antibiotic resistance gene and taxon-specific gene marker, reference strains carrying the genetic targets of interest were used. Serial dilutions of reference strains were made to determine the correlation between plate count experiments and Ct values. 8 serial dilution suspensions were prepared starting with 108 bacterial cells per mL (optical density OD600nm of 1.0). The data obtained from 5 of the 8 dilution steps were qualified to be used for calculation of the calibration curves. Using these curves, the measured Ct values of antibiotic resistance genes or taxon-specific gene markers from water samples can be converted into cell equivalents (Schwartz et al., 2006; Alexander et al., 2015).

2.4. Target Bacteria and Antibiotic Resistance Genes The abundance of methicillin-resistant staphylococci and CNS was linked to the detection of the methicillin resistance gene mecA. Enterococci are indicators of fecal contamination of water and described to harbor a broad range of ARGs (Zarb et al., 2012; Gagnon et al., 2011). Primers targeting the 23S rDNA were used to investigate the abundance and persistence of enterococci (Enterococcus faecium/ faecalis/casseliflavus) in wastewater before and after ozone treatment. The ampicillin resistance gene is harbored by different Enterobacteriaceae, with sequence homology present in Escherichia coli, Citrobacter freundii, Enterbocter cloacae, and Klebsiella pneumoniae (Schwartz et al., 2003). Apart from being an intrinsic ARG, ampC was frequently reported to be located on mobile genetic elements capable of transfer between different bacteria (Philippon et al., 2002; Amador et al., 2015). For this reason, it was used as taxonomic and ARG parameter. Erythromycin-resistant Streptococcus pneumoniae is a major cause of respiratory tract infection worldwide and ermB is located on different mobile genetic elements (Okitsu et al., 2005; Villaseñor-Sierra et al., 2012). Due to its importance to human health, the abundance of ermB in the bacterial community in wastewater was investigated before and after ozone treatment.

2.6. Cell Equivalent Calculation of Opportunistic Bacteria and Antibiotic Resistance Genes The abundances of ARGs and opportunistic bacteria were quantified in each water sample. At first, the abundances of gene targets were analyzed prior and after ozone treatment by qPCR in 100 ng total DNA extracted from water samples. For the quantification of the ARGs blaVIM and vanA a standard PCR was performed because of interferences in the specific amplification of the vanA and blaVIM in the qPCR. Densitometry (Light Units, LumiImager Working station, Lumi Analyst Software) was measured to quantify the abundances of vanA and blaVIM in contrast to the otherwise used Ct values of the qPCR. Reference bacteria carrying the respective ARGs were used to correlate the abundance of a specific ARG or of taxon-specific sequences

106

J. Alexander et al. / Science of the Total Environment 559 (2016) 103–112

Table 1 List of primer used to detect opportunistic bacteria, antibiotic resistance genes, and to amplify 16S rDNA fragments for population analysis. Target

Gene

Name

Sequence

Amplicon

Accuracy (R2)

Reference

Microorganisms Enterococci

23S rDNA

0.9981

Volkmann et al. (2004)

mecA

91 bp

0.9987

Volkmann et al. (2004)

Enterobacteriaceae

ampC

66 bp

0.9891

Volkmann et al. (2004)

Pseudomonas aeruginosa

ecfX

AGAAATTCCAAACGAACTTG CAGTGCTCTACCTCCATCATT CGCAACGTTCAATTTAATTTTGTTAA TGGTCTTTCTGCATTCCTGGA GGGAATGCTGGATGCACAA CATGACCCAGTTCGCCATATC AGCGTTCGTCCTGCACAAGT TCCACCATGCTCAGGGAGAT

93 bp

Staphylococci

ECST784F ENC854R mecA1FP mecA1RP Lak2FP Lak1RP ecfXRT-F ecfXRT-R

81 bp

0.9972

Clifford et al. (2012)

Target

Name

Sequence

Amplicon

Accuracy

Reference

Antibiotic resistance gene Vancomycin vanA resistance Imipenem blaVIM resistance Erythromycin ermB resistance

Gene

vana3FP vana3RP vim1FP vim1RP ermB-F ermB-R

CTGTGAGGTCGGTTGTGCG TTTGGTCCACCTCGCCA CCTCCATTGAGCGGATTCA GCCGTGCCCCGGAA TGAATCGAGACTTGAGTGTGCAA GGATTCTACAAGCGTACCTT

64 bp

0.9936

Volkmann et al. (2004)

61 bp

0.9807

Volkmann et al. (2004)

71 bp

0.9798

Alexander et al. (2015)

Target

Name

Sequence

GC27F⁎ 338R 518R

AGAGTTTGATCCTGGCTCAG CTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG

Gene

PCR-DGGE and 16S Amplicon Sequencing Ribosomal DNA 16S rDNA

Reference

332 bp 509 bp

Muyzer et al. (1993) Varela-Villarreal et al. (2013)

⁎ GC-clamp: CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCGCCCCCGCCCC for PCR-DGGE analyses

determined by qPCR or standard PCR to the amount of the corresponding colony-forming unit (CFU) of the target bacteria (Supporting information Figs. 1 and 2). The coefficient of determination of all standard curves was above 0.979 in all experiments (Table 1), indicating minimal variability within the linear data range. The numbers of target genes in each wastewater sample were derived using the corresponding calibration curve and normalized per 100 ng of total isolated DNA (cell equivalents per 100 ng DNA). Hence we calculated the relative abundance with respect to the population size rather than the wastewater volume. 2.7. RNA Extracton, PCR Amplification, Denaturing Gradient Gel Electrophoresis (DGGE), and Illumina Amplicon Sequencing To analyze the effect of ozone treatment on the dynamics of the viable bacterial populations in wastewater, an RNA extraction and subsequent Reverse Transcription (RT) reaction, followed by standard PCR amplification, were performed. RNA extraction was carried out using the RNeasy Protect Bacteria Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. Prior to RT reaction, digestion of DNA was accomplished using the TURBO DNA-free™ Kit (Ambion, Life technologies, Karlsbad, Germany) according to the manufacturer’s protocol and controlled by DNA-directed 16S PCR amplification (see below). For subsequent RT reaction, the TaqMan Gold RT-PCR Kit (Applied Biosytems, Life technologies, Karlsbad, Germany) was applied. Solutions were prepared on ice by addition of 5 μL of 10x TaqMan RT buffer, 11 μL of MgCl2 (25 mM), 10 μL of dNTP mixtures (2.5 mM of each nucleotide species), 2.5 μL of random hexamers (50 μM), 1 μL RNase inhibitor (20 U μL-1), and 1.25 μL MultiScribe Reverse Transcriptase (50 U μL-1). Finally, 400 ng of extracted RNA were added. The Reverse Transcription was performed in a thermocycler with the following temperature profile: 25 °C for 10 min, 48 °C for 30 min, and 95°C for 5 min. Finally, the samples were cooled at 4 °C prior to PCR. PCR-amplification of the bacterial 16S cDNA was performed using primers GC27F and 518R (Table 1). PCR samples containing approximately equal amounts of PCR product were loaded onto a vertical gel containing acrylamide/ bis-acrylamide with a gradient of urea (40 to 70%) according to Muyzer et al. (1993) and Varela-Villarreal et al. (2013). After gel

electrophoresis the gels were stained with GelRed™ (Biotium) and documented at the LumiImager working station (Roche Diagnostics, Mannheim, Germany). For more extended microbiome analyses, a barcoded Illumina paired-end sequencing method was used to analyze the microbial population of wastewater before and after ozone treatment. Total DNA was extracted from wastewater communities after filtration using the FastDNA Spin Kit for soil according to the manufacturer's instructions. The filter membranes were placed into lysing matrix E tubes containing MT buffer and sodium phosphate buffer. Bacterial cells were lysed in a Fast Prep-24 instrument for 30 s at an intensity setting of 6.0. DNA was eluted in 50 μl of DES solution and quantified using a NanoDrop ND1000 spectrophotometer. The V1-2 region of the 16S rRNA gene was amplified using 27F and 338R primers as described in Camarinha-Silva et al. (2014). The forward primer contains a 6-nt barcode and a 2-nt CA linker. Both primers comprised sequences complementary to the Illumina-specific adaptors to the 5′-ends. Amplification was performed in a total volume of 50 μl with 10x PCR buffer, each containing desoxynucleotides triphosphate at a concentration of 10 mM, each primer at a concentration of 0.4 μM, 1 μl of template DNA, and 0.25 μl HotStarTaq DNA Polymerase (Qiagen, Hilden, Germany). An initial denaturation step of 95 °C for 3 min was followed by 15 cycles of denaturation at 98 °C for 10 s, annealing at 55 °C for 10 s, and extension at 72 °C for 45 s. One microliter of this reaction mixture served as template in a second polymerase chain reaction (PCR) performed under the same conditions as described above, but for 20 cycles using PCR primers designed to integrate the sequence of the specific Illumina-multiplexing sequencing primers and index primers. Non-template controls were performed and free of any amplification products after both rounds of PCR. PCR amplicons were verified by agarose gel electrophoresis and quantified with the Quant-iT PicoGreen dsDNA reagent and kit (Invitrogen, Darmstadt, Germany). Sequencing was carried out using the Illumina MiSeq system (Genome Analytics, Helmholtz Centre for Infection Research, Braunschweig, Germany). Sequences were assigned to operational taxonomic units (OTUs) using the USEARCH algorithm. Taxonomy was made using the RDP classifier. Low-abundance OTUs (b 0.005%) were removed to reduce the number of spurious OTUs.

J. Alexander et al. / Science of the Total Environment 559 (2016) 103–112

3. Results and Discussion Molecular techniques, such as polymerase chain reaction (PCR) and quantitative PCR (qPCR), are very sensitive to detect total DNA present in a sample, including extracellular DNA (eDNA) and DNA coming from live and dead cells. As mentioned before, previous studies demonstrated the applicability of the propidium monoazide (PMA) method for livedead discrimination. Here, quantitative PCR and PCR-DGGE of the eubacterial 16S rDNA fragment were used to test the ability of the PMA treatments to distinguish DNA coming from cells with intact cell membranes in the presence of DNA from dead cells and free genomic DNA. This method was also applied to three months´ old natural biofilms. The examined protocols (PMA concentration, incubations times) were applied with some modifications to the recent studies to compare the abundances of ARGs and opportunistic bacteria from wastewater populations before and after ozone treatment. Additionally, nucleic acids are major targets in bacteria during disinfection processes (UV at 254 nm and ozonation). Due to process-related DNA modifications, PCR-based approaches allow for a direct detection of DNA damage and repair during disinfection (Süß et al., 2009). By applying different primer sets, the correlation between amplicon length and PCR amplification became obvious. The longer the targeted DNA fragment (about 1000 bp) was, the more disinfection-induced DNA lesions inhibited PCR. Since the applied qPCR protocols result in short amplicons lengths (Table 1), analyses without previous PMA treatment, blocking modified DNA from injured or dead bacteria, will underestimate the extent of DNA damage and, hence, disinfection efficiencies. As a consequence, PMA treatment prior to qPCR analyses is an important step for accurate detection and quantification of ARBs and ARGs. The total inactivation ratio of bacteria by ozone treatment was determined using plate count experiments (E. coli and coliforms as well as enterococci). 96% reduction was reached at the ozone outlet (data not shown), which is in accordance with other studies (Lüddeke et al., 2014). The extracted DNA concentrations ranged from 0.5 – 5.5 μg 100 mL-1 in the ozone inflow and 0.4 – 1.7 μg 100 mL-1 in the outflow. The DNA-concentration was determined by spectrophotometry, which did not distinguish between PMA modified and non-modified DNA. The lower DNA concentrations after ozone treatment may also result from DNA degradation by natural nucleases in wastewaters (Okitsu et al., 2005). This effect might be enhanced by the release of intracellular nucleases from ozone-killed bacteria. 3.1. Effect of Ozone Treatment on the Abundance of ARGs and Opportunistic Bacteria 3.1.1. Antibiotic Resistance Genes Wastewater samples were investigated to determine the abundance of ARGs and opportunistic bacteria in the population before and after ozone treatment prior to the subsequent bio- and GAC-filter units. 100 ng total DNA from native water samples were used to normalize genetic targets to investigate their abundance in the population. The majority of bacteria in a wastewater community, however, is uncharacterized and consists of different genetic backgrounds (e.g. multi-copy plasmids) as well as autochthonous bacteria containing ARGs (Vaz-Moreira et al., 2014). For this reason, calibration curves derived from different antibiotic resistant reference bacteria were used for quantification of so-called cell equivalents in mixed populations. Other studies using relative quantification based on 16S rDNA copy number or absolute quantification using plasmid standards are known (Jechalke et al., 2013; Stalder et al., 2014). Normalization to 16S rDNA has some limitations that counteract the quantification of gene targets: (1) there is no correlation between genome size and PCR amplification of 16S rRNA genes from a mixture of bacterial species. As long as these two parameters (genome size and 16S copy number) are unknown for species present in environmental samples, it is impossible to quantify the number of present bacteria (Farrelly et al., 1995);

107

(2) the number of rRNA genes correlates with the rate at which phylogenetically diverse bacteria respond to resource availability rather than the phenotype (Klappenbach et al., 2000); and (3) the genome sizes are more conserved than 16S rRNA copy numbers (1 - 15 copies per genome). Nevertheless, the 16S rRNA still remains the target of choice for studies in bacterial ecology, in spite the multiple and variable 16S rRNA copies within bacterial genomes (Větrovský and Baldrian, 2013). Normalization using plasmid standards also is subject to limitations. According to a recent study supercoiled circular confirmation of DNA appeared to suppress PCR amplification. The authors observed that PCR using circular plasmids as a template increased the threshold cycle number by 2.65 - 4.38 compared to equimolar linear standards (Hou et al., 2010). Hence, restriction of both reference plasmids as well as genomic DNA from natural samples are needed for this normalization approach, which is an additional treatment step prior to qPCR and difficult to control in natural population from wastewaters. For these reasons, calculation of cell equivalents referred to 100 ng DNA extracted from natural wastewaters in this study (Table 2). In addition, calculation of cell equivalents referred also to 100 mL wastewater volume (Table 3). Wastewater samples were collected and investigated over 24 months to characterize the influence of ozone treatment on the antibiotic resistance situation. In total 48 composite samples (24h) were analyzed in triplicates. The vancomycin resistance gene vanA was chosen because of the importance of the vancomycin drug, which is used as a last-resort antibiotic, and because infections with vancomycin-resistant enterococci (VRE) represent a serious problem in healthcare facilities and intensive care units (Zarb et al., 2012; Wardal et al., 2014). In addition, vanA is reported to be located on a highly mobile genetic element (Tn1546) and was found in environmental communities downstream of WWTPs (Varela et al., 2013) as well as in drinking water biofilms (Schwartz et al., 2003). This underlines the importance to reduce the dissemination of vanA via wastewater discharge. The average or the relative abundance of vanA in the influent of the ozone system was 8.4 x 103 cell equivalents per 100 ng DNA with a standard deviation of 3.3 x 103, which indicates a high fluctuation over the course of the investigation (Table 2). The average abundance increased up to 3.4 x 104 cell equivalents per 100 ng DNA (4-fold) in the bacterial population after ozone treatment, with a standard deviation of 1.2 x 104 cell equivalents per 100 ng DNA. The imipenem ARG blaVIM was chosen, because it is reported to be located on Tn402 with a high mobility among K. pneumonia, E. coli, E. cloacae, and P. aeruginosa (Tato et al., 2010). Additionally, the clonal spread of blaVIM in pathogenic bacteria is worrisome (Ikonomidis et al., 2005; Kofteridis et al., 2014). In addition to vanA, the median abundance of the imipenem resistance gene blaVIM, originally detected in P. aeruginosa, was 6.6 x 103 cell equivalents per 100 ng of total DNA in the influent of the ozone treatment system and increased up to 5.1 x 104 (7-fold, Table 2). The ozone treatment did not reduce the abundances of vanA and blaVIM, but was supposed to even select bacteria carrying those resistance genes. Due to the sequence homology of the intrinsic ampC gene within different Enterobacteriaceae and the location of this ARG on mobile genetic elements, ampC was used as taxonomic as well as ARG parameter. The ampicillin resistance gene is harbored by different Enterobacteriaceae, with sequence homology present in Escherichia coli, Citrobacter freundii, Enterbocter cloacae, and Klebsiella pneumoniae (Schwartz et al., 2003). Apart from being an intrinsic ARG, ampC was frequently reported to be located on mobile genetic elements capable of transfer between different bacteria (Philippon et al., 2002; Amador et al., 2015). For this reason, it was used as taxonomic and ARG parameter. Compared to all analyzed ARGs, ampC displayed a stable dissemination in the wastewater population during all sampling periods. After ozone treatment, ampC exhibited no microbiological significant decrease in the population (ozone influent: 3x103 per 100 ng DNA; ozone outflow: 2.7 x 103 per 100 ng DNA, i.e. -9%).

108

J. Alexander et al. / Science of the Total Environment 559 (2016) 103–112

Table 2 Influence of ozone treatment on the relative abundance of antibiotic resistance genes and taxonomic gene markers in 100 ng total DNA extracted from 48 wastewater populations before (Inlet) and after (Outlet) ozone treatment. Abundances and standard deviations (± SD) are displayed and the percentages of changes are given in parenthesis. The median values of each gene target from 48 samples over a period of 2 years are listed. Target

Inlet

Outlet

Changes

Antibiotic resistance gene vanA blaVIM ampC ermB

8.4 x 103 ± 3.3 x 103 6.6 x 103 ± 3.9 x 103 3.0 x 103 ± 7.8 x 102 2.6 x 103 ± 2.5 x 103

3.4 x 104 ± 1.2 x 104 5.1 x 104 ± 1.4 x 104 2.7 x 103 ± 3.7 x 102 2.0 x 101 ± 9.8 x 101

4 fold increase (+405%) 7 fold increase (+764%) reduction (−9%) reduction (−99%)

Taxonomic gene marker Enterococci Staphylococci P. aeruginosa Enterobacteria

2.7 x 104 ± 1.4 x 104 3.4 x 101 ± 1.6 x 101 1.1 x 103 ± 1.8 x 102 3.0 x 103 ± 7.8 x 102

8.5 x 102 ± 4.5 x 102 5.7 x 100 ± 1.0 x 100 1.7 x 103 ± 8.6 x 102 2.7 x103 ± 3.7 x 102

reduction (−98%) reduction (−83%) increase (+43%) reduction (−9%)

Erythromycin-resistant Streptococcus pneumoniae is a major cause of respiratory tract infection worldwide and ermB is located on different mobile genetic elements (Okitsu et al., 2005; Villaseñor-Sierra et al., 2012). Due to its importance to human health, the abundance of ermB in the bacterial community in wastewater was therefore investigated before and after ozone treatment. The ermB gene displayed the highest abundance variation of all investigated ARGs in the wastewater population. The median abundance of ermB per 100 ng of DNA was 2.6 x 103 and decreased down to 2x101 after ozone treatment. While this relative quantification of antibiotic resistance cell equivalents in defined amounts of DNA from whole wastewater populations, the absolute quantification referred to the abundances of targets in a defined volume of wastewaters. In contrast to the relative quantification, the absolute quantification for the vancomycin resistance gene vanA and imipenem resistance gene blaVIM gene resulted in reduction of 49.9% and 18.7%, respectively, after ozonation (Table 3). The residual cell equivalents numbers were still increased for the two gene targets, whereas the ampicillin resistance gene ampC and the erythromycin resistance genes ermB were much strong reduced by ozone treatment (i.e. 69.8% for ampC and 99.3% for ermB). The residual cell equivalents per 100 mL were quantified with 2.3 x 103 cell equivalents for ampC and 1.1 x 102 cell equivalents for ermB. Thus independent from the reference systems significant amounts of bacteria carrying the investigated ARGs will reach the aquatic environments. 3.1.2. Opportunistic-Pathogenic Bacteria Apart from ARGs, the abundance of genetic markers specific of opportunistic bacteria was quantified before and after ozone treatment. Similar to the detection of ARGs, a PMA treatment was applied to exclude injured or dead bacteria. Primers targeting the 23S rDNA were used to investigate the abundance and persistence of enterococci (Enterococcus faecium/ faecalis/casseliflavus) in wastewater before and after ozone treatment. Enterococci are reported to harbor a number of acquired antibiotic

resistance genes (Varela et al., 2013; Ramos et al., 2013). The abundance varied between 1.5 x 103 and 5.5 x 104 cell equivalents per 100 ng total DNA. The enterococci marker displayed the highest removal ratio after ozone treatment of all investigated bacteria (Table 2) and was reduced by almost two orders of magnitude by the ozone treatment (98%). Despite the high reduction of enterococci by ozone, no complete removal was achieved and enterococci were still present in the final outflow. P. aeruginosa is a nosocomial microorganism and adapted to persist and proliferate in the aquatic environment (Otter et al., 2011; Zarb et al., 2012). P. aeruginosa harbors a number of intrinsic clinically relevant ARGs and hosts a high abundance of acquired ARGs (Gad et al., 2007). A species-specific primer targeting the ecfX gene of P. aeruginosa was used to detect the abundance in wastewater before and after ozone treatment (Table 1). The ecfX primer system was chosen due to its higher amplification specificity and performance in qPCR settings compared to the standard 23S rDNA targeting primer system (Clifford et al., 2012). P. aeruginosa is an important nosocomial pathogen that is of relevance to all aquatic habitats and is known to carry resistances against multiple antibiotics (Schwartz et al., 2006, 2015). The abundance of P. aeruginosa in the influent of the ozone treatment system ranged between 1.5 x 102 and 4 x 104 with a median of 1 x 103 cell equivalents per 100 ng of total DNA. In contrast to enterococci, no decline, but an increase in abundance was observed after ozone treatment (42% increase). S. aureus and CNS are major contributors to nosocomial infections and they were found in the final outflow of WWTPs, thus proving that these microorganisms can survive wastewater purification (Schwartz et al., 2003; Otter et al., 2011). Nosocomial infections by methicillinresistant staphylococci (MRSA and CNS) are major problems in human healthcare facilities. Previous investigations revealed MRSA and CNS in wastewater of hospitals and intensive care units (Schwartz et al., 2003; Rizzo et al., 2013; Volkmann et al., 2004). The abundance of methicillin-resistant staphylococci and CNS was linked to the detection of the methicillin resistance gene mecA. After secondary wastewater

Table 3 Influence of ozone treatment on the absolute abundance of antibiotic resistance genes and taxonomic gene markers in 100 mL volume of wastewater samples before (Inlet) and after (Outlet) ozone treatment. Abundances and standard deviations (± SD) are displayed and the percentages of changes are given in parenthesis. The median values of each gene target from 48 samples over a period of 2 years are listed. Target

Inlet

Outlet

Changes

Antibiotic resistance genes vanA blaVIM ampC ermB

8.7 x 104 ± 9.6 x 103 8.7 x 103 ± 3.1 x 103 7.8 x 103 ± 4.1 x 102 1.4 x 104 ± 8.0 x103

4.3 x 104 ± 2.9 x 103 7.1 x 103 ± 2.5 x 103 2.3 x 103 ± 1.3 x 103 1.1 x 102 ± 6.6 x 100

reduction (−49.9%) reduction (−18.7%) reduction (−69.8%) reduction (−99.3%)

Taxonomic gene markers Enterococci Staphylococci P. aeruginosa Enterobacteria

2.5 x 104 ± 1.1 x 104 4.3 x 101 ± 1.2 x 101 7.6 x 103 ± 1.2 x 103 7.8 x 103 ± 4.1 x 102

2.9 x 102 ± 1.7 x 102 9.5 x 100 ± 4.2 x 100 3.0 x 103 ± 1.1 x 103 2.3 x 103 ± 1.3 x 103

reduction (−98.9%) reduction (−78.1%) reduction (−60.2%) reduction (−69.8%)

J. Alexander et al. / Science of the Total Environment 559 (2016) 103–112

clarification, however, only very few methicillin-resistant S. aureus and CNS were detected in the influent of the ozone treatment system (3.4 x 101 cell equivalents per 100 ng total DNA). After ozone treatment, MRSA and CNS concentrations were found to be close to the detection limits of the qPCR system. Similar to the ARGs detection, beside the relative quantification, an absolute calculation of the abundances of opportunistic bacteria were run referred to 100 mL wastewater volume. In accordance to the relative abundance enterococci and staphylococci taxonomic gene markers were strongly reduced with 98.9% and 78.1% (Table 3), whereas the taxonomic genes for P. aeruginosa and enterobacteria were less affected by ozone treatment (60.2% and 69.8%). The calculated residual cell equivalents per 100 mL reaching the downstream aquatic environments are lower than the relative population-based abundances (per 100 ng DNA), but in both cases clinically relevant bacteria were disseminated to the environment. Furthermore, it´s important to consider the high volumes of clarified wastewaters released from the municipal wastewater treatment plants to the environment per day. The bio- and granulated activated carbon filter units (aerated and without aeration) (Fig. 1), which was fed with treated water from ozone pilot scale outlet, displayed limited reductions of antibiotic resistance and taxonomic gene markers in their final outlets. In spite of a high fluctuation of the gene target abundances, the reduction was found to be in maximum 0.2 order of magnitudes (corresponds to ca. -40%) for all filters systems compared to the respective filter inlets (Supporting information Table 1). Not mentioning the very high standard deviations (ranging from 4% to 90%) for all analyzed gene targets it became obvious that the log10 cell equivalents for the taxonomic gene markers of P. aeruginosa and staphylococci were found to be increased in the outlets of aerated GAC filters and in some cases for biofilters. This result was not determined in case of antibiotic resistance gene markers detction. The high standard deviations, which limit the validity of these results, might be due to the biofilm formation and dispersion of particular matter from filter materials. In consequence, antibiotic resistant bacteria are not completely eliminated and, hence, reach the downstream aquatic environment. 3.1.3. Possible Ozone Resistance Mechanisms in Bacteria Quantification of ARGs and opportunistic bacteria in the wastewater population before and after ozone treatment produced a much more differentiated picture than previous lab-scale studies of ozone treatment and bacterial reduction (Zhuang et al., 2014). Our results suggest different levels of robustness or resistance against oxidative stress depending on the bacterial species and/or associated ARGs. It became obvious that ozone treatment affected the abundances of vanA and blaVIM quite differently compared to the ermB resistance gene, which was significantly reduced. Bacteria carrying the vanA or blaVIM resistance gene are observed to be more robust against ozone treatment. Potential transfers of these highly abundant genes, which are triggered by the oxidative stress, explain their high abundances (Gagnon et al., 2011; Tato et al., 2010). The results underline that it is very important to control different clinically relevant antibiotic resistance genes for the evaluation of disinfection measures in wastewater and other aquatic systems. On the other hand, the species-specific quantification revealed different levels of susceptibilities of bacteria, e.g. enterococci (highly susceptible) and P. aeruginosa (minor susceptibility), indicating different levels of bacterial coping mechanisms. The mucoid character of P. aeruginosa with increased production of extracellular polymeric substances (EPS) (Herzberg et al., 2009) might be responsible for the reduced impact of ozonation. Previous studies also revealed a secondary effect of bactericidal antibiotics besides their drug target-specific interaction within bacteria (Kohanski et al., 2007, 2010). These studies used sub-lethal concentrations of bactericidal antibiotics to stimulate the formation of intra-cellular, highly reactive hydroxyl radicals, which contribute to the killing efficiency of bactericidal antibiotics. The induction of oxidative stress by bactericidal antibiotics may induce sub-lethal

109

stress response mechanisms in bacteria that deal not only with the adaptation to the original drug target (antibiotic resistance development), but also activate anti-oxidative mechanisms and oxidative damage-associated responses (e.g. recA response). Bacteria which experienced these stress signals, responded and survived. Therefore, they have a considerable advantage in surviving oxidative wastewater treatments. Vancomycin, imipenem, and also ampicillin are bactericidal antibiotics, but only bacteria carrying vanA and blaVIM showed increased ozone resistance, while the ampicillin resistance gene showed no increase, but a minor reduction (-9%) in the bacterial wastewater population. In addition, erythromycin is a bacteriostatic antibiotic and ermB gene carriers were decreased considerably in the bacterial wastewater population after ozone treatment, which indicated a higher susceptibility to oxidative stress. These findings support the theory of predisposition by bactericidal antibiotics in wastewater compartments (e.g. sewer, activated sludge). Previous studies demonstrated the presence of antibiotics in concentrations of several μg L-1 in the inlets and outlets of WWTPs (Alexander et al., 2015; Michael et al., 2013), not mentioning the presence of transformation products and their impacts on bacteria. In addition, Szabó et al. (2016) described transformation products of antibiotics putting a higher selective pressure on bacteria compared to the original substance. In consequence, advanced wastewater technologies should be potent to degrade antibiotics without generating any critical transformation products having such impacts on bacteria. Besides ozone resistance, other factors may influence the abundance of ARGs in the bacterial population after ozone treatment. The mode of action of the ozone treatment used to ensure hygienic quality in water systems involves inactivation of bacteria by DNA damages (Dodd, 2012). One of the response mechanisms to DNA damage is an induction of horizontal gene transfer (HGT) by the recA system (Fall et al., 2007). The ARGs vanA and blaVIM are located on mobile genetic elements and are reported to be transferable, even between different species (Tato et al., 2010; Guardabassi and Dalsgaard, 2004). The transposon Tn1546, which harbors vanA and other resistance genes, is reported to occur also in environmental enterococci. But the structure of the Tn1546 element cannot be distinguished from those found in humanand animal-associated VRE infections, indicating a possible vanA resistance gene reservoir in the environment. In addition, blaVIM is reported to be located on different Tn402 variants which are predominant among Enterobacteriaceae and P. aeruginosa. However, recent results indicated that various Tn402 elements have the potential for being disseminated in other species due to recombination events (Tato et al., 2010). In addition to the overall inactivation of bacteria in wastewater by ozone treatment (90 - 95%), the release of mobile genetic elements, together with sub-lethally damaged bacteria in the need for DNA repair, may cause ARGs to accumulate in the surviving population. AmpC, by contrast, is not only located on the bacterial chromosome, but also on different types of plasmids (Philippon et al., 2002). Yet, no increase of the ampC abundance was observed in the bacterial population after ozone treatment. 3.2. Population Analysis in the Wastewater after Ozone Treatment Total RNA extractions from wastewater populations were performed before and after ozone treatment to target the living part of natural communities, since the impact of PMA-modified DNA during 16S Illumina Amplicon Sequencing is unknown. The total RNA yields were quantified by spectrophotometry using the Nanodrop technology with 500 ± 100 to 700 ± 230 ng per 100 mL before ozonation and 230 ± 90 ng per 100 mL after ozonation. The target molecule for population analyses was 16S rRNA, which is known to possess a higher stability of several hours to degradation than mRNA that is stable for seconds or minutes (Houseley and Tollervey, 2009). The extracted RNA was treated several times with DNase I and the purities of the RNA samples were tested by 16S rDNA amplification using primers listed in Table 1. In

110

J. Alexander et al. / Science of the Total Environment 559 (2016) 103–112

the absence of any 16S rDNA amplicon, Reverse Transcription was performed. PCR-DGGE analyses were run parallel to 16S Amplicon Sequencing to obtain better insight into the population shifts. While the amplicons from PCR-DGGE were about 500 bp and provided information about the GC-contents of the 16S fragments, the amplicons from 16S Illumina Amplicon Sequencing were much smaller (100 to 150 bp). They provided more taxonomic data on bacteria, if present in the data base, but no further information, such as the GC content. 3.2.1. PCR-DGGE Analyses To investigate the effect of the ozone treatment on the bacterial diversity of the wastewater community, population analysis by PCRDGGE was performed using the 16S rDNA directed primers listed in Table 1. The number of present or absent bands before and after ozone application was analyzed by DGGE separation (Fig. 2) and a pairwise grouping method with mathematical averages utilizing the Dice coefficient. In addition to the significant inactivation of a high number of bacteria by ozone treatment, the RNA-directed method demonstrated the presence of surviving bacteria as well as population shifts and selection-like processes. A similarity index of 0.39 indicated substantial changes in the living part of wastewater communities after the ozone treatment. Furthermore, bacteria with a high GC content in the amplicon of the 16S rDNA fragment were more abundant in the wastewater population of the ozone outflow due to their stronger migration within the gel, while bacteria with a low GC content seemed to be more efficiently reduced by the ozone treatment. The degeneration of DNA by ozone was reported to be thymine- and guaninedependent, because these two nucleotide bases are most susceptible to ozone (Cataldo, 2006). The second-order rate constant for the nucleobase thymine is 3.4 x 104 L mol-1 s-1 in comparison to the guanine base with only 1.6 L mol-1 s-1 (53% slower). Hence, we hypothesize that DNA with a high GC-content is more stable to ozone impacts than thymine/adenine, which is due to their reduced reactivity and to the fact that their DNA structure contains more hydrogen bonds between the nucleotides G and C. For the identification of the surviving bacteria an Illumina 16S Amplicon Sequencing analysis was performed. 3.2.2. Illumina 16S Amplicon Sequence Analysis A total of 315,520 raw sequences were obtained from the Illumina MiSeq sequencing. Following quality filtering, 13361 sequences remained with an average length of 300 bp. The removal of low abundance OTUs (b0.005%) yielded a total of 1021 OTUs in samples of the

Fig. 3. Classification by 16S rRNA Illumina Amplicon Sequencing before and after ozone application. Only those genera containing ≥1% of sequences are displayed.

ozone influent, and 482 OTUs in samples taken in the outlet of the ozone system. The average sequence coverage for all samples was N 95%. The RDP classifier and USEARCH sequence analysis tool was used to assign taxonomy to OTUs from domain to genus level. A shift in the relative abundance of several OTUs after ozone application was observed (Fig. 3). Bacterial diversity was significantly reduced in wastewater samples by more than 50% of all analyzed genera present in the wastewater community, prior to the ozone treatment and decreased to less than 1% abundance after ozone application. In contrast to this, a small fraction of bacteria of low abundance within the wastewater population (1%) was found to have a significant robustness and survived the ozone treatment. This group (Pseudomonas, Oxalobacteriaceae, Variovorax, Massilia, Acidovorax, Methylophilus, and Herminiimonas) represented up to 62% of the vital population in the ozone outflow. In agreement with qPCR results, Illumina 16S Amplicon Sequencing analysis confirmed a strong reduction of enterococci by the ozone treatment and simultaneously a robustness of pseudomonads. According to DGGE analysis, which indicated bacteria with a higher GC content to be more abundant in the wastewater population after ozone application, the robust bacteria, identified by Illumina 16S sequence analysis reached a higher molar G + C ratio of up to 72% in their DNA (Fernandes et al., 2005; Willems et al., 1990). In addition to the GC content, metabolic activity repairing oxidative damage has to be considered and still remains to be investigated in more detail. Both population analyses confirmed that the general mode of bacteria inactivation by ozone varies depending on the bacteria. Hence, it is important to consider appropriate operational and microbiological parameters to evaluate advanced wastewater treatment processes in terms of inactivation ratios. 4. Conclusion

Fig. 2. Three independent population analysis using PCR-DGGE were performed after total RNA extraction and Reverse Transcription. The eubacterial GC27F and 518R primers were used to amplify the V1-V2 variable regions of the 16S rDNA.

Implementation of advanced wastewater cleaning processes in addition to a conventional wastewater treatment is an important step to protect the aquatic environment. Beside a significant overall reduction of bacteria by ozone treatment, molecular biology analyses

J. Alexander et al. / Science of the Total Environment 559 (2016) 103–112

revealed a selection of a robust population including P. aeruginosa. The surviving population is characterized by higher guanine nucleobase contents in their genomic DNA, which is described to be less reactive to ozone treatment than thymine-rich DNA. The different behaviors of the investigated opportunistic bacteria (enterococci, P. aeruginosa) as well as ARGs indicates the need for an adjusted microbiology evaluation concept for treated wastewater to assess the remaining risk for receiving bodies. Antibiotic resistance genes against vancomycin (vanA) and imipemem (blaVIM) were still found to be increased in abundance within the surviving population, whereas other ARGs were still present or reduced. Subsequent filter units demonstrated no further improvement. Hence, the genetic markers for P. aeruginosa and its antibiotic resistance gene directed to imipenem are important parameters for future microbiological risk assessments. Additional modifications or process combinations are needed to increase the bactericidal effect and to improve the hygienization of wastewaters (e.g. higher ozone concentrations/contact time, combinations with UV-light treatment). Alternatively, different AOP technologies (e.g. Photo-Fenton treatment or TiO2 photo-catalysis) should be tested for bacteria elimination efficiencies Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.scitotenv.2016.03.154. Acknowledgement This study is part of the TransRisk project (02WRS1275N) funded by the BMBF within the framework of the RiSKWa project initiative. We thank Prof. Dr. Thomas Ternes for coordinating the TransRisk project. TS supports the COST Nereus Action ES1403. References Alexander, J., Bollmann, A., Seitz, W., Schwartz, T., 2015. Microbiological characterization of aquatic microbiomes targeting taxonomical marker genes and antibiotic resistance genes of opportunistic bacteria. Sci. Total Environ. 512–513, 316–325. Amador, P.P., Fernandes, R.M., Prudêncio, M.C., Barreto, M.P., Duarte, I.M., 2015. Antibiotic resistance in wastewater: occurrence and fate of Enterobacteriaceae producers of class A and class C β-lactamases. J. Environ. Sci. Health A Tox. Hazard. Subst. Environ. Eng. 50 (1), 26–39. Bellanger, X., Guilloteau, H., Bonot, S., Merlin, C., 2014. Demonstrating plasmid-based horizontal gene transfer in complex environmental matrices: a practical approach for a critical review. Sci. Total Environ. 15 (493), 872–882. Bennett, P.M., 2008. Plasmid encoded antibiotic resistance: acquisition and transfer of antibiotic resistance genes in bacteria. Br. J. Pharmacol. 153 (1), 347–357. Blatchley, E.R., Weng, S., Afifi, M.Z., Chiu, H.H., Reichlin, D.B., Jousset, S., Erhardt, R.S., 2012. Ozone and UV254 radiation for municipal wastewater disinfection. Water Environ. Res. 84 (11), 2017–2027. Camarinha-Silva, A., Jáuregui, R., Chaves-Moreno, D., Oxley, A.P., Schaumburg, F., Becker, K., Wos-Oxley, M.L., Pieper, D.H., 2014. Comparing the anterior nare bacterial community of two discrete human populations using Illumina amplicon sequencing. Environ. Microbiol. 16 (9), 2939–2952. Cataldo, F., 2006. DNA degradation with ozone. Int. J. Biol. Macromol. 38 (3–5), 248–254. Clifford, R.J., Milillo, M., Prestwood, J., Quintero, R., Zurawski, D.V., Kwak, Y.I., Waterman, P.E., Lesho, E.P., Mc, Gann P., 2012. Detection of bacterial 16S rRNA and identification of four clinically important bacteria by real-time PCR. PLoS One 7 (11), e48558. Czekalski, N., Berthold, T., Caucci, S., Egli, A., Bürgmann, H., 2012. Increased levels of multiresistant bacteria and resistance genes after wastewater treatment and their dissemination into Lake Geneva, Switzerland. Front. Microbiol. 3, 106. Dodd, M.C., 2012. Potential impacts of disinfection processes on elimination and deactivation of antibiotic resistance genes during water and wastewater treatment. J. Environ. Monit. 14 (7), 1754–1771. Fall, S., Mercier, A., Bertolla, F., Calteau, A., Gueguen, L., Perrire, G., Vogel, T.M., Simonet, P., 2007. Horizontal gene transfer regulation in bacteria as a “Spandrel” of DNA repair mechanisms. PLoS One 2 (10), e1055. Farrelly, V., Rainey, F.A., Stackebrandt, E., 1995. Effect of genome size and rrn gene copy number on PCR amplification of 16S rRNA genes from a mixture of bacterial species. Appl. Environ. Microbiol. 61 (7), 2798–2801. Fernandes, C., Rainey, F.A., Fernanda Nobre, M., Pinhal, I., Folhas, F., da Costa, M.S., 2005. Herminiimonas fonticola gen. nov., sp. nov., a Betaproteobacterium isolated from a source of bottled mineral water. Syst. Appl. Microbiol. 28 (7), 596–603. Funke, J., Prasse, C., Lütke-Eversloh, C., Ternes, T., 2015. A. Oxypurinol - A novel marker for wastewater contamination of the aquatic environment. Water Res. 74, 257–265. Gad, G.F., El-Domany, R.A., Zaki, S., Ashour, H.M., 2007. Characterization of Pseudomonas aeruginosa isolated from clinical and environmental samples in Minia, Egypt: prevalence, antibiogram and resistance mechanisms. J. Antimicrob. Chemother. 60 (5), 1010–1017.

111

Gagnon, S., Lévesque, S., Lefebvre, B., Bourgault, A.M., Labbé, A.C., Roger, M., 2011. VanAcontaining Enterococcus faecium susceptible to vancomycin and teicoplanin because of major nucleotide deletions in Tn1546. J. Antimicrob. Chemother. 66 (12), 2758–2762. Guardabassi, L., Dalsgaard, A., 2004. Occurrence, structure, and mobility of Tn 1546-like elements in environmental isolates of vancomycin-resistant enterococci. Appl. Environ. Microbiol. 70 (2), 984–990. Herzberg, M., Kang, S., Elimelech, M., 2009. Role of extracellular polymeric substances (EPS) in biofouling of reverse osmosis membranes. Environ. Sci. Technol. 15 (12), 4393–4398. Hollender, J., Zimmermann, S.G., Koepke, S., Krauss, M., McArdell, C.S., Ort, C., Singer, H., von Gunten, U., Siegrist, H., 2009. Elimination of organic micropollutants in a municipal wastewater treatment plant upgraded with a full-scale post-ozonation followed by sand filtration. Environ. Sci. Technol. 43 (20), 7862–7869. Hou, Y., Zhang, H., Miranda, L., Lin, S., 2010. Serious overestimation in quantitative PCR by circular (supercoiled) plasmid standard: microalgal pcna as the model gene. PLoS One 5 (3), e9545. Houseley, J., Tollervey, D., 2009. The many pathways of RNA degradation. Cell 136 (20), 763–776. Huber, M.M., Gobel, A., Joss, A., Hermann, N., Loffler, D., McArdell, C.S., Ried, A., Siegrist, H., Ternes, T.A., von Gunten, U., 2005. Oxidation of pharmaceuticals during ozonation of municipal wastewater effluents: a pilot study. Environ. Sci. Technol. 39 (11), 4290–4299. Ikonomidis, A., Tokatlidou, D., Kristo, I., Sofianou, D., Tsakris, A., Mantzana, P., Pournaras, S., Maniatis, A.N., 2005. Outbreaks in distinct regions due to a single Klebsiella pneumoniae clone carrying a blaVIM-1 metallo-β-lactamase gene. J. Clin. Microbiol. 43 (10), 5344–5347. Jechalke, S., Schreiter, S., Wolters, B., Dealtry, S., Heuer, H., Smalla, K., 2013. Widespread dissemination of class 1 integron components in soils and related ecosystems as revealed by cultivation-independent analysis. Front. Microbiol. 4, 420. Klappenbach, J.A., Dunbar, J.M., Schmidt, T.M., 2000. rRNA operon copy number reflects ecological strategies of bacteria. Appl. Environ. Microbiol. 66 (4), 1328–1333. Kofteridis, D.P., Valachis, A., Dimopoulou, D., Maraki, S., Christidou, A., Mantadakis, E., Samonis, G., 2014. Risk factors for carbapenem-resistant Klebsiella pneumoniae infection/colonization: A case-case-control study. J. Infect. Chemother. 20 (5), 293–297. Kohanski, M.A., DePristo, M.A., Collins, J.J., 2010. Sublethal antibiotic treatment leads to multidrug resistance via radical-induced mutagenesis. Mol. Cell 37 (3), 311–320. Kohanski, M.A., Dwyer, D.J., Hayete, B., Lawrence, C.A., Collins, J.J., 2007. A common mechanism of cellular death induced by bactericidal antibiotics. Cell 130 (5), 797–810. Lüddeke, F., Heß, S., Gallert, C., Winter, J., Güde, H., Löffler, H., 2014. Removal of total and antibiotic resistant bacteria in advanced wastewater treatment by ozonation in combination with different filtering techniques. Water Res. 69, 243–251. Mezzanotte, V., Antonelli, M., Citterio, S., Nurizzo, C., 2007. Wastewater disinfection alternatives: chlorine, ozone, peracetic acid, and UV light. Water Environ. Res. 79 (12), 2373–2379. Michael, I., Rizzo, L., McArdell, C.S., Manaia, C.M., Merlin, C., Schwartz, T., Dagot, C., FattaKassinos, D., 2013. Urban wastewater treatment plants as hotspots for the release of antibiotics in the environment: a review. Water Res. 47 (3), 957–995. Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59 (3), 695–700. Nocker, A., Camper, A.K., 2009. Novel approaches toward preferential detection of viable cells using nucleic acid amplification techniques. FEMS Microbiol. Lett. 291, 137–142. Nocker, A., Sossa, K.E., Camper, A.K., 2007a. Molecular monitoring of disinfection efficacy using propidium monoazide in combination with quantitative PCR. J. Microbiol. Methods 70, 252–260. Nocker, A., Sossa-Fernandez, P., Burr, M.D., Camper, A.K., 2007b. Use of propidium monoazide for live/dead distinction in microbial ecology. Appl. Environ. Microbiol. 73, 5111–5117. Okitsu, N., Kaieda, S., Yano, H., Nakano, R., Hosaka, Y., Okamoto, R., Kobayashi, T., Inoue, M., 2005. Characterization of ermB Gene Transposition by Tn 1545 and Tn 917 in macrolide-resistant Streptococcus pneumoniae isolates. J. Clin. Microbiol. 43 (1), 168–173. Ostoich, M., Serena, F., Falletti, L., Fantoni, A., 2013. Control of dangerous substances in discharges and microbiological abatement: European framework and a case study of an ozone disinfection system. Water Sci. Technol. 67 (6), 1238–1246. Otter, J.A., Yezli, S., French, G.L., 2011. The role played by contaminated surfaces in the transmission of nosocomial pathogens. Infect. Control Hosp. Epidemiol. 32 (7), 687–699. Philippon, A., Arlet, G., Jacoby, G.A., 2002. Plasmid-Determined AmpC-Type β -lactamases. Antimicrob. Agents Chemother. 46 (1), 1–11. Prasse, C., Stalter, D., Schulte-Öhlmann, U., Öhlmann, J., Ternes, T.A., 2015. Spoilt for choice: a critical review on the chemical and biological assessment of current wastewater treatment technologies. Water Res. 15 (87), 237–270. Ramos, S., Igrejas, G., Rodrigues, J., Capelo-Martinez, J.L., Poeta, P., 2013. Genetic characterisation of antibiotic resistance and virulence factors in vanA-containing enterococci from cattle, sheep and pigs subsequent to the discontinuation of the use of avoparcin. Vet. J. 193 (1), 301–303. Rizzo, L., Manaia, C., Merlin, C., Schwartz, T., Dagot, C., Ploy, M.C., Michael, I., FattaKassinos, D., 2013. Urban wastewater treatment plants as hotspots for antibiotic resistant bacteria and genes spread into the environment: a review. Sci. Total Environ. 447, 345–360. Schwartz, T., Armant, O., Bretschneider, N., Hahn, A., Kirchen, S., Seifert, M., Dötsch, A., 2015. Whole genome and transcriptome analyses of environmental antibiotic

112

J. Alexander et al. / Science of the Total Environment 559 (2016) 103–112

sensitive and multi-resistant Pseudomonas aeruginosa isolates exposed to waste water and tap water. Microb. Biotechnol. 8 (1), 116–130. Schwartz, T., Kohnen, W., Jansen, B., Obst, U., 2003. Detection of antibiotic-resistant bacteria and their resistance genes in wastewater, surface water, and drinking water biofilms. FEMS Microbiol. Ecol. 43 (3), 325–335. Schwartz, T., Volkmann, H., Kirchen, S., Kohnen, W., Schön-Hölz, K., Jansen, B., Obst, U., 2006. Real-time PCR detection of Pseudomonas aeruginosa in clinical and municipal wastewater and genotyping of the ciprofloxacin-resistant isolates. FEMS Microbiol. Ecol. 57 (1), 158–167. Stalder, T., Barraud, O., Jove, T., Casellas, M., Gaschet, M., Dagot, C., Ploy, M.C., 2014. Quantitative and qualitative impact of hospital effluent on dissemination of the integron pool. ISME J. 8 (4), 768–777. Süß, J., Volz, S., Obst, U., Schwartz, T., 2009. Application of a molecular biology concept for thedetection of DNA damage and repair during UV disinfection. Water Res. 43, 3705–3716. Szabó, L., Tóth, T., Engelhardt, T., Rácz, G., Mohácsi-Farkas, C., Takács, E., Wojnárovits, L., 2016. Change in hydrophilicity of penicillins during advanced oxidation by radiolytically generated radical dotOH compromises the elimination of selective pressure on bacterial strains. Sci. Total Environ. 551–552, 393–403. Tato, M., Coque, T.M., Baquero, F., Cantón, R., 2010. Dispersal of carbapenemase blaVIM-1 gene associated with different Tn402 variants, mercury transposons, and conjugative plasmids in Enterobacteriaceae and Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 54 (1), 320–327. Ternes, T.A., Joss, A., Öhlmann, J., 2015. Occurrence, fate, removal and assessment of emerging contaminants in water in the water cycle (from wastewater to drinking water. Water Res. 72, 1–2. Varela, A.R., Ferro, G., Vredenburg, J., Yanik, M., Vieira, L., Rizzo, L., Lameiras, C., Manaia, C.M., 2013. Vancomycin resistant enterococci: from the hospital effluent to the urban wastewater treatment plant. Sci. Total Environ. 450–451, 155–161. Varela-Villarreal, J., Jungfer, C., Obst, U., Schwartz, T., 2013. DNase I and Proteinase K eliminate DNA from injured or dead bacteria but not from living bacteria in microbial reference systems and natural drinking water biofilms for subsequent molecular biology analyses. J. Microbiol. Methods 94 (3), 161–169.

Vaz-Moreira, I., Nunes, O.C., Manaia, C.M., 2014. Bacterial diversity and antibiotic resistance in water habitats: searching the links with the human microbiome. FEMS Microbiol. Rev. 38 (4), 761–778. Větrovský, T., Baldrian, P., 2013. The variability of the 16S rRNA Ggne in bacterial genomes and its consequences for bacterial community analyses. PLoS One 8 (2), e57923. Villaseñor-Sierra, A., Katahira, E., Jaramillo-Valdivia, A.N., Barajas-García, M.D.L.A., Bryant, A., Morfín-Otero, R., Márquez-Díaz, F., Tinoco, J.C., Sánchez-Corona, J., Stevens, D.L., 2012. Phenotypes and genotypes of erythromycin-resistant Streptococcus pyogenes strains isolated from invasive and non-invasive infections from Mexico and the USA during 1999-2010. Int. J. Infect. Dis. 16 (3), 178–181. Volkmann, H., Schwartz, T., Bischoff, P., Kirchen, S., Obst, U., 2004. Detection of clinically relevant antibiotic-reistance genes in municipal wastewater using real-time PCR (TaqMan). J. Microbiol. Methods 56 (2), 277–286. Wardal, E., Markowska, K., Zabicka, D., Wróblewska, M., Giemza, M., Mik, E., PołowniakPracka, H., Woźniak, A., Hryniewicz, W., Sadowy, E., 2014. Molecular analysis of vanA outbreak of Enterococcus faecium in two Warsaw hospitals: the importance of mobile genetic elements. Biomed. Res. Int. 575367. Willems, A., Falsen, E., Pot, B., Jantzen, E., Hoste, B., Vandamme, P., Gillis, M., Kersters, K., De Ley, J., 1990. Acidovorax, A new genus for Pseudomonas facilis, Pseudomonas delafieldii, E. Falsen (EF) group 13, EF Group 16, and several clinical isolates, with the species Acidovorax facilis comb. nov., Acidovorax delafieldii comb. nov., and Acidovorax temperans sp. Int. J. Syst. Bacteriol. 40 (4), 384–398. Zarb, P., Coignard, B., Griskeviciene, J., Muller, A., Vankerckhoven, V., Weist, K., Goossens, M., Vaerenberg, S., Hopkins, S., Catry, B., Monnet, D., Goossens, H., Suetens, C., 2012. Point prevalence survey of healthcare- associated infections and antimicrobial use in European acute care hospitals. Euro Surveill. 17 (46), 20316. Zhuang, Y., Ren, H., Geng, J., Zhang, Y., Zhang, Y., Ding, L., Xu, K., 2014. Inactivation of antibiotic resistance genes in municipal wastewater by chlorination, ultraviolet, and ozonation disinfection. Environ. Sci. Pollut. Res. Int. 22 (9), 7037–7044. Zimmermann, S.G., Wittenwiler, M., Hollender, J., Krauss, M., Ort, C., Siegrist, H., von Gunten, U., 2011. Kinetic assessment and modeling of an ozonation step for fullscale municipal wastewater treatment: micropollutant oxidation, by-product formation and disinfection. Water Res. 45 (2), 605–617.