Ozz-E3, A Muscle-Specific Ubiquitin Ligase, Regulates β-Catenin Degradation during Myogenesis

Developmental Cell, Vol. 6, 269–282, February, 2004, Copyright 2004 by Cell Press

Ozz-E3, A Muscle-Specific Ubiquitin Ligase, Regulates ␤-Catenin Degradation during Myogenesis Tommaso Nastasi,1,4 Antonella Bongiovanni,1,4,5 Yvan Campos,1 Linda Mann,1 James N. Toy,1 Jake Bostrom,1 Robbert Rottier,1,6 Christopher Hahn,1,7 Joan Weliky Conaway,2 A. John Harris,3 and Alessandra d’Azzo1,* 1 Department of Genetics and Tumor Cell Biology St. Jude Children’s Research Hospital 332 North Lauderdale Street Memphis, Tennessee 38105 2 Stowers Institute for Medical Research 1000 East 50th Street Kansas City, Missouri 64110 3 Developmental Biology Unit and Department of Physiology University of Otago Dunedin New Zealand

Summary The identities of the ubiquitin-ligases active during myogenesis are largely unknown. Here we describe a RING-type E3 ligase complex specified by the adaptor protein, Ozz, a novel SOCS protein that is developmentally regulated and expressed exclusively in striated muscle. In mice, the absence of Ozz results in overt maturation defects of the sarcomeric apparatus. We identified ␤-catenin as one of the target substrates of the Ozz-E3 in vivo. In the differentiating myofibers, Ozz-E3 regulates the levels of sarcolemma-associated ␤-catenin by mediating its degradation via the proteasome. Expression of ␤-catenin mutants that reduce the binding of Ozz to endogenous ␤-catenin leads to Mb-␤-catenin accumulation and myofibrillogenesis defects similar to those observed in Ozz null myocytes. These findings reveal a novel mechanism of regulation of Mb-␤-catenin and the role of this pool of the protein in myofibrillogenesis, and implicate the Ozz-E3 ligase in the process of myofiber differentiation. Introduction Ubiquitin-mediated protein degradation is crucial for muscle development and the maintenance of striated muscle homeostasis (Solomon and Goldberg, 1996; Song et al., 1998). It also regulates the rapid proteolysis associated with muscle wasting (Tisdale, 2002) and muscle atrophy, which is induced by metabolic or catabolic diseases (Jagoe and Goldberg, 2001). Ubiquitination of protein substrates occurs through the sequential *Correspondence: [email protected] 4 These authors contributed equally to this work. 5 Present address: Istituto di Biomedicina e Immunologia Molecolare, IBIM Consiglio Nazionale delle Ricerche, Palermo, Italy. 6 Present address: MGC-Department of Cell Biology, The Erasmus University, Rotterdam, Netherlands. 7 Present address: Vascular Biology Laboratory, Hanson Center for Cancer Research, Adelaide, Australia.

action of distinct enzymes: E1 (ubiquitin-activating enzyme); E2 (ubiquitin-conjugating enzyme); E3 (ubiquitin ligase) (Hershko et al., 2000). The E3 ligase is either a single protein, with an intrinsic ubiquitin-ligase activity, or a protein complex that binds both the E2 enzyme and the substrate (Ciechanover, 1994). Substrate recognition by the E3 ligase dictates the selectivity of the ubiquitination reaction (Hershko et al., 2000). Only a few E3 ligases that control the turnover of muscle proteins have been identified (Jagoe and Goldberg, 2001): three homologous RING-finger proteins, MURF1 through 3, that have been implicated in the stabilization of the microtubule network and the sarcomeric M-line (Centner et al., 2001; Spencer et al., 2000) and Trim32, another putative E3-ubiquitin-ligase, that has been found mutated in the Limb-girdle muscular dystrophy type 2H (Frosk et al., 2002). However, a precise understanding of the role of ubiquitination in muscle development and the identification of the E3 ligases and their target substrates have remained elusive. The ␤-catenin protein is an essential mediator of myogenesis and muscle homeostasis that functions at multiple subcellular sites. The cytoplasmic and nuclear pools of ␤-catenin participate in the Wnt/Wg signaling pathway (Moon et al., 2002), which is involved in cell proliferation and in establishing the early myotome (Schmidt et al., 2000). ␤-catenin is also a key constituent of cadherinbased adherens junctions, where it translocates during early differentiation, a crucial step for the maintenance of myogenic commitment (Goichberg et al., 2001). During terminal differentiation, the cadherin-catenin complex plays a role in intermyocyte recognition and alignment that precede the fusion of myocytes to form multinucleated myotubes (Kang et al., 2003; Kaufmann et al., 1999). In mature myofibers, cadherin-catenin complexes transfer the contractile force from sarcomeres to the extracellular matrix and stabilize the structure of sarcomeres by linking the cadherins to the actin filaments of the cytoskeleton (Kurth et al., 1996). Although previously hypothesized because of its costameric localization in adult muscle cells, evidence of a direct role of ␤-catenin in the establishment and organization of the sarcomeric apparatus during myogenesis has been largely missing. Only recently, the N-cadherin/␤-catenin complex was shown to be involved in the alignment of myofibrils in cardiomyocytes (Luo and Radice, 2003). Therefore, regulating the abundance of the membrane pool of ␤-catenin may be crucial for sarcomeric organization and for muscle fiber elongation and fusion. The involvement of ubiquitin-mediated degradation in modulating the functions of ␤-catenin in different cell systems has been amply documented, and multiple E3ubiquitin ligases have been described that regulate the cytosolic levels of ␤-catenin and its translocation to the nucleus (Matsuzawa and Reed, 2001; Moon et al., 2002; Winston et al., 1999). Recent findings identified an ubiquitin ligase, Hakai, that acts on the ␤-catenin associated with E-cadherin in epithelial cells (Fujita et al., 2002). However, the identities of the E3 ligases that control

Developmental Cell 270

Figure 1. Ozz Is a Developmentally Regulated, Muscle-Specific SOCS-Box Protein (A) Northern blot analysis of mouse embryos, and adult human and mouse tissues hybridized with an Ozz cDNA probe showed that Ozz expression is developmentally regulated and restricted to striated muscle (He, heart; Br, brain; Sp, spleen; Lu, lung; Li, liver; Sm, skeletal muscle; Ki, kidney; Te, testis; Pa, pancreas; Pl, placenta). (B) The primary structure of mouse and human Ozz includes the NHR1 (blue), NHR2 (green), and SOCS-box (red) domains. (C) In E10 embryos, Ozz protein (purple) is localized in the somites at the tips of the myotomal cells, near the intermyotomal septum. (D) In E14.5 embryos, Ozz (brown) is evident near the myotendinous junctions in maturing myocytes. (E) Ozz localization (brown) in myotomal cells was confirmed by double labeling with antimyogenin antibodies (red ). (F and G) In E14.5 embryos, Ozz⫹ staining (brown) is confined to the tips of nestin⫹ myofibers (F, purple) and is juxtaposed to the boundary of the developing myotendinous junction positive for tenascin (G, purple). Scale bars, 50 ␮m (C–G). (H) Confocal analysis of cultured myocytes showed that Ozz localizes at the tips of the elongating fibers. (I) On Northern blots, Ozz mRNA levels appear low in proliferating myoblasts (day 0) and at the onset of differentiation (day 1), and increase in differentiated myotubes (day 4). GAPDH mRNA levels are shown as a loading control. (J) Western blot (WB) analysis of total-protein extracts from myoblasts (day 0) and myocytes (days 1–4) immunolabeled with the indicated antibodies showed that the level of Ozz protein increases during differentiation.

selective degradation of specific pools of ␤-catenin during myogenesis have been unknown until now. We discovered a novel gene, Ozz, based on its partial overlap with the transcriptional unit of the carboxypeptidase protective protein/cathepsin A (PPCA), the enzyme deficient in the lysosomal storage disease galactosialidosis (d’Azzo et al., 2001). Ozz is a member of the Suppressor of Cytokine Signaling (SOCS) family (Kile et al., 2002) and is developmentally regulated in muscle cells. SOCS proteins are components of ubiquitin ligase complexes that also include Elongins B and C, a Cullin family member, and the RING protein Rbx1 (Kile et al., 2002). The SOCS proteins contain a variable N-terminal protein-protein interaction domain, which is thought to bind the substrate, and a C-terminal “SOCS box,” which interacts with Elongin B/C in the invariant catalytic core (Stebbins et al., 1999). Here we demonstrate that Ozz assembles into an active E3 ligase complex and identify ␤-catenin as one of its target substrates in vivo. We provide evidence that during myogenesis Ozz-E3 controls the ubiquitination and degradation of the specific pool of ␤-catenin located at the sarcolemma. Ozz null

mice accumulate ␤-catenin at the membrane and develop a striking muscle phenotype characterized by increased frequency of central nuclei and a consistent misalignment of the myofibrils. Accumulation of membrane-bound ␤-catenin (Mb-␤-catenin) and defects in myofibrillar organization are also evident in cultured Ozz⫺/⫺ myocytes and can be recapitulated in wild-type myocytes expressing dominant-negative ␤-catenin mutants that compete with endogenous wild-type ␤-catenin for Ozz binding. Together these findings underscore the contribution of Mb-␤-catenin to the Ozz null sarcomeric phenotype and point to a key role of Ozz-E3 ubiquitin ligase in the process of myofiber differentiation and maturation.

Results Ozz Is a Muscle-Specific SOCS Protein that Is Regulated during Myogenesis The Ozz transcript was first identified on a mouse multitissue Northern blot probed with exon 1a of the PPCA

Ozz-E3 Regulates ␤-Catenin in Striated Muscle 271

Figure 2. Ozz⫺/⫺ Mice Have Increased Number of Myofibers with Central Nuclei and Impaired Striation Pattern (A) Schematic representation of the Ozz targeting construct. (B) Northern blot analysis of PPCA and Ozz expression in heart and skeletal muscles from 5-month-old animals confirmed the absence of Ozz mRNA in Ozz⫺/⫺ mice that still express PPCA mRNA. (C) Western blot analysis with anti-Ozz antibody showed absence of the Ozz protein in heart and skeletal muscle lysates from Ozz⫺/⫺ mice. (D–G) In H&E-stained longitudinal and crosssections of soleus muscles from 2.5-monthold mice, an aberrant number and distribution of nuclei (E) and increased frequency of fibers with central nuclei ([G], arrowheads) were evident in Ozz⫺/⫺ mice compared to wild-type littermates (D and F). (H and I) Toluidine blue staining of thin sections of soleus muscles from 2.5-month-old Ozz⫹/⫹ (H) and Ozz⫺/⫺ (I) mice displayed a strikingly abnormal striation pattern of the myofibers with regional loss of sarcomeric banding.

gene. PPCA and Ozz are transcribed in opposite orientation from a bidirectional promoter (Rottier and d’Azzo, 1997) that contains three conserved E-boxes with target binding sites for muscle-specific basic helix-loop-helix transcription factors (Molkentin and Olson, 1996). Ozz mRNA is expressed during embryonic development, and its expression is maintained in both the adult mouse and human in a pattern restricted to skeletal and cardiac muscle (Figure 1A). The encoded protein is 285 amino acids long and includes three domains (Figure 1B): two N-terminal Neuralized homology repeats (NHR1 and NHR2) which are found in the Neuralized protein family (Yeh et al., 2000), and a C-terminal SOCS box. To determine the cellular distribution of Ozz during muscle development, we labeled sections of adult mice and embryos at various stages with an anti-Ozz polyclonal antibody. Ozz was expressed in adult skeletal and cardiac muscles (data not shown). In embryonic

day (E)10 embryos, Ozz immunostaining was confined to the developing heart (data not shown) and the somites at the tips of the myotomal cells near the intermyotomal septum (Figure 1C). Ozz expression in the myotomes was confirmed by double staining with anti-myogenin and anti-Ozz antibodies (Figure 1E). In E14 to E15 embryos, when most muscles have formed but secondary myogenesis has not yet begun, Ozz accumulated near the myotendinous junctions, the site of sarcomere assembly in growing myotubes (Dix and Eisenberg, 1990) (Figure 1D). The expression of Ozz marginally overlapped the nestin-positive regions at the extreme ends of developing fibers (Figure 1F) and was juxtaposed to the boundary of tenascin-positive regions at the developing myotendinous junctions (Figure 1G). Like its subcellular distribution in embryonic muscle, the distribution of Ozz in primary myoblast cultures was localized predominantly at the tips of the differentiating

Developmental Cell 272

myofibers (Figure 1H). Northern blot analysis revealed that the levels of Ozz mRNA were low in proliferating myoblasts but drastically increased at day 4 of differentiation (Figure 1I). In addition, Western blot analysis of lysates of primary myoblasts and myotubes labeled with anti-Ozz antibody demonstrated that the 30 kDa endogenous protein was present in negligible amounts in proliferating myoblasts but was induced during differentiation. The appearance of Ozz was concomitant with that of myosin heavy chain (MyHC) and the decrease of myogenin (Figure 1J). Thus, Ozz mRNA and protein levels are regulated during the differentiation of muscle cells.

Ozz Null Mice Show Sarcomeric Abnormalities We generated Ozz⫺/⫺ mice by using the targeting vector shown schematically in Figure 2A to disrupt one of the Ozz alleles in embryonic stem cells. Ozz⫺/⫺ mice were born at the expected mendelian ratio (n ⫽ 100) and were viable and fertile. Nevertheless, their body weight, which was measured each month between 1 and 6 months of age, averaged 20% less than that of their wild-type littermates (n ⫽ 50). In Ozz null mice, the heart and skeletal muscle lacked both Ozz mRNA (Figure 2B) and Ozz protein (Figure 2C). We also analyzed PPCA expression in Ozz⫺/⫺ mice, because the targeting of the Ozz gene could have interfered with PPCA transcription in the opposite orientation. We found that the levels of PPCA mRNA were slightly reduced in Ozz⫺/⫺ heart and skeletal muscle (Figure 2B) and that lysosomal cathepsin A activity varied from approximately control values in the heart to 50% that of control values in skeletal muscle (data not shown). These values were equal or above those measured in PPCA-heterozygous mice that develop normally and have a normal lifespan (Zhou et al., 1995). Moreover, Ozz⫺/⫺ mice do not show any of the pathologic manifestations associated with PPCA deficiency (Zhou et al., 1995), and hence any phenotypic changes should be attributed solely to loss of Ozz function. The overall morphology of skeletal muscle was preserved in the knockout mice, although the distribution and number of nuclei in H&E-stained longitudinal sections of the Ozz⫺/⫺ soleus muscle appeared altered (Figures 2D and 2E). Cross-sections of the same muscle also showed an increased number of fibers (10%–15%) with central nuclei, a finding that suggests either delayed maturation or increased regeneration of the Ozz⫺/⫺ myofibers (Figures 2F and 2G). In addition, a strikingly abnormal striation pattern was evident in toluidine bluestained semithin sections of the adult soleus muscle (Figures 2H and 2I). These phenotypic aberrations were further investigated by ultrastructural analysis of adult Ozz⫹/⫹ and Ozz⫺/⫺ myofibers of quadriceps and soleus muscles (Figures 3A–3H). In the absence of Ozz, myofibrils displayed multiple abnormalities: misalignment of the Z-bands was consistently observed in most of the fibers (Figure 3B) and was frequently associated with widening of the Z-band and thinning of the surrounding structures (Figures 3D and 3H). These defects were accompanied by an increased frequency of myofibril branching and splitting (Figures 3B and 3F, arrowheads). This muscle phenotype was consistently observed in

Ozz⫺/⫺ mice between the ages of 1 and 6 months (n ⫽ 4). Although most of the muscle fibers were affected, some variation was seen among different muscles. Thus, the Ozz-E3 ligase is clearly implicated in the establishment of the sarcomeric apparatus, maintenance of this structure, or both. Ozz Assembles into a RING-Type E3 Ligase and Ubiquitinates ␤-Catenin Because Ozz is a SOCS protein, we hypothesized that it could form an E3 ligase complex with Elongin B/C, Rbx1, and a Cullin protein. In fact, we readily reconstituted the five-component complex in vitro by coinfecting insect cells with recombinant baculoviruses for Ozz, Elongin B, Elongin C, Rbx1, and Cullin5 (Supplemental Figure S1A [http://www.developmentalcell.com/cgi/content/ full/6/2/269/DC1]). No reconstitution was obtained using Cullin2 (data not shown), which confirms the affinity of SOCS proteins for Cullin5 (Kamura et al., 2001). In addition, Ozz comigrated on gel filtration and coprecipitated with Elongin B/C and Rbx1 in lysates of skeletal muscle (Supplemental Figure S1B). Thus, Ozz is indeed a subunit of a RING-type E3-ligase complex in vivo and, as such, could participate in the ubiquitination of protein substrates. To ascertain the biological role of the Ozz-E3 in myogenesis, we set out to test its ubiquitin ligase activity toward target substrates in skeletal muscle. We first isolated putative Ozz-interacting proteins by using a yeast two-hybrid screening of an E14.5 mouse cDNA library; full-length Ozz or the N-terminal half including the NHRs was used as bait. The location of the N-terminal region of Ozz corresponds to the variable proteinprotein interaction module of SOCS proteins thought to bind substrates. Both screens yielded three clones that had 100% homology to ␤-catenin and shared a region spanning amino acids 403 through 781. The interaction between Ozz and ␤-catenin was first verified by coprecipitating the two proteins with anti-␤-catenin antibody after in vitro transcription/translation (Supplemental Figure S1C); when SOCS3 instead of Ozz was cotranslated with ␤-catenin, these two proteins did not coprecipitate, further confirming the specificity of the Ozz and ␤-catenin interaction (data not shown). We also demonstrated that Ozz and ␤-catenin coimmunoprecipitated from postnuclear fractions of wild-type heart and skeletal muscle (Figure 4A), but not of Ozz⫺/⫺ striated muscles (Figure 4A). We next assayed the in vitro ubiquitin ligase activity of the reconstituted and purified Ozz-E3 toward a glutathione S-transferase (GST)-tagged ␤-catenin. Ubiquitinated forms of ␤-catenin were detected only in the presence of Ozz-E3 (Figure 4B). Furthermore, ubiquitination of ␤-catenin was dependent on the presence of Ozz because an in vitro ubiquitination assay performed with all the components except Ozz did not result in ubiquitination of the substrate (Figure 4B). In a parallel control experiment, omission of any of the other components from the reaction mixture prevented ubiquitination of ␤-catenin (Figure S1D). From these data, we inferred that in striated muscle Ozz may function as the substraterecognition component of an E3 ligase that recruits and ubiquitinates ␤-catenin.

Ozz-E3 Regulates ␤-Catenin in Striated Muscle 273

Figure 3. Aberrant Myofibril Organization in Ozz Null Mice Electron micrographs of the soleus (A–D) and quadriceps (E–H) muscles isolated from adult Ozz⫹/⫹ and Ozz⫺/⫺ mice. Disorganization of the myofibrillar array associated with abnormal appearance of Z-bands and surrounding structures is evident in the Ozz⫺/⫺ muscles (B, D, and H). Increased frequency of myofibril splitting and branching was observed in most of the Ozz⫺/⫺ myofibers (arrowheads in [B] and [F]). Scale bars: 1 ␮m (A, B, E, F) and 400 nm (C, D, G, H).

Ozz Regulates the Levels of Mb-␤-Catenin in Adult Striated Muscle and Differentiating Myocytes If the Ozz-E3 ligase regulates ubiquitination of ␤-catenin in muscle cells, the levels of this protein should change in the absence of Ozz. However, in total postnuclear lysates from Ozz⫹/⫹ and Ozz⫺/⫺ striated muscles, we could not detect any significant difference in ␤-catenin levels (Figure 4A, input). Given that ␤-catenin distributes at specific subcellular sites, we investigated which pool of the protein was specifically targeted by the Ozz-E3 in vivo and what was the fate of the ubiquitinated ␤-catenin. We compared the levels of cytosolic ␤-catenin and Mb-␤-catenin in subcellular fractions of Ozz⫹/⫹, Ozz⫺/⫺, and Ozz⫹/⫺ heart and skeletal muscle. The amount of Mb-␤-catenin increased in Ozz⫺/⫺ samples of both muscles, and this increase directly reflected the dose of the Ozz gene (Figure 4C, left panels); in contrast, the cytosolic levels of ␤-catenin were unchanged in both tissues from all three genotypes (Figure 4C, right panels). Because ␤-catenin forms stable complexes with members of the cadherin family at the plasma membrane (Gottardi and Gumbiner, 2001), we also tested whether the levels of M- and N-cadherin were influenced by the

increased Mb-␤-catenin. M-cadherin in skeletal muscle and N-cadherin in heart were slightly increased in the membrane fraction of Ozz⫺/⫺ tissues (Figure 4C), which probably reflected the abnormal accumulation of ␤-catenin at the membrane. In line with these findings, the level of Mb-␤-catenin was substantially higher in Ozz⫺/⫺ cultured myocytes than in wild-type myocytes (Figure 4D, left panels), while the levels of cytosolic ␤-catenin were comparable in the two samples (Figure 4D, right panels). Accordingly, M- and N-cadherins accumulated in the membrane fraction of the Ozz⫺/⫺ myocytes (Figure 4D, left panels). We further validated the biochemical evidence by whole-mount immunofluorescent labeling of isolated muscle fibers from Ozz⫺/⫺ and Ozz⫹/⫹ tibialis anterior muscles with an anti-␤-catenin antibody. Immunolabeled fibers were analyzed using a multi-photon confocal laser scan microscope. 3D projections of Z-series of optical sections clearly demonstrate the substantial increase of ␤-catenin at the sarcolemma of the Ozz⫺/⫺ muscle fibers (Supplemental Figure S2). Similarly, in cultured Ozz⫺/⫺ myocytes immunolabeled with anti␤-catenin antibody and analyzed with a confocal laser

Developmental Cell 274

Figure 4. Ozz-E3 Ubiquitinates ␤-Catenin In Vitro and Regulates ␤-Catenin Levels in Muscle Cells (A) Immunoprecipitation of postnuclear lysates of heart and skeletal muscle from Ozz⫹/⫹, Ozz⫹/⫺, and Ozz⫺/⫺ with anti-␤-catenin antibody followed by immunoblotting (WB) with anti-Ozz antibody showed coprecipitation of the two proteins. Immunoprecipitated IgG are shown as loading control. The input controls were also probed with the indicated antibodies. (B) In vitro ubiquitination of GST-␤-catenin was performed using either the Ozz-E3 complex (Ozz⫹-E3) or all the E3 components except Ozz (Ozz–-E3). Ubiquitinated ␤-catenin was immunoprecipitated with anti-␤-catenin and detected on immunoblot probed with anti-ubiquitin. Reactions performed without ATP were used as control. (C) Cytosolic and membrane-bound fractions of heart and skeletal muscle from 6-week-old Ozz⫹/⫹, Ozz⫹/⫺, and Ozz⫺/⫺ mice were tested on Western blots (WB) labeled with anti-␤-catenin, and anti-N- and M-cadherins antibodies. ␤-catenin levels increase in Ozz⫺/⫺ samples, and this increase is dependent on the dosage of the Ozz gene. N-cadherin levels in heart and M-cadherin in skeletal muscle are also slightly increased in Ozz null tissues. Cytosolic levels of ␤-catenin are unchanged in all samples. Blots were also probed with anti-Ozz antibody (arrowheads indicate the position of the Ozz band). GAPDH immunolabeling and Coomassie brilliant blue (CBB) staining are shown as loading controls for the cytosolic and the membrane-bound fractions, respectively. (D) Myoblasts isolated from Ozz⫹/⫹ and Ozz⫺/⫺ mice were maintained in culture and induced to differentiate for 3 days. The level of Mb␤-catenin increased in Ozz⫺/⫺ differentiating myocytes, but that of cytosolic (Cyt) ␤-catenin did not. The levels of M-cadherin and N-cadherin also increased. GAPDH immunolabeling and Coomassie brilliant blue (CBB) staining are shown as loading controls.

Ozz-E3 Regulates ␤-Catenin in Striated Muscle 275

Figure 5. Ozz-E3 Controls Mb-␤-Catenin Polyubiquitination and Degradation in Differentiating Myocytes (A) Ozz⫺/⫺ and wild-type myoblasts were differentiated for 2 days and treated with lactacystin for 3 hr. Cytosolic and membrane-bound subcellular fractions were first immunoprecipitated with anti-␤-catenin and analyzed on Western blots probed with anti-ubiquitin to detect ubiquitinated forms of the protein. In the membrane-bound fraction of Ozz null myocytes, no polyubiquitinated ␤-catenin was observed. IgG, input, and preclearing controls are shown. (B) Confocal laser scan microscope images of myocytes (day 3) treated or not with lactacystin (Lcy) showed a clear increase of Mb-␤-catenin in Ozz⫹/⫹ cells after treatment with the inhibitor. In Ozz⫺/⫺ samples, Mb-␤-catenin is increased regardless of treatment with lactacystin. (C) Ozz⫺/⫺ and Ozz⫹/⫹ myocytes were metabolically labeled with 3H-Leu and chased for the indicated periods (minutes). Membrane-bound proteins were immunoprecipitated with anti-␤-catenin, separated by SDS-PAGE, and visualized by autoradiography. The turnover of Mb␤-catenin in Ozz⫺/⫺ myocytes is slower than that in wild-type myocytes. Densitometric measurements are plotted as ratios between each time point and t0. (D) Ozz⫺/⫺ myoblasts were transduced with an Ozz-expressing retrovirus (RV-Ozz), sorted, and induced to differentiate for 2 days. Restoring Ozz expression in Ozz null cells normalizes the levels of Mb-␤-catenin. Loading controls are shown as indicated.

Developmental Cell 276

scan microscope, ␤-catenin abnormally accumulated and became uniformly distributed along the plasma membrane compared to Ozz⫹/⫹ myocytes (Figure 5B). Ozz Regulates the Stability of Membrane-Bound ␤-Catenin The accumulation of Mb-␤-catenin in the Ozz⫺/⫺ muscle could be explained by the lack of polyubiquitination and hence degradation of this pool of the protein in absence of Ozz. To test this hypothesis, we assessed the ubiquitination state of the Mb-␤-catenin in Ozz⫺/⫺ and Ozz⫹/⫹ myocytes cultured in the presence of the proteasomal inhibitor lactacystin. In wild-type myocytes, Mb-␤-catenin was heavily polyubiquitinated; however, in Ozz⫺/⫺ myocytes, it was not (Figure 5A). No appreciable difference in the ubiquitination pattern of ␤-catenin was detected in the cytosolic fraction of both Ozz⫺/⫺ and Ozz⫹/⫹ myocytes (Figure 5A). We could, therefore, predict that in wild-type myocytes cultured in the presence of lactacystin, ␤-catenin accumulates at the plasma membrane as the result of blocked degradation. Indeed, confocal microscopic analysis of immunofluorescent-labeled Ozz⫹/⫹ myocytes treated with lactacystin demonstrated a striking increase of Mb-␤-catenin (Figure 5B). Under these conditions, the intensity of Mb-␤-catenin immunostaining in wild-type myocytes was equal to that of untreated Ozz⫺/⫺ myocytes; adding lactacystin to the mutant cells did not alter the Mb-␤-catenin signal (Figure 5B). We also tested whether the turnover of Mb␤-catenin changes in absence of Ozz. Primary myocytes from Ozz⫹/⫹ and Ozz⫺/⫺ mice were radiolabeled with 3HLeucine and chased for different time points. Immunoprecipitation of Mb-␤-catenin from radiolabeled subcellular fractions demonstrated that the turnover of this pool of ␤-catenin in Ozz⫺/⫺ myocytes was slower than that in wild-type myocytes (Figure 5C). These results validate the hypothesis that Ozz is the adaptor of the E3 ligase that regulates Mb-␤-catenin during myogenesis. The ultimate proof that functional Ozz is necessary for regulating Mb-␤-catenin levels in differentiating myocytes was obtained by retrovirally expressing exogenous Ozz in Ozz⫺/⫺ myocytes. In these cells, Mb-␤-catenin levels reverted to normal, a finding that indicates that restoring Ozz function in the null background is in itself sufficient to rescue this phenotype (Figure 5D). Ozz Regulates a Pool of ␤-Catenin Involved in Myofibrillar Organization Because of the costameric localization of ␤-catenin and its proposed role in the organization of the sarcomeric apparatus, we hypothesized that the accumulation of this protein at the sarcolemma of Ozz null myofibers could contribute at least in part to the sarcomeric abnormalities observed in these fibers. To test this hypothesis, we have generated and expressed in wild-type myoblasts two ␤-catenin mutants that allowed us to induce accumulation of endogenous ␤-catenin at the membrane. The first mutant spans the C-terminal region of the protein from amino acid 424 to 781 and includes the Armadillo repeats 8–12 and the C-terminal tail. This ␤-catenin fragment (␤TH) corresponds to the one isolated by two-hybrid interacting screening. The second mutant

is a shorter version of the first and includes only the C-terminal tail from amino acid 672 to 781 (␤CT). We specifically chose the C-terminal half of the protein because this is the portion interacting with Ozz. To minimize interference with the interaction of endogenous ␤-catenin with membrane/cytoskeleton complexes, we excluded from our studies ␤-catenin mutants that included the N terminus and/or the whole Arm-repeat region, since these domains are known to contain the binding sites for ␣-catenin and E-cadherin (Aberle et al., 1994; Fukata and Kaibuchi, 2001; Huber and Weis, 2001; Kemler, 1993). We predicted that our mutants would effectively compete with endogenous full-length ␤-catenin for binding to Ozz and, in turn, stabilize Mb-␤-catenin and phenocopy the Ozz null myocytes. Indeed, the results confirmed this prediction. We expressed both ␤TH and ␤CT mutants in primary myoblasts by MSCV-IRES-GFPbased retroviral transduction (Figure 6A) and showed that they maintain the interaction with Ozz when coexpressed in vitro (Figure 6B). Full-length ␤-catenin was included as experimental control. We also proved that both mutants effectively competed with endogenous ␤-catenin for interaction with Ozz because the levels of endogenous ␤-catenin that coimmunoprecipitated with anti-Ozz antibody were drastically decreased (Figure 6C). Moreover, Mb-␤-catenin levels increased significantly in wild-type differentiating myocytes expressing either of the mutants, but not in cells expressing the empty vector (wt) or the full-length ␤-catenin (␤FL), which followed the normal pathway of regulation of the endogenous protein (Figure 6D). As expected, the levels of the cadherins were also increased (Figure 6D). Accumulation of ␤-catenin at the sarcolemma in ␤TH- and ␤CTexpressing myocytes was confirmed by immunofluorescence analysis (Figure 6E). To rule out the possibility that both ␤TH and ␤CT mutants still bind to ␤-catenin nuclear partners (i.e., TBP and CBP/p300), and therefore suppress or enhance the nuclear function of this protein (Hecht et al., 1999, 2000; Takemaru and Moon, 2000), we also measured the TCFdependent transcriptional activity by transfecting the cells with a Tcf/Lef1 Luciferase reporter vector (Nakamura et al., 2003). The level of luciferase activity in myocytes expressing the mutants was within the range of that in wild-type differentiated myocytes and well below the level measured in wild-type proliferating myoblasts (Supplemental Figure S1E). We next tested whether myocytes expressing the ␤-catenin mutants had altered myofibrillogenesis both by immunofluorescence analysis using the myofibrillar marker ␣-actinin (Du et al., 2003) and by electron microscopy. Myofibrils formed and aligned correctly in wildtype cells or in cells expressing ␤FL (Figure 7). Ozz null cells displayed a pattern of ␣-actinin⫹ myofibrils that were erroneously oriented and disorganized; moreover, some cells did not show any banding of the protein. Strikingly, myocytes expressing either ␤TH or ␤CT mutants had myofibrillogenesis defects similar to those observed in Ozz null myocytes. Longitudinally oriented ␣-actinin⫹ structures and mislocalization of this protein were consistent features of the mutant-expressing myocytes. Moreover, streaming of the myofibrils was observed in some cells expressing the ␤CT mutant, a phenotype also

Ozz-E3 Regulates ␤-Catenin in Striated Muscle 277

Figure 6. ␤-Catenin Mutants ␤TH and ␤CT Reduce Endogenous ␤-Catenin Binding to Ozz and Induce Its Accumulation at the Sarcolemma (A) Western blot analysis of postnuclear lysates of differentiating myocytes transduced with either full-length (␤FL), ␤TH, ␤CT or empty (wt) retroviruses were immunolabeled with anti-␤-catenin antibody. (B) In vitro transcription/translation reactions containing 35S-radiolabeled Ozz and either ␤FL, ␤TH, or ␤CT proteins were immunoprecipitated with anti-Ozz and visualized by autoradiography that confirmed interaction of Ozz with both ␤-catenin mutants. (C) Ozz/␤-catenin complexes were immunoprecipitated with an anti-Ozz antibody (IP panel) from postnuclear lysates of Ozz⫺/⫺ myocytes (KO) and wild-type cells transduced with either empty (wt), ␤TH, or ␤CT retroviruses; immunocomplexes were resolved on SDS-PAGE, and endogenous ␤-catenin visualized on immunoblots probed with anti-␤-catenin antibody. Interaction of endogenous ␤-catenin and Ozz decreases in presence of either ␤TH or ␤CT mutant. Input levels of endogenous ␤-catenin and Ozz are shown as control (Input). (D) Levels of endogenous ␤-catenin, M-cadherin, and N-cadherin were examined in membrane subcellular fractions from Ozz⫺/⫺ myocytes or wild-type cells transduced with either empty (wt), ␤FL, ␤TH, or ␤CT retroviruses. Similarly to Ozz⫺/⫺ samples, ␤-catenin and cadherins accumulate in both ␤TH and ␤CT samples (Membrane panel), but not in ␤FL or in the wt samples (see also Coomassie staining as loading control, CBB). The postnuclear panels are shown as controls of the levels of ␤-catenin, Ozz, retrovirally expressed GFP, and GAPDH. (E) Immunofluorescence analysis with an anti-␤-catenin antibody of myocytes treated as above demonstrates accumulation of Mb-␤-catenin only in the KO, ␤TH, and ␤CT samples.

similar to the one seen in some of the Ozz null fibers in vivo (Figure 2I). Presence of disorganized myofibrils was also confirmed in ␤TH- and ␤CT-expressing myocytes by

electron microscopy analysis (Figure 8). Their aberrant myofibrillar organization was strikingly similar to that observed in Ozz null myocytes and overtly differed from

Developmental Cell 278

Figure 7. Expression of Either ␤TH or ␤CT Mutant in Wild-Type Cells Causes Myofibrillogenesis Defects Similar to Those Observed in Ozz⫺/⫺ Samples Confocal laser scan microscopy of differentiating myocytes immunolabeled with anti-sarcomeric ␣-actinin (red) and phalloidin (green) revealed that absence of Ozz (KO) or expression of ␤TH or ␤CT mutants in wild-type myocytes affects the correct alignment of the ␣-actinin⫹ myofibrillar array, compared to wild-type myocytes transduced with either empty (wt) or ␤FL retroviruses. Two different fields are shown for each sample (left and middle panels). Higher magnification images of individual myotubes are shown in the right panels.

the compacted myofibrillar arrays characteristic of wildtype myocytes (Figure 8). Discussion During muscle development, dramatic changes in protein expression and cell morphology rely on the turnover

of regulatory and structural components. Here we describe the identification of a novel muscle-specific and developmentally regulated protein, Ozz, which specifies a RING-type E3 ubiquitin ligase and participates to the turnover of protein substrate(s) during myofiber differentiation. Ozz contains three functional motifs: two NHRs at the N terminus and a SOCS box at the C terminus,

Ozz-E3 Regulates ␤-Catenin in Striated Muscle 279

Figure 8. Electron Microscopic Analysis Reveals Severe Myobrillogenic Defects in Ozz⫺/⫺ Myocytes Eletromicrographs of Ozz⫺/⫺ myocytes or wild-type myocytes transduced with either empty (wt), ␤FL, ␤TH, or ␤CT retroviruses show that Ozz⫺/⫺ myocytes, as well as ␤TH- or ␤CT-expressing myocytes, have loose and disorganized myofibrils that fail to assemble into the compact sarcomeric array seen in wt and ␤FL samples.

which includes the consensus BC-box sequence (Kibel et al., 1995). The SOCS domain in Ozz likely mediates its interaction with Elongin B/C (Kile et al., 2002). Via this interaction, Ozz assembles into a muscle-specific E3 complex including also Rbx1 and Cullin5. The NHR motifs are located in the putative protein-protein interaction region of Ozz. These motifs are present in Neuralized proteins, which also contain a RING-finger domain and have an intrinsic ubiquitin ligase activity (Deblandre et al., 2001; Lorick et al., 1999; Yeh et al., 2001). The NHR domain in Neuralized serves as the protein recognition site for its substrate Delta (Lai et al.,

2001), a finding that suggests that the NHRs in Ozz are the protein-protein interaction domains for its substrate(s). We identified ␤-catenin as one of the substrates of the Ozz-E3 ligase in muscle cells and demonstrated that Ozz-E3 specifically targets for ubiquitination and degradation only the pool of ␤-catenin located at the sarcolemma. The accumulation of Mb-␤-catenin following inhibition of the proteasome with lactacystin underscores the existence of a proteolytic pathway specific for this pool of the protein in wild-type differentiating myocytes. Consistent with this observation, we found that Mb-␤-catenin is more stable in Ozz⫺/⫺ than in wildtype myocytes and accumulates abnormally both in cultured myocytes and in skeletal muscle fibers. We also showed that the increase in Mb-␤-catenin in striated muscle is dependent on the dose of Ozz and that exogenous expression of Ozz in Ozz null myocytes reconstitutes the normal levels of Mb-␤-catenin. These findings, together with the observation that cytosolic levels of ␤-catenin are not altered in the absence of Ozz, unequivocally point to a role of the Ozz-E3 in regulating specifically the sarcolemmal pool of ␤-catenin. As demonstrated in epithelial cells, our data suggest that distinct E3 ligases function in concert to control either the cytosolic or the cadherin-assembled pool of ␤-catenin during myogenesis. ␤-catenin plays a key role in many myogenic processes, but the underlying molecular mechanisms have not been fully elucidated. During somitogenesis, ␤-catenin is expressed in the dorsal dermomyotome before early myogenic markers are expressed (Schmidt et al., 2000). At this stage, the Wnt/Wg signaling pathway is thought to be involved in stabilizing cytosolic ␤-catenin and, in turn, in activating its downstream nuclear targets that control early myogenic commitment (Nakamura et al., 2003; Petropoulos and Skerjanc, 2002; Polesskaya et al., 2003). Goichberg et al. (2001) have suggested that at early stages of differentiation, the association of ␤-catenin with the cadherins at the adherens junctions counterbalances the nuclear pool of ␤-catenin and pushes the committed cells toward myogenic differentiation. In fact, interference with the formation of adherens junctions, by either overexpressing ␤-catenin or cadherin mutants in differentiating C2 myoblasts, severely affects myogenic differentiation (Goichberg et al., 2001). In adherens junctions and costameres, ␤-catenin links the cadherins to actin filaments of the cytoskeleton and constitutes an integral component of the system that transfers the contractile force from sarcomeres to the extracellular matrix and stabilizes the structure of sarcomeres. Developing skeletal muscles have two forms of adherens junctions that express ␤-catenin at different levels: one form occurs between myotubes and myotubes or myoblasts, and the other occurs at developing myotendinous junctions (Paul et al., 2002). At these locations, cadherin-catenin complexes need to be dynamically regulated to permit rapid disassembly and reassembly of the adherens junctions and elongation or remodeling of the myofibers (Kurth et al., 1996; Lin et al., 1989; Wu et al., 1999). The control of sarcolemmal ␤-catenin levels by the Ozz-E3 ligase during muscle development may have two functions: first, it could allow

Developmental Cell 280

the disassembly of myotendon-specific adherens junctions and the remodeling of the interaction between myotubes and tendon fibroblasts; second, it could permit the disassembly of Z-line–costamere connections, thus destabilizing the terminal sarcomeres to permit assembly of new sarcomeric units. Indeed, Ozz⫺/⫺ myofibers show several sarcomeric abnormalities, including high percentage of misaligned, split, or branched myofibrils. Until now, only integrin complexes had been clearly implicated in the regulation of myofibrillogenesis (McDonald et al., 1995; Schwander et al., 2003; Wu et al., 1999). In line with a recent finding that absence of cadherin-catenin complexes in N-cadherin⫺/⫺ cardiomyocytes did not interfere with myofibril formation but hampered myofibril alignment (Luo and Radice, 2003), we can speculate that in Ozz⫺/⫺ myocytes abnormal accumulation of these complexes perturbs the organized assembly and alignment of the myofibrils. This is supported by the evidence that expression in wild-type myocytes of two ␤-catenin mutants that reduce endogenous ␤-catenin binding to Ozz causes an accumulation of Mb-␤-catenin and recapitulates the myofibrillogenic defects observed in the Ozz⫺/⫺ myocytes. However, at present, we cannot exclude that other substrates of the Ozz-E3 ligase participate to the observed muscle phenotype. Finally, the unusual genomic organization of the Ozz and PPCA genes fosters the theory that mutations that affect the function of PPCA and cause galactosialidosis could impair the expression of Ozz as well. This hypothesis raises the possibility that the cardiomyopathy observed in some patients with galactosialidosis (d’Azzo et al., 2001) is caused by altered expression of Ozz. It is also conceivable that deregulation of the activity of Ozz-E3 in developing muscle fibers results in heart or skeletal muscle myopathies of unknown etiology. Experimental Procedures Plasmids and Antibodies Full-length Ozz cDNA was isolated from a murine heart cDNA library (Clontech); full-length murine ␤-catenin cDNA was obtained by RTPCR from heart polyA⫹ RNA; ␤TH was obtained by digesting ␤-catenin with EcoRI and XhoI; the ␤CT was amplified by PCR using the 5⬘ primer TCTGAGGACAAGCCACAGGAT and the 3⬘ primer TTA CAGGTCAGTATCAAACCA. All cDNAs were subcloned into pSCTOP (Fornerod et al., 1995), for in vitro transcription, and into the MSCVIRES-GFP plasmid (Persons et al., 1999), for retroviral infections. Polyclonal antibodies against Ozz were generated at Rockland. AntiElongin B was described previously (Kamura et al., 2000). All other monoclonal antibodies are commercially available: anti-myogenin (Pharmingen), anti-MyHC (MF-20, Developmental Studies Hybridoma Bank, University of Iowa), anti-␤-catenin and anti-M- and N-cadherin (Transduction Labs.), anti-Rbx1 (NeoMarkers), anti-actin (C2, Santa Cruz), anti-GFP (Clontech), anti-Elongin C (Transduction Labs), anti-Tenascin (clone Mtn-12, Sigma), anti-GAPDH (Chemicon), anti-sarcomeric ␣-actinin (clone EA53, Sigma), and anti-ubiquitin (Zymed). Oregon Green Phalloidin (Molecular Probes) was used to detect actin filaments. Generation of the Ozz⫺/⫺ Mice The murine Ozz gene, isolated from the 129sv genomic library, was targeted by homologous recombination in W9.5 ES cells using standard procedures (De Geest et al., 2002). Disruption of the Ozz gene was achieved by in-frame insertion of a lacZ-pGK-Neo cassette at a unique MluI site in exon 1 of the Ozz gene. Homologously recombined, G418-resistent ES clones were screened by PCR using

a reverse primer outside the targeting construct (CAGGCAGATCAT TGTGAGCTACA) in conjunction with two forward primers, the first located 104 nt downstream of the Ozz start codon (GCATGGACCC CTCAGGAACGC) and the second 500 nt upstream of the end of the lacZ/neo cassette (TGTATACGCTTGATCCGGCTAC). Five homologously recombined ES clones with a correct karyotype were injected into C57BL/6 blastocysts. Of five chimeric mice, two gave germline transmission and were crossed with both 129sv and C57BL/6 mice to generate Ozz-heterozygous animals, which were then interbred to obtain Ozz⫺/⫺ mice. Northern blot analyses were performed as described earlier (Bonten et al., 1996). Yeast Two-Hybrid Screening PCR fragments of full-length (bp 1–845) or truncated (bp 1–688) Ozz were subcloned in frame with the GAL4 DNA binding domain of the bait vector pPC97 (Vidal et al., 1996). Yeast strain MAV103 transformations, media preparation, and ␤-gal assays were performed using established protocols (Chevray and Nathans, 1992). MAV103 cells harboring the bait vectors were further transformed with 1 ␮g of an E14 mouse embryo cDNA library (a gift of Peter McKinnon, St. Jude Children’s Research Hospital) cloned downstream of the GAL4-activating domain of the prey plasmid pPC86 (Vidal et al., 1996). Satellite Cell Culture and Subcellular Fractionation Myoblast cultures were established as previously described (Bois and Grosveld, 2003; Hollenbach et al., 2002). For proteasomal inhibition, cells were incubated with 10 ␮M lactacystin (Calbiochem) for 3 hr. Retroviruses were produced as described (Persons et al., 1999) and added to the myoblast cultures in log-phase growth for 3 hr. Two to three days after infection, GFP-expressing myoblasts were sorted by FACS and plated onto collagen-coated dishes. Postnuclear lysates were prepared by lysis in situ with 50 mM Tris-HCl (pH 7.5), 250 mM NaCl, 1 mM EDTA, 1% NP-40 lysis buffer, and a cocktail of protease and phosphatase inhibitors for 15 min on ice; lysates were then centrifuged at 13,000 ⫻ g for 15 min at 4⬚C. To prepare subcellular fractions, cells or muscle tissues were incubated 15 min in ice-cold hypotonic buffer (10 mM Tris-HCl [pH 7.8], 1 mM CaCl2, 5 mM KCl, and a cocktail of protease and phosphatase inhibitors) and lysed using a Dounce homogenizer. Nuclear fractions were excluded by centrifugation at 700 ⫻ g for 5 min at 4⬚C, and the postnuclear supernatant was then centrifuged at 100,000 ⫻ g for 1 hr at 4⬚C. The resulting supernatant S100 was used as cytosolic fraction, while the P100 pellet was extracted on ice for 15 min in buffer containing 1% Triton X-100 and then subjected to an additional centrifugation at 100,000 ⫻ g for 1 hr at 4⬚C. The resulting pellet (membrane-fraction) was resuspended in buffer containing 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% Triton X-100, 1% SDS, 4 ␮g/ml lactacystin, and protease and phosphatase inhibitors. Ubiquitinated Mb-␤-catenin was assayed on membrane-fraction extracted in presence of N-ethylmaleimide (10 mM), immunoprecipitated with anti-␤-catenin antibody, and analyzed by immunoblotting with anti-ubiquitin antibody. For Western blot analysis, 5–10 ␮g of proteins was used. Turnover of Mb-␤-Catenin in Myocytes Ozz⫹/⫹ and Ozz⫺/⫺ myocytes were cultured for 30 min in leucinefree medium and radiolabeled for 2 hr with 0.5 mCi of 3H-Leucine (151 Ci/mmol, Amersham) per dish. Cells were then washed with PBS and chased for different time points in presence of cold leucine. Mb-proteins were prepared as described above and immunoprecipitated using anti-␤-catenin antibody. Immunoprecipitated samples were resolved by SDS-PAGE and visualized by autoradiography. The signal of each band was quantified using the Fovea Pro software (Reindeer Graphics) and normalized for the percentage of 3H-Leucine incorporated in each sample. Immunohistochemistry, Immunofluorescence, and Electron Microscopy E10 and E14.5 mouse embryos and adult tissues were fixed in 4% paraformaldehyde (PFA) and embedded in paraffin. Anti-Ozz immunolabeling was visualized with secondary antibodies conjugated to either Alexa568 (Molecular Probes) or HRP (Vector Labs). For double-immunolabeling, the incubation with anti-Ozz antibodies was

Ozz-E3 Regulates ␤-Catenin in Striated Muscle 281

followed by incubation with biotinylated anti-myogenin, -nestin, or -tenascin antibodies (Mouse-on-Mouse Iso-IHC kit, Innogenex); Ozz and Tenascin double immunostaining was performed on sections from flash-frozen E14.5 embryos fixed in 3% PFA for 20 min. For the electron microscopic studies, isolated muscles or myocytes grown on collagen-coated Thermanox coverslips (Nunc) were postfixed in 1% OsO4 and en bloc stained with 1% uranyl acetate. After standard dehydration, samples were infiltrated and embedded in Spurr low-viscosity resin (Electron Microscopy Sciences), and polymerized at 60⬚C for 18 hr. Semithin sections (0.5 ␮m) were stained with toluidine blue, and 600 to 900 A˚ sections were stained in grids with Reynold’s lead citrate and uranyl acetate. Immunofluorescence analyses were performed on cultured myocytes fixed in 3% PFA and stained as indicated. Alexa 594 antimouse IgG and Alexa 488 anti-rabbit IgG were used as secondary antibodies. Where indicated, images were analyzed with the confocal laser scanning microscope (LEICA TCS- NTSP) or with the multiphoton confocal laser scan microscopy system (Zeiss 510 NLO Meta). Acknowledgments We are indebted to Gerard Grosveld for his crucial suggestions and discussions; Charles Sherr, Brenda Schulman and Guillermo Oliver for critical reading of the manuscript and helpful comments; Brenda Schulman for sharing some of the ubiquitination reagents; Stephanie Newton for performing the two-hybrid yeast screening; Latham Fink for his assistance in generating the ␤-catenin mutants; Erik Bonten for his assistance with the insect cells and purification procedures; Jacqueline Bonten for maintaining the myoblast cultures; Ann Marie Hamilton-Easton and Richard Cross for performing FACS analyses; Ken Barnes and Kuruganti Murti for their assistance with the confocal analyses; and Charlette Hill and Angela McArthur for editing the manuscript. A.J.H. was supported by grants from the New Zealand Lottery Board and Foundation for Research Science & Technology (FRST). A.d’A. holds an Endowed Chair in Genetics and Gene Therapy from the Jewelers Charity Fund. These studies were supported in part by the National Institute of Health grant DK52025, the Cancer Center Support grant CA21765, Phillip and Elizabeth Gross, and the American Lebanese Syrian Associated Charities (ALSAC). Received: December 3, 2002 Revised: April 4, 2003 Accepted: December 19, 2003 Published: February 9, 2004 References

De Geest, N., Bonten, E., Mann, L., De Sousa-Hitzler, J., Hahn, C., and D’Azzo, A. (2002). Systemic and neurologic abnormalities distinguish the lysosomal disorders sialidosis and galactosialidosis in mice. Hum. Mol. Genet. 11, 1455–1464. Deblandre, G.A., Lai, E.C., and Kintner, C. (2001). Xenopus neuralized is a ubiquitin ligase that interacts with XDelta1 and regulates Notch signaling. Dev. Cell 1, 795–806. Dix, D.J., and Eisenberg, B.R. (1990). Myosin mRNA accumulation and myofibrillogenesis at the myotendinous junction of stretched muscle fibers. J. Cell Biol. 111, 1885–1894. Du, A., Sanger, J.M., Linask, K.K., and Sanger, J.W. (2003). Myofibrillogenesis in the first cardiomyocytes formed from isolated quail precardiac mesoderm. Dev. Biol. 257, 382–394. Fornerod, M., Boer, J., van Baal, S., Jaegle, M., von Lindern, M., Murti, K.G., Davis, D., Bonten, J., Buijs, A., and Grosveld, G. (1995). Relocation of the carboxyterminal part of CAN from the nuclear envelope to the nucleus as a result of leukemia-specific chromosome rearrangements. Oncogene 10, 1739–1749. Frosk, P., Weiler, T., Nylen, E., Sudha, T., Greenberg, C.R., Morgan, K., Fujiwara, T.M., and Wrogemann, K. (2002). Limb-girdle muscular dystrophy type 2H associated with mutation in TRIM32, a putative E3-ubiquitin-ligase gene. Am. J. Hum. Genet. 70, 663–672. Fujita, Y., Krause, G., Scheffner, M., Zechner, D., Leddy, H.E., Behrens, J., Sommer, T., and Birchmeier, W. (2002). Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. Nat. Cell Biol. 4, 222–231. Fukata, M., and Kaibuchi, K. (2001). Rho-family GTPases in cadherin-mediated cell-cell adhesion. Nat. Rev. Mol. Cell Biol. 2, 887–897. Goichberg, P., Shtutman, M., Ben-Ze’ev, A., and Geiger, B. (2001). Recruitment of beta-catenin to cadherin-mediated intercellular adhesions is involved in myogenic induction. J. Cell Sci. 114, 1309– 1319. Gottardi, C.J., and Gumbiner, B.M. (2001). Adhesion signaling: how ␤-catenin interacts with its partners. Curr. Biol. 11, R792–R794. Hecht, A., Litterst, C.M., Huber, O., and Kemler, R. (1999). Functional characterization of multiple transactivating elements in ␤-catenin, some of which interact with the TATA-binding protein in vitro. J. Biol. Chem. 274, 18017–18025. Hecht, A., Vleminckx, K., Stemmler, M.P., van Roy, F., and Kemler, R. (2000). The p300/CBP acetyltransferases function as transcriptional coactivators of ␤-catenin in vertebrates. EMBO J. 19, 1839–1850. Hershko, A., Ciechanover, A., and Varshavsky, A. (2000). Basic Medical Research Award. The ubiquitin system. Nat. Med. 6, 1073–1081.

Aberle, H., Butz, S., Stappert, J., Weissig, H., Kemler, R., and Hoschuetzky, H. (1994). Assembly of the cadherin-catenin complex in vitro with recombinant proteins. J. Cell Sci. 107, 3655–3663.

Hollenbach, A., McPherson, C., Lagutina, I., and Grosveld, G. (2002). The EF-hand calcium-binding protein calmyrin inhibits the transcriptional and DNA-binding activity of Pax3. Biochim. Biophys. Acta 93621, 1–8.

Bois, P.R., and Grosveld, G.C. (2003). FKHR (FOXO1a) is required for myotube fusion of primary mouse myoblasts. EMBO J. 22, 1147– 1157.

Huber, A.H., and Weis, W.I. (2001). The structure of the ␤-catenin/ E-cadherin complex and the molecular basis of diverse ligand recognition by ␤-catenin. Cell 105, 391–402.

Bonten, E., Spoel, A.v.d., Fornerod, M., Grosveld, G., and d’Azzo, A. (1996). Characterization of human lysosomal neuraminidase defines the molecular basis of the metabolic storage disorder sialidosis. Genes Dev. 10, 3156–3169. Centner, T., Yano, J., Kimura, E., McElhinny, A.S., Pelin, K., Witt, C.C., Bang, M.L., Trombitas, K., Granzier, H., Gregorio, C.C., et al. (2001). Identification of muscle specific ring finger proteins as potential regulators of the titin kinase domain. J. Mol. Biol. 306, 717–726. Chevray, P.M., and Nathans, D. (1992). Protein interaction cloning in yeast: identification of mammalian proteins that react with the leucine zipper of Jun. Proc. Natl. Acad. Sci. USA 89, 5789–5793. Ciechanover, A. (1994). The ubiquitin-proteasome proteolytic pathway. Cell 79, 13–21. d’Azzo, A., Andria, G., Strisciuglio, P., and Galjaard, H. (2001). Galactosialidosis. In The Metabolic and Molecular Bases of Inherited Disease, C. Scriver, A. Beaudet, W. Sly, and D. Valle, eds. (New York: McGraw-Hill Publishing Co.), pp. 3811–3826.

Jagoe, R.T., and Goldberg, A.L. (2001). What do we really know about the ubiquitin-proteasome pathway in muscle atrophy? Curr. Opin. Clin. Nutr. Metab. Care 4, 183–190. Kamura, T., Sato, S., Iwai, K., Czyzyk-Krzeska, M., Conaway, R.C., and Conaway, J.W. (2000). Activation of HIF1␣ ubiquitination by a reconstituted von Hippel-Lindau (VHL) tumor suppressor complex. Proc. Natl. Acad. Sci. USA 97, 10430–10435. Kamura, T., Burian, D., Yan, Q., Schmidt, S.L., Lane, W.S., Querido, E., Branton, P.E., Shilatifard, A., Conaway, R.C., and Conaway, J.W. (2001). Muf1, a novel Elongin BC-interacting leucine-rich repeat protein that can assemble with Cul5 and Rbx1 to reconstitute a ubiquitin ligase. J. Biol. Chem. 276, 29748–29753. Kang, J.S., Feinleib, J.L., Knox, S., Ketteringham, M.A., and Krauss, R.S. (2003). Promyogenic members of the Ig and cadherin families associate to positively regulate differentiation. Proc. Natl. Acad. Sci. USA 100, 3989–3994. Kaufmann, U., Kirsch, J., Irintchev, A., Wernig, A., and StarzinskiPowitz, A. (1999). The M-cadherin catenin complex interacts with

Developmental Cell 282

microtubules in skeletal muscle cells: implications for the fusion of myoblasts. J. Cell Sci. 112, 55–68.

myofibrillar proteins in rabbit muscle extracts. J. Biol. Chem. 271, 26690–26697.

Kemler, R. (1993). From cadherins to catenins: cytoplasmic protein interactions and regulation of cell adhesion. Trends Genet. 9, 317–321.

Song, A., Wang, Q., Goebl, M.G., and Harrington, M.A. (1998). Phosphorylation of nuclear MyoD is required for its rapid degradation. Mol. Cell. Biol. 18, 4994–4999.

Kibel, A., Iliopoulos, O., DeCaprio, J.A., and Kaelin, W.G., Jr. (1995). Binding of the von Hippel-Lindau tumor suppressor protein to Elongin B and C. Science 269, 1444–1446.

Spencer, J.A., Eliazer, S., Ilaria, R.L., Jr., Richardson, J.A., and Olson, E.N. (2000). Regulation of microtubule dynamics and myogenic differentiation by MURF, a striated muscle RING-finger protein. J. Cell Biol. 150, 771–784.

Kile, B.T., Schulman, B.A., Alexander, W.S., Nicola, N.A., Martin, H.M., and Hilton, D.J. (2002). The SOCS box: a tale of destruction and degradation. Trends Biochem. Sci. 27, 235–241. Kurth, T., Schwarz, H., Schneider, S., and Hausen, P. (1996). Fine structural immunocytochemistry of catenins in amphibian and mammalian muscle. Cell Tissue Res. 286, 1–12. Lai, E.C., Deblandre, G.A., Kintner, C., and Rubin, G.M. (2001). Drosophila neuralized is a ubiquitin ligase that promotes the internalization and degradation of delta. Dev. Cell 1, 783–794.

Stebbins, C.E., Kaelin, W.G., Jr., and Pavletich, N.P. (1999). Structure of the VHL-ElonginC-ElonginB complex: implications for VHL tumor suppressor function. Science 284, 455–461. Takemaru, K.I., and Moon, R.T. (2000). The transcriptional coactivator CBP interacts with ␤-catenin to activate gene expression. J. Cell Biol. 149, 249–254. Tisdale, M.J. (2002). Cachexia in cancer patients. Nat. Rev. Cancer 2, 862–871.

Lin, Z.X., Holtzer, S., Schultheiss, T., Murray, J., Masaki, T., Fischman, D.A., and Holtzer, H. (1989). Polygons and adhesion plaques and the disassembly and assembly of myofibrils in cardiac myocytes. J. Cell Biol. 108, 2355–2367.

Vidal, M., Brachmann, R.K., Fattaey, A., Harlow, E., and Boeke, J.D. (1996). Reverse two-hybrid and one-hybrid systems to detect dissociation of protein-protein and DNA-protein interactions. Proc. Natl. Acad. Sci. USA 93, 10315–10320.

Lorick, K.L., Jensen, J.P., Fang, S., Ong, A.M., Hatakeyama, S., and Weissman, A.M. (1999). RING fingers mediate ubiquitin-conjugating enzyme (E2)-dependent ubiquitination. Proc. Natl. Acad. Sci. USA 96, 11364–11369.

Winston, J.T., Strack, P., Beer-Romero, P., Chu, C.Y., Elledge, S.J., and Harper, J.W. (1999). The SCF␤-TRCP-ubiquitin ligase complex associates specifically with phosphorylated destruction motifs in I␬B␣ and ␤-catenin and stimulates I␬B␣ ubiquitination in vitro. Genes Dev. 13, 270–283.

Luo, Y., and Radice, G.L. (2003). Cadherin-mediated adhesion is essential for myofibril continuity across the plasma membrane but not for assembly of the contractile apparatus. J. Cell Sci. 116, 1471– 1479.

Wu, J.C., Chung, T.H., Tseng, Y.Z., and Wang, S.M. (1999). N-cadherin/catenin-based costameres in cultured chicken cardiomyocytes. J. Cell. Biochem. 75, 93–104.

Matsuzawa, S., and Reed, J.C. (2001). Siah-1, SIP, and Ebi collaborate in a novel pathway for ␤-catenin degradation linked to p53 responses. Mol. Cell 7, 915–926.

Yeh, E., Zhou, L., Rudzik, N., and Boulianne, G.L. (2000). Neuralized functions cell autonomously to regulate drosophila sense organ development. EMBO J. 19, 4827–4837.

McDonald, K.A., Lakonishok, M., and Horwitz, A.F. (1995). Alpha v and alpha 3 integrin subunits are associated with myofibrils during myofibrillogenesis. J. Cell Sci. 108, 2573–2581.

Yeh, E., Dermer, M., Commisso, C., Zhou, L., McGlade, C.J., and Boulianne, G.L. (2001). Neuralized functions as an E3 ubiquitin ligase during Drosophila development. Curr. Biol. 11, 1675–1679.

Molkentin, J.D., and Olson, E.N. (1996). Combinatorial control of muscle development by basic helix-loop-helix and MADS-box transcription factors. Proc. Natl. Acad. Sci. USA 93, 9366–9373.

Zhou, X.Y., Morreau, H., Rottier, R., Davis, D., Bonten, E., Gillemans, N., Wenger, D., Grosveld, F.G., Doherty, P., Suzuki, K., et al. (1995). Mouse model for the lysosomal disorder galactosialidosis and correction of the phenotype with over-expressing erythroid precursor cells. Genes Dev. 9, 2623–2634.

Moon, R.T., Bowerman, B., Boutros, M., and Perrimon, N. (2002). The promise and perils of Wnt signaling through beta-catenin. Science 296, 1644–1646. Nakamura, T., Sano, M., Songyang, Z., and Schneider, M.D. (2003). A Wnt- and ␤-catenin-dependent pathway for mammalian cardiac myogenesis. Proc. Natl. Acad. Sci. USA 100, 5834–5839. Paul, A.C., Sheard, P.W., Kaufman, S.J., and Duxson, M.J. (2002). Localization of alpha 7 integrins and dystrophin suggests potential for both lateral and longitudinal transmission of tension in large mammalian muscles. Cell Tissue Res. 308, 255–265. Persons, D.A., Allay, J.A., Allay, E.R., Ashmun, R.A., Orlic, D., Jane, S.M., Cunningham, J.M., and Nienhuis, A.W. (1999). Enforced expression of the GATA-2 transcription factor blocks normal hematopoiesis. Blood 93, 488–499. Petropoulos, H., and Skerjanc, I.S. (2002). Beta-catenin is essential and sufficient for skeletal myogenesis in P19 cells. J. Biol. Chem. 277, 15393–15399. Polesskaya, A., Seale, P., and Rudnicki, M.A. (2003). Wnt signaling induces the myogenic specification of resident CD45⫹ adult stem cells during muscle regeneration. Cell 113, 841–852. Rottier, R.J., and d’Azzo, A. (1997). Identification of the promoters for the human and murine protective protein/cathepsin A genes. DNA Cell Biol. 16, 599–610. Schmidt, M., Tanaka, M., and Munsterberg, A. (2000). Expression of (beta)-catenin in the developing chick myotome is regulated by myogenic signals. Development 127, 4105–4113. Schwander, M., Leu, M., Stumm, M., Dorchies, O.M., Ruegg, U.T., Schittny, J., and Muller, U. (2003). ␤1 integrins regulate myoblast fusion and sarcomere assembly. Dev. Cell 4, 673–685. Solomon, V., and Goldberg, A.L. (1996). Importance of the ATPubiquitin-proteasome pathway in the degradation of soluble and

Accession Numbers The Ozz sequence reported in this paper corresponds to AK004524.1.