p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons

YMCNE-02850; No of Pages 10 Molecular and Cellular Neuroscience xxx (2013) xxx–xxx

Contents lists available at ScienceDirect

Molecular and Cellular Neuroscience journal homepage: www.elsevier.com/locate/ymcne

3Q1

Monika Podkowa, Tania Christova, Xin Zhao, Yongqiang Jian, Liliana Attisano ⁎

4

Department of Biochemistry and Donnelly CCBR, University of Toronto, Toronto, ON, Canada

a r t i c l e

i n f o

O

R O

5

a b s t r a c t

Article history: Received 7 June 2013 Revised 1 October 2013 Accepted 8 October 2013 Available online xxxx

P

Bone Morphogenetic Proteins (BMPs) are crucial for many aspects of the development and differentiation of the nervous system and are important in controlling cytoskeletal remodeling during neuronal morphogenesis. BMPs are TGFβ superfamily members that signal through a heteromeric complex of type I and type II BMP receptors. The BMPRII receptor is particularly important in mediating remodeling of the neuronal cytoskeleton through the activation of BMPRII-bound cytoskeletal regulators, such as LIM Kinase (LIMK). Here, we show that PAK1, a key regulator of diverse neuronal processes and an upstream activator of LIMK, binds to the BMP type I receptor, ALK2. Although, PAK1 is dispensable for activation of the Smad transcriptional mediators, abrogation of PAK1 expression or inhibition of PAK1 activity prevents BMP-induced neurite outgrowth in cultured neuroblastoma cell lines. Moreover, in primary murine embryonic cortical neurons, inhibition of PAK activity blocks BMP7induced cofilin phosphorylation, prevents remodeling of the actin cytoskeleton and thereby blocks BMP7induced dendrite formation. Thus, we propose a model in which BMP7 signaling leads to the recruitment of ALK2-bound PAK1 to BMPRII, which binds a downstream regulator of the actin cytoskeleton, LIMK1, and that the BMP receptor complex thereby acts as a scaffold to localize and coordinate actin cytoskeletal remodeling. We propose that this scaffold plays a key role in mediating BMP7-dependent dendritogenesis in primary cortical neurons. © 2013 Published by Elsevier Inc.

T

E

D

Keywords: Bone Morphogenetic Proteins (BMP) Receptor serine threonine kinases p21-Activated kinase (PAK) LIM Kinase Cytoskeleton Neurons Dendritogenesis

C

6 7 8 9 10 11 13 12 14 15 16 17 18 19 20 21 22

E

42 41

Introduction

44 45

The acquisition of proper neuronal morphology comprised of one axon and multiple dendrites and the maintenance of the appropriate neuronal circuitry in adults require the coordinated remodeling of the neuronal cytoskeleton (Miller and Kaplan, 2003; Stiess and Bradke, 2011). Extracellular growth factors activate signaling pathways to change the activity, localization and stability of cytoskeletal regulators (Georges et al., 2008; Govek et al., 2005; Miller and Kaplan, 2003; Stiess and Bradke, 2011) and one such group of factors is the TGFβ superfamily members, Bone Morphogenetic Proteins (BMPs) (Miyazono et al., 2010; Sieber et al., 2009). BMPs play diverse roles throughout neuronal development by regulating neural stem cells, by specifying neural crest and by controlling the patterning of the dorsal–ventral axis in the spinal cord and brain (Bond et al., 2012; Sanchez-Camacho and Bovolenta, 2009). Moreover, BMPs can modulate neurite outgrowth acting to induce dendrite formation in cortical and hippocampal neurons, to spatially orient and control the rate of growth of commissural, spinal cord and retinal ganglion cell axons, and to regulate the formation of neuromuscular junctions (Henriquez et al., 2011; Hocking et al., 2009;

52 53 54 55 56 57 58 59 60 61

R

N C O

50 51

U

48 49

R

43

46 47

F

2Q2

p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons

1

⁎ Corresponding author at: Donnelly CCBR, Rm 1008, University of Toronto, 160 College Street, Toronto, ON M5S 3E1, Canada. E-mail address: [email protected] (L. Attisano).

23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 40 39

Lee-Hoeflich et al., 2004; Perron and Dodd, 2011; Podkowa et al., 2010; Wen et al., 2007). BMPs initiate signaling by binding to a complex of type I and type II Ser/Thr kinase receptors (Miyazono et al., 2010; Sieber et al., 2009) of which there are three type II receptors, BMPRII (BMPR2), ActRII (ACVR2A) and ActRIIB (ACVR2B) and three type I receptors, ALK2 (ACVR1), ALK3 (BMPRIA) and ALK6 (BMPRIB). Upon heteromeric complex formation, the type II receptor phosphorylates and thereby activates the type I receptor, which then propagates the signal to the universal intracellular mediators, the Smads, which control transcriptional outcome. Smad-independent pathways also contribute to the complex, cell-specific biological responses to BMPs (Mu et al., 2012), and those emanating from the BMP type II receptor, BMPRII are of particular importance for neuronal morphogenesis (Miyazono et al., 2010; Mu et al., 2012; Sieber et al., 2009). BMPRII is essential for the establishment of the basic embryonic body plan and dorsal–ventral specification (Beppu et al., 2000; Frisch and Wright, 1998; Suzuki et al., 1994) and is mutated in most cases of familial pulmonary arterial hypertension (PAH) (Morrell, 2011). Moreover, BMPRII is highly expressed in brain-derived tissues and similar to the Drosophila counterpart, Wishful Thinking (Wit), regulates diverse aspects of neuronal development and morphogenesis (Henriquez et al., 2011; Miyagi et al., 2011, 2012; Miyazono et al., 2010; SanchezCamacho and Bovolenta, 2009; Sieber et al., 2009). For example, Wit is required in the neuromuscular junction where it is involved in retrograde

1044-7431/$ – see front matter © 2013 Published by Elsevier Inc. http://dx.doi.org/10.1016/j.mcn.2013.10.005

Please cite this article as: Podkowa, M., et al., p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons, Mol. Cell. Neurosci. (2013), http://dx.doi.org/10.1016/j.mcn.2013.10.005

62 63 Q3 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86

110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 Q4 126 127 128 129 130 131 132 133

F

O

R O

108 109

136 137 138 139 140 141 142 143 144 145 146 147 148

PAK1 is required for BMP-induced neurite formation in neuroblastoma cells 150 BMPRII binds LIMK a regulator of the actin cytoskeleton to control BMP-dependent changes in neuronal morphology (Foletta et al., 2003; Hocking et al., 2009; Lee-Hoeflich et al., 2004), but how LIMK is activated is not known. Thus, we focused on examining the contribution of PAK1, a known activator of LIMK implicated in neuronal outgrowth (Chan and Manser, 2012; Kreis and Barnier, 2009; Nikolic, 2008) in mediating BMP effects on cytoskeletal remodeling. N1E115 cells are a mouse neuroblastoma cell line that forms neurite-like extensions upon overexpression of the microtubule associated protein, MAP2, and we previously showed that BMP7 enhances formation of neurites in these cells (Podkowa et al., 2010). Thus, we first examined the effect of inhibiting PAK activity on BMP7 mediated MAP2-dependent protrusion formation. For this, we used the cell permeant 18-mer PAK peptide inhibitor, PAK18, which prevents PAK activation by blocking PIX/PAK interactions together with the inactive variant, PAK18-R192A, as a control (Maruta et al., 2002; Santiago-Medina et al., 2013). As described previously (Podkowa et al., 2010), cells expressing GFP-MAP2 display an increase in the number of neuritic protrusions in the presence of BMP7. This effect was attenuated in the presence of the PAK18 inhibitor but not in the presence of the inactive peptide control (Fig. 1). Thus, PAK activity is required for BMP7-mediated neurite formation in NIE115 cells. We next sought to confirm the contribution of PAK in promoting BMP-induced protrusion formation in an alternative cell model and in response to another BMP family member, BMP2. Neuro2A cells are a mouse neural crest-derived neuroblastoma cell line that can be induced to differentiate into neurons by various stimuli including

P

106 107

149

Results

D

104 105

134 135

T

102 103

C

100 101

E

98 99

R

96 97

R

94 95

O

93

C

91 92

and Barnier, 2009; Nikolic, 2008). LIMK in turn mediates actin cytoskeleton remodeling by regulating actin filament turnover by phosphorylating, and thereby inactivating, the actin depolymerization and severing factor, ADF/cofilin (Bernard, 2007). To better understand how BMPs modulate neuronal morphology, we focused on PAKs and herein demonstrate that PAK1 interacts with the BMP type I receptor, ALK2 and that PAK activity is required for BMP-induced cytoskeletal remodeling and neurite outgrowth in cultured neuronal cells and for dendrite outgrowth in primary cortical neurons. Given that BMPRII binds LIMK (Foletta et al., 2003; Hocking et al., 2009; Lee-Hoeflich et al., 2004), altogether our studies suggest a model in which BMP induces formation of BMPRII–ALK2 receptor complex and thereby brings PAK1-bound ALK2 in close proximity to its downstream BMPRII-bound target, LIMK1, to promote localized remodeling of the actin cytoskeleton.

N

89 90

signaling and in synaptic stabilization (Aberle et al., 2002; Eaton and Davis, 2005; Haghighi et al., 2003; Marques and Zhang, 2006; Marques et al., 2002; Nahm et al., 2013; Ng, 2008) while BMPRII is required for dendritogenesis in murine cortical neurons and axon lengthening in retinal ganglion cells (Hocking et al., 2009; Lee-Hoeflich et al., 2004; Podkowa et al., 2010). BMPRII and Wit are unique amongst the TGFβ family receptors in that they are both comprised of a long carboxy-terminal extension (Miyazono et al., 2010; SanchezCamacho and Bovolenta, 2009; Sieber et al., 2009). This tail is dispensable for Smad regulated transcriptional responses but rather functions to mediate Smad-independent signals through binding of diverse cytoskeletal regulators such as LIM Kinase 1 (LIMK1) (Eaton and Davis, 2005; Foletta et al., 2003; Lee-Hoeflich et al., 2004), JNK (Podkowa et al., 2010), Tctex1 (Machado et al., 2003), Tbr3 (Chan et al., 2007) and Src (Wong et al., 2005). Indeed, LIMK binding to the BMPRII tail is required for BMP7-induced dendritogenesis in cortical neurons and for axon outgrowth in commissural neurons by inducing remodeling of the actin cytoskeleton (Hocking et al., 2009; Lee-Hoeflich et al., 2004). Similarly, in Drosophila, LIMK binds to and functions downstream of Wit to control synaptic stability (Eaton and Davis, 2005). A requirement for LIMK downstream of BMPRII in the de-epithelization step of neural crest epithelial to mesenchymal transition (EMT) has also been reported (Park and Gumbiner, 2012). JNK also binds to the BMPRII tail and promotes localized BMP-induced JNK activation to regulate the stability of dendritic microtubules (Podkowa et al., 2010). Thus, by scaffolding diverse cytoskeletal regulators, BMPRII plays an important role in mediating Smad-independent BMP signals to control neuronal morphogenesis and function. Small Rho GTPases such as Rac, Cdc42 and RhoA are major regulators of cytoskeletal dynamics and dendritic morphogenesis (EtienneManneville and Hall, 2002; Govek et al., 2005; Jaffe and Hall, 2005) that engage effector molecules such as PAKs (Chan and Manser, 2012; Kreis and Barnier, 2009; Nikolic, 2008). Of the six PAKs, Group I PAKs, PAK1 to 3, have been the most extensively studied and in neurons are important for neurite outgrowth, neuronal migration, spine morphology, and synaptic and behavioral plasticity and alterations in PAK activity are associated with neurodegenerative disorders (Chan and Manser, 2012; Kreis and Barnier, 2009; Nikolic, 2008). In basal conditions, PAK exists in a trans-inhibited homodimeric conformation, where the aminoterminal domain of one PAK molecule binds to and inhibits the carboxy-terminal kinase domain of the other (Lei et al., 2000; Parrini et al., 2002). Relief of this autoinhibition can be achieved by binding of an activated GTPase or by binding of α- or β-PIX, guanine nucleotide exchange factors (GEF), and is further maintained by multiple PAK autophosphorylation events. Once activated, PAKs phosphorylate and activate diverse targets such as LIMK1 (Chan and Manser, 2012; Kreis

U

87 88

M. Podkowa et al. / Molecular and Cellular Neuroscience xxx (2013) xxx–xxx

E

2

Fig. 1. Effect of inhibition of PAK activity on BMP7 mediated MAP2-dependent protrusion formation in N1E115 cells. PAK inhibition blocks BMP7 induced MAP2-dependent protrusion formation in N1E115 cells. (A) N1E115 cells transfected with MAP2-GFP were treated with PAK inhibitor or control peptide at 15 μM, incubated in the presence or absence of 3 nM BMP7 for 24 h and the number of protrusions was counted. (B) The percentage of cells in each category based on the number of protrusions formed (0–1, ≥2 protrusions) was plotted as a percent of total. Shown are the mean ± S.E.M. of three independent experiments with at least 40 cells analyzed per condition. (*p b 0.05, Student's t-test for the category ≥2).

Please cite this article as: Podkowa, M., et al., p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons, Mol. Cell. Neurosci. (2013), http://dx.doi.org/10.1016/j.mcn.2013.10.005

151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 Q5 172 173 174 175 176 177

M. Podkowa et al. / Molecular and Cellular Neuroscience xxx (2013) xxx–xxx

198 199 200 201 Q6 202 203 204 205 206 207

F

O

R O

BMP7 induces the formation of dendrites in primary neurons (Lee- 210 Hoeflich et al., 2004; Podkowa et al., 2010), thus we next sought to 211

P

195

D

193 194

196 197

PAKs are required for BMP7-induced dendrite formation in primary 208 cortical neurons 209

E

191 192

T

189 190

C

187 188

E

185 186

R

184

R

182 183

similar requirement for PAK1 in BMP7-induced neurite extension was also observed (Fig. 2E). In the canonical BMP signaling pathway, the type I receptor directly phosphorylates and thereby activates the Smad family of transcriptional regulators. However, abrogation of PAK1 expression had no effect on BMP2 or BMP7-induced Smad1 phosphorylation in Neuro2A or NIE115 cells (Figs. 2F and G), indicating that PAK1 is not required for Smad-mediated processes. Altogether, these results indicate that loss of PAK1 activity, either using siRNA-mediated abrogation of expression or using a specific, PAK peptide inhibitor, prevents BMP2 and/or BMP7induced neurite growth and extension in a Smad-independent manner in two established neuroblastoma cell lines.

N C O

180 181

serum-deprivation (Tremblay et al., 2010; Wu et al., 1998) and thus are useful for the study of the neurite outgrowth. We confirmed that Neuro2A cells express PAK1 as well as BMP receptors, including the type II receptors, BMPRII, ActRIIA, and ActRIIB by qPCR and that the cells are responsive to both BMP2 and BMP7 as measured by induction of Smad1 phosphorylation (see Figs. 2F and G and data not shown; (Du and Yip, 2010)). Thus, we next examined the effect of BMP2 on the growth of neurite-like extensions after a 24 h treatment in reduced-serum conditions. Serum-deprivation typically induces the formation of a single neurite in about 40% of cells and the total number of neurites per cell was not altered by the presence of BMP2 (Fig. 2A). However, analysis of neurite length revealed that the number of cells with longer neurites, quantitated by measuring length as fold over cell body diameter, was enhanced by BMP2 as compared to controls (Figs. 2A and B). We next examined the effect of abrogating PAK1 expression, using siRNAs, with knockdown efficiency confirmed by qPCR (Fig. 2C). This analysis revealed that loss of PAK1 expression attenuated the ability of BMP2 to enhance neurite length (Fig. 2B). A

U

178 179

3

Fig. 2. Effect of PAK1 on BMP-induced protrusion formation in Neuro2A cells. Neuro2A (A–G) or N1E115 (G, right panel) cells were transfected with siControl (siCTL) or siPAK1 and 24 h after transfection cells were incubated in medium containing 1% FBS in the presence or in the absence of 1 nM BMP2 (A–C), 3 nM BMP7 (D, E) for 1 day or for 1 h (F, G). (A) Representative microphotographs of Neuro2A cells, transfected with siCTL and siPAK1 with or without BMP2 are shown. (B) The ratio of neurite length/cell body diameter was calculated and the percentage of cells in each of 3 categories was plotted as a percentage of the total. Shown are the mean ± standard deviations of 3 replicates with 1000 cells analyzed per condition. (*p b 0.0005, Student's t-test for the category N4, for siCTL — versus +BMP2 (white *), or siCTL + BMP2 versus siPAK1 + BMP2 (black *)). (C) Expression of PAK1 was determined by qPCR to confirm knockdown efficiency. Relative gene expression is plotted as an average of three PCR replicates ± the range. (D) Expression of PAK1 was determined by immunoblotting in each of 3 replicate samples, to confirm knockdown efficiency. Dashed line on blots indicates removal of sample lanes. (E) The ratio of neurite length/cell body diameter was calculated and the percentage of cells in each of 3 categories was plotted as a percentage of the total. Shown are the mean ± standard deviations of 3 replicates with at least 50 cells analyzed per condition. (*p b 0.05, Student's t-test for the category N4, for siCTL + BMP7 versus siPAK1 + BMP7). (F and G) Lysates from Neuro2A or N1E115 cells, as indicated, were immunoblotted for phospho-Smad1/5/8, Smad1, PAK1 and for actin to verify equal protein loading.

Please cite this article as: Podkowa, M., et al., p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons, Mol. Cell. Neurosci. (2013), http://dx.doi.org/10.1016/j.mcn.2013.10.005

240 241 242 243 244 245 246 247 248 249 250 251 252 253 254

C

238 239

E

236 237

R

234 235

R

232 233

O

230 231

255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292

PAKs are required for BMP7-induced cytoskeletal remodeling and dendrite 293 formation in primary cortical neurons 294 LIMK is a key regulator of the actin cytoskeleton and is bound to 295 the BMPRII receptor where it functions to promote BMP-induced 296 dendritogenesis (Foletta et al., 2003; Lee-Hoeflich et al., 2004). PAK1 is 297

C

225 226

N

223 224

U

221 222

F

To better understand at the molecular level, how PAK1 might function in BMP signaling pathways, we examined whether PAK1 could associate with BMP receptors. BMPs efficiently signal through any one of the three type I receptors, ALK2, ALK3 and ALK6 (Miyazono et al., 2010; Sieber et al., 2009) and we selected one of these, ALK2, for a detailed study. We first assessed whether PAK1 interacts with ALK2 using the LUMIER method (Barrios-Rodiles et al., 2005; Miller et al., 2009; Narimatsu et al., 2009; Taipale et al., 2012; Varelas et al., 2010). Lysates from COS1 cells transfected with Flag-PAK1 and ALK2-Renilla Luciferase (ALK2Rluc), were subjected to anti-Flag immunoprecipitation and associated ALK2-Rluc was detected by measuring luciferase activity (Fig. 4). We observed a strong interaction of ALK2 with PAK1 (Fig. 4A). To determine if the activation status of PAK1 has an effect on the binding to ALK2, we tested the association of PAK1 wild type (WT) or kinase-dead (KR) Flag-PAK1 with ALK2-Renilla Luciferase (ALK2-Rluc). We observed a strong interaction of ALK2 with the wild-type PAK1, however the interaction was lost when the kinase inactive version of PAK1 was tested (Fig. 4A), demonstrating that intact PAK1 kinase activity is required for receptor association. We next assessed whether the activation status of the BMP type I receptor, ALK2, has an effect on the binding of PAK1. For this, we examined the interaction of PAK1 with various versions of the ALK2 receptor including the wild type (WT), a kinase-deficient (KR) variant and the Q207D mutant of ALK2 (QD), which can constitutively phosphorylate Smad1 and thereby activate Smad1-mediated transcriptional responses in the absence of ligand (Fukuda et al., 2009; Wieser et al., 1995). LUMIER analysis demonstrated that PAK1 efficiently

219 220

O

229

218 Q7

R O

PAK1 interacts with BMP type I receptor, ALK2

216 217

P

228

214 215

interacted with all of the ALK2 variants, with a modest enhancement of interaction with the kinase-deficient receptor detected (Fig. 4B). The absence of appropriate ALK2 antibodies prevents analysis of the association of endogenous ALK2 with PAK1. However, interaction of endogenous PAK1 with transfected ALK2-Flag in the neuronally-derived Neuro2A and NIE115 cells was confirmed by immunoprecipitation with either anti-PAK1 or anti-Flag antibodies followed by immunoblotting (Figs. 4C and D). BMP receptors form a heteromeric receptor complex comprised of type I and type II Ser/Thr kinase receptors, in which the type II receptor phosphorylates and thereby activates the type I receptor (Miyazono et al., 2010; Sieber et al., 2009). Thus, we next examined whether PAK1 can interact with this complex. Lysates from COS-1 cells transfected with Flag-PAK1, ALK2-HA and the BMP type II receptor, BMPRII tagged with Renilla Luciferase (BMPRII-Rluc), were subjected to anti-Flag PAK1 immunoprecipitation and associated BMPRII-Rluc was detected by measuring luciferase activity. This analysis revealed that PAK1 does not interact with BMPRII when BMPRII is expressed alone (Fig. 4E). However, in cells coexpressing ALK2, which forms a complex with BMPRII, an association between PAK1 and BMPRII was observed. Thus, our biochemical analysis demonstrates that PAK1 associates with the BMP receptor complex via ALK2 and would be appropriately positioned to activate downstream BMPRII-bound targets such as LIMK1. To gain further insights into the interaction, PAK1 deletion mutants were tested for association with ALK2 by LUMIER. As previously shown (Fig. 4) full-length wild type PAK1 interacts with ALK while the kinase-dead (KR) version does not (Figs. 5A–D). Amino-terminal deletions of PAK1 lacking the Rac/Cdc42 binding and autoinhibitory domains, PBD/AI (PAK1: 150-545 and PAK1: 171-545) retained the ability to interact with ALK2 while versions of PAK1 with carboxyterminal kinase domain deletions (PAK1: 1-350 and PAK1: 1-171) did not. Consistent with this, a construct comprised of only the kinase domain (PAK1: 249-545) interacted with ALK2. Further analysis of kinase subdomains using constructs lacking (PAK1: 171-350) or retaining (PAK1: 350-545) the C-lobe demonstrated that the C-lobe was required for interactions with ALK2. Similar results were obtained with both kinase-dead (Fig. 5) or wild type (not shown) ALK2. Altogether, these results indicate that both intact kinase activity and the C-lobe of the kinase are required for interaction with ALK2.

T

227

examine the role of PAKs in BMP7-induced dendritogenesis in this context. For this, primary embryonic mouse cortical neurons were transfected with a GFP-encoding adenoviral vector to facilitate the visualization of dendrites and dendrite formation, confirmed by MAP2 co-staining, in GFP-positive cells was determined. In cultures stimulated with BMP7, we observed an increase of 40% in the number of primary dendrites (Figs. 3A and B), as compared to control cells, as previously described (Lee-Hoeflich et al., 2004; Podkowa et al., 2010). Similar results were observed in cells treated with a control peptide. However, in neurons incubated with the PAK18 inhibitor, BMP7-dependent dendrite formation was completely abolished (Figs. 3A and B). Thus, PAKs are required for BMP7-induced dendrite formation in primary neurons. Taken together with our results on BMP-dependent neurite induction in cultured neuroblastoma cells, our results indicate that PAK1 plays a role in BMP-induced alterations of neuronal morphology in diverse cell contexts.

D

212 213

M. Podkowa et al. / Molecular and Cellular Neuroscience xxx (2013) xxx–xxx

E

4

Fig. 3. BMP7-induced PAK activation is required for dendrite formation in primary cortical neurons. (A, B) Inhibition of PAK blocks BMP-dependent dendrite formation. Primary cortical neurons expressing GFP were incubated with the PAK18 inhibitor or control peptide at 15 μM in the presence or absence of 3 nM BMP7 for 48 h after 4 DIV. The number of dendrites per neuron in GFP-positive cells (A) that co-stained with the dendrite specific Map2 (a + b) antibody (not shown) was determined. (B) Quantitation (mean ± st.dev.) of three representative experiments is shown with at least 20 neurons analyzed per condition. (*p b 0.05, Student's t-test).

Please cite this article as: Podkowa, M., et al., p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons, Mol. Cell. Neurosci. (2013), http://dx.doi.org/10.1016/j.mcn.2013.10.005

5

N C O

R

R

E

C

T

E

D

P

R O

O

F

M. Podkowa et al. / Molecular and Cellular Neuroscience xxx (2013) xxx–xxx

U

Fig. 4. PAK1 interacts with ALK2 within the BMP receptor complex. (A and B) Characterization of PAK1 binding to ALK2. Lysates from COS-1 cells transfected with wild-type (wt) or kinasedead (KR) Flag-PAK1 and wild-type (wt), kinase dead (KR) or activated (QD) variant of ALK2-Renilla Luciferase (ALK2-RLuc) were subjected to anti-Flag immunoprecipitation and associated ALK2-RLuc was detected by measuring luciferase activity. Total ALK2-RLuc levels were measured from total cell lysates and total levels of Flag-PAK1 were visualized by antiFlag immunoblotting. (C and D) Endogenous PAK1 associates with ALK2-Flag. Neuro2A (C) or N1E115 (D) cells were transfected with ALK2-Flag and cell lysates subjected to anti-Flag, anti-PAK1 or control anti-IgG immunoprecipitation followed by anti-PAK1 or anti-Flag immunoblotting, respectively. (E) PAK1 binds to the BMP receptor complex. Lysates from COS-1 cells transfected with Flag-PAK1, ALK2-HA and BMPRII-Renilla Luciferase (BMPRII-RLuc), were subjected to anti-Flag immunoprecipitation, and associated BMPRII-RLuc was detected by measuring luciferase activity. The data was corrected to total BMPRII-RLuc levels measured from total cell lysates. Total levels of Flag-PAK1 and ALK2-HA were visualized by antiFlag and anti-HA immunoblotting.

298 299 300 301 302 303 Q8 304 305 306 307 308 309

an upstream activator of LIMK1 and is required for BMP-induced dendritogenesis (Fig. 3), thus we sought to determine whether PAKs are specifically involved in BMP7-mediated reorganization of the neuronal cytoskeleton. For this, mouse primary cortical neurons were treated with BMP7 and the extent of actin remodeling was determined by phalloidin staining using immunofluorescence microscopy. The addition of BMP7 induced a rapid remodeling of the actin at the tips of dendrites, a region corresponding to the neuronal growth cone (Fig. 6) as visualized by intense phalloidin staining. Remarkably, the addition of the PAK18 inhibitor abrogated BMP7-induced remodeling of the actin cytoskeleton (Fig. 6). These results are consistent with the notion that PAK is required for BMP7-induced actin remodeling.

PAKs are required for BMP7-induced cofilin phosphorylation

310

ADF/cofilin is phosphorylated by LIMK on Ser3 and is essential for the rapid turnover of actin filaments. We previously showed that BMP7 enhances cofilin phosphorylation in the tips of dendrites (LeeHoeflich et al., 2004), thus we next determined whether PAKs are also required for this event. In cells treated with BMP7 for 10 min, there was an increase in phospho-cofilin staining at dendrite tips, with almost 95% of neurons displaying three or greater phospho-cofilin positive dendrites as compared to 50% in controls (Figs. 7A and B). The PAK18 peptide inhibitor reduced the basal levels of phospho-cofilin prior to BMP7 addition, but more importantly, completely blocked the BMP7-

311

Please cite this article as: Podkowa, M., et al., p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons, Mol. Cell. Neurosci. (2013), http://dx.doi.org/10.1016/j.mcn.2013.10.005

312 313 314 315 316 317 318 319 320

M. Podkowa et al. / Molecular and Cellular Neuroscience xxx (2013) xxx–xxx

C

T

E

D

P

R O

O

F

6

321 322

O

R

R

E

Fig. 5. Mapping of PAK1 binding to the BMP type I receptor, ALK2. (A) Schematic representation of PAK1 domains and PAK1 deletion mutant constructs. The Rac/Cdc42-binding domain (PBD) overlaps with the autoinhibitory domain (AI). The five PXXP putative SH3-binding motifs in PAK1, numbered black boxes, the non-canonical PIX/Cool SH3-binding motif (PIX), an acidic residue rich region (ED) and the C-terminal kinase domain and the location of the KR mutation in the kinase-dead PAK1 (*) are displayed. The ability of the indicated constructs to interact with ALK2 is indicated (+/−). (B–D) Cell lysates from HEK293T cells transfected with wild-type (wt), kinase-dead (KR) or deletion mutants of Flag-PAK1 and kinase-dead ALK2Renilla Luciferase (ALK2-KR-RLuc), were subjected to anti-Flag immunoprecipitation and associated ALK2-RLuc was detected by measuring luciferase activity (as depicted in B). The data was corrected for total BMPRII-RLuc levels measured from cell lysates and plotted relative to ALK2-KR-Rluc alone controls. Total levels of Flag-PAK were visualized by anti-Flag immunoblotting (C–D). Dashed lines on blots indicate removal of a sample lane.

329

Discussion

330 331

Bone Morphogenetic Proteins (BMPs) control many crucial steps during the differentiation and morphogenesis of the nervous system (Bond et al., 2012; Sanchez-Camacho and Bovolenta, 2009; Sieber et al., 2009). BMPs function by binding type I and type II Ser/Thr kinase receptors, which transduce the signal to intracellular mediator proteins, Smads, to regulate transcription (Miyazono et al., 2010; Sieber et al., 2009). In addition, Smad-independent pathways that mediate cell specific responses have been uncovered (Mu et al., 2012). For instance, BMPs directly modulate the neuronal cytoskeleton by regulating the activity of BMPRII-bound cytoskeletal regulators, LIMK1 and JNKs (Eaton and Davis, 2005; Foletta et al., 2003; Hocking et al., 2009; Lee-

332 333 334 335 336 337 338 339 340

N

325 326

U

323 324

C

327 328

induced increase. Since LIMKs are the only kinases known to induce phosphorylation of cofilin (Bernard, 2007), these observations indicate that PAKs are required for BMP-induced LIMK activation and subsequent phosphorylation of cofilin. In summary, our analysis indicates that PAK1 binds to the BMP type I receptor, ALK2 and that PAKs are required for BMP-induced cofilin phosphorylation, actin remodeling and extension of neurites in cultured cells and dendrites in primary neurons.

Hoeflich et al., 2004; Podkowa et al., 2010). Here, we identify PAK1 as a novel interaction partner of the BMP type I receptor, ALK2 and show that PAKs are required for BMP-induced remodeling of the actin cytoskeleton, for inducing of neurite growth in neuroblastoma cells and for promoting dendritogenesis in primary neurons. Taken together, our studies suggest a model in which BMP binding induces formation of a heteromeric receptor complex that brings BMPRII-bound LIMK1 close to its upstream activator, ALK2-bound PAK1 (Fig. 7C). We propose that the BMP receptor complex thereby acts as a membranelocalized platform where cytoskeletal regulators are assembled to control remodeling of the cytoskeleton in the neuronal growth cone during BMP-induced dendritogenesis. Consistent with a highly enriched neuronal distribution, PAKs have been shown to have key developmental functions in the nervous system, particularly with respect to dendrite formation and synaptic plasticity. Expression of dominant-negative PAK1 in the mouse forebrain affects synapse morphology and long-term memory consolidation, and PAK1 null mice display reduced hippocampal longterm potentiation (LTP), while PAK1/3 double knockout mice have markedly simplified dendritic arbors and axons and reduced synapse density (Hayashi et al., 2004; Huang et al., 2011; Kreis and Barnier, 2009). PAKs function by regulating phosphorylation of numerous

Please cite this article as: Podkowa, M., et al., p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons, Mol. Cell. Neurosci. (2013), http://dx.doi.org/10.1016/j.mcn.2013.10.005

341 342 343 344 345 Q9 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362

7

E

C

T

E

D

P

R O

O

F

M. Podkowa et al. / Molecular and Cellular Neuroscience xxx (2013) xxx–xxx

365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383

downstream targets. Phosphorylation of LIMK1 at Thr508 by PAK triggers phosphorylation of cofilin, a cytoskeletal protein that acts as an actin capping and severing protein (Bernard, 2007). In both of the above-mentioned studies of PAK1 and PAK1/3 knockout mice, the authors attribute the observed synaptic defects to a loss of LIMKmediated cofilin phosphorylation and the concomitant disruption of the actin cytoskeleton (Asrar et al., 2009; Huang et al., 2011). This is in agreement with our work showing that cofilin phosphorylation and actin cytoskeletal remodeling induced by BMP require PAK activity. PAK has also been shown to be involved in the phosphorylation of proteins that control microtubule dynamics such as Stathmin (Daub et al., 2001). Thus, in future studies it would be of interest to determine whether the binding of PAK1 to ALK2 is also required for BMPdependent microtubule remodeling that is mediated by JNK in cortical neurons (Podkowa et al., 2010). Here we have shown that PAK1 associates with the cell-surface localized BMP receptor complex. Localization of proteins in cellular compartments is especially critical in processes such as cortical dendrite formation. Indeed membrane localization of PAK1 has been shown to be required for neuronal polarization in hippocampal neurons (Jacobs et al., 2007) and it has long been known that forced membrane

U

363 364

N C O

R

R

Fig. 6. PAK is required for BMP-induced actin remodeling in primary cortical neurons. Primary cortical neurons were incubated with the PAK18 inhibitor or control peptide at 15 μM and treated with 3 nM BMP7 for 15 and 30 min. Actin remodeling was visualized by immunofluorescence microscopy using Alexa Fluor 568 phalloidin and dendritic protrusions visualized using anti-tubulin antibody. The number of actin-enriched neurites (arrow) was determined and is plotted as a percentage of the total. The mean ± S.E.M. of a representative experiment with at least 20 neurons analyzed per condition is shown. (*p b 0.05, Student's t-test for the category N5 for control — versus +BMP7 (white *), and for control versus PAK inhibitor + BMP7 (black*)).

targeting of PAK can induce neurite outgrowth (Daniels et al., 1998). Nevertheless, mechanisms whereby PAKs are recruited to the membrane remain unclear. PAK kinases contain an amino-terminal autoinhibitory region, which binds to the carboxy-terminal kinase domain and thereby blocks kinase activity. Relief of autoinhibition is achieved by conformational changes induced by binding of the upstream activated GTPases and/or the guanine nucleotide exchange factors (GEFs) such as α- and β-PIX and is further maintained by multiple PAK autophosphorylation events (Chan and Manser, 2012; Kreis and Barnier, 2009; Nikolic, 2008). Our biochemical analyses indicate that PAK1 kinase activity, which can reinforce the open PAK1 conformation, is required for association with ALK2. We and others have shown previously that BMPs can induce Cdc42 activation (Gamell et al., 2008, 2011; Lee-Hoeflich et al., 2004), thus it is tempting to speculate that BMP-activated Cdc42 induces a relief of PAK autoinhibition that allows for PAK1 binding to the BMP type I receptor. A role for BMP2-induced activation of PAK1 and PAK4 in the regulation of actin assembly and cell migration of C2C12 cells has been previously reported (Gamell et al., 2008, 2011) and here we showed that PAK is also required for both BMP2 and BMP7-induced cytoskeletal remodeling in neuronal cells. BMPs are members of the

Please cite this article as: Podkowa, M., et al., p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons, Mol. Cell. Neurosci. (2013), http://dx.doi.org/10.1016/j.mcn.2013.10.005

384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404

M. Podkowa et al. / Molecular and Cellular Neuroscience xxx (2013) xxx–xxx

D

P

R O

O

F

8

405 406

C

T

E

Fig. 7. PAK1 is required for BMP-induced cofilin phosphorylation in primary cortical neurons. Primary cortical neurons were treated with PAK18 inhibitor or control peptide at 15 μM and were incubated with or without 3 nM BMP7 for 10 min. (A) Localization of phosphorylated cofilin at neurite tips in primary cortical neurons was determined by immunofluorescence microscopy using anti-phospho-cofilin antibody. (B) The number of phospho-cofilin positive neurites (arrow) was counted and is plotted as a percentage of the total. Shown is the mean ± SD for 2 independent experiments with at least 30 neurons per condition determined in each experiment. (*p ≤ 0.05, Student's t-test, for the category N5, for — versus +BMP7 (white *) and for control versus PAK inhibitor + BMP7 (black *)). (C) A model for BMP-induced actin remodeling and activation of LIMK1 via PAK1. BMP7 ligand binding induces formation of the BMP receptor complex comprised of BMPRII and ALK2. ALK2-bound PAK1 is activated, likely through Cdc42/PIX and is brought in close proximity to BMPRII, which scaffolds LIMK1, a PAK1 substrate and actin cytoskeletal regulator. PAK1 phosphorylates and activates LIMK, inducing phosphorylation of cofilin, which promotes actin cytoskeletal remodeling and dendrite outgrowth.

419

Experimental methods

420

Constructs and vectors

421

426 427

PAK1 constructs (Knaus et al., 1995) provided by Dr. Jonathan Chernoff (Fox Chase Cancer Center) and PAK3 (Allen et al., 1998), provided by Dr. Richard Cerione (Cornell University, Ithaca, NY), were epitope-tagged and subcloned into pCMV5. Mutant derivatives PAK1 were generated by PCR. BMPRII, LIMK1, and JNK1, 2, and 3 were previously described (Lee-Hoeflich et al., 2004; Podkowa et al., 2010). BMPRII and ALK2 were Renilla Luciferase-tagged for LUMIER.

428

Biochemical assays and antibodies

429

Immunoprecipitation and immunoblotting were conducted as described previously (Labbe et al., 2000). Analysis of interactions

414 415 416 417

422 423 424 425

430

R

R

O

412 413

C

410 411

N

409

U

407 408

E

418

TGFβ superfamily and although BMPs and TGFβ signal through unique receptors, previous studies have also indicated that PAKs can mediate non-Smad TGFβ signals in some cell contexts (Wilkes et al., 2003) and that PAK1 can bind to the TGFβ type I receptor in the establishment of epithelial cell polarity (Barrios-Rodiles et al., 2005). Whether PAK can interact with all TGFβ family type I receptors, has not been carefully examined. Nevertheless, coupled with our work, these findings indicate a conserved role for PAK in signaling pathways activated by several members of the TGFβ superfamily including TGFβ, BMP2 and BMP7, in diverse processes involving cytoskeletal remodeling. Whether receptor binding by PAK1 is required for only a subset of TGFβ/BMP signals where precise patterns of localized activation are essential, such as the process of neuronal polarization described herein, or whether this is a universal mechanism requires further investigation.

between Renilla Luciferase (RLuc) and Flag-tagged proteins was performed using LUMIER, a luminescence-based strategy for the detection of mammalian protein-protein interactions (Barrios-Rodiles et al., 2005; Miller et al., 2009; Narimatsu et al., 2009; Taipale et al., 2012; Varelas et al., 2010). The Renilla Luciferase enzymatic assay was performed on anti-Flag immunoprecipitates to determine protein interactions. Total levels of proteins fused to Renilla Luciferase were measured from total cell lysates, and total levels of Flag-tagged or HA-tagged proteins were visualized by anti-Flag M2 (Sigma-Aldrich) or anti-HA (Santa Cruz Biotechnology) immunoblotting. Other antibodies used include anti-PAK (Santa Cruz Biotechnology), anti-Smad1 (Invitrogen), anti-phospho-Smad1/5 (Ser463/465), Smad8 (Ser426/ 428) (Cell Signaling Technology), and anti-actin (Sigma-Aldrich).

431 432

Dendritogenesis and cytoskeletal remodeling in primary cortical neurons

444

Primary cortical neurons were isolated and infected with recombinant adenoviruses as previously described (Lee-Hoeflich et al., 2004; Podkowa et al., 2010). To examine the effect of the PAK inhibitor on dendritogenesis, cells were transfected with a GFP expressing plasmid using Lipofectamine 2000 (Invitrogen) at 3 days in vitro. At 24 hours post-transfection, neuronal cultures were treated with the cellpermeable peptide PAK inhibitor, (p21-Activated Kinase Inhibitor, Calbiochem #506101), or the control peptide (Calbiochem #506102) at 15 μM and cultured in the presence or absence of 3 nM BMP7 for 48 h. The number of primary dendrites in GFP-expressing neurons was quantitated by blinded counting of at least 20 neurons per treatment condition. To examine the effect of the PAK inhibitor on actin remodeling, primary cortical neurons were incubated with 15 μM of PAK18 peptide that inhibits PAK1-3 (Maruta et al., 2002; Santiago-Medina et al.,

445 446

Please cite this article as: Podkowa, M., et al., p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons, Mol. Cell. Neurosci. (2013), http://dx.doi.org/10.1016/j.mcn.2013.10.005

433 434 435 436 437 438 439 440 441 442 443

447 448 449 450 451 452 453 454 455 456 457 458 459

M. Podkowa et al. / Molecular and Cellular Neuroscience xxx (2013) xxx–xxx

460 461

490 491

494 495

N1E115, mouse neuroblastoma cells, were transfected with GFPMAP2 using Turbofect (Fermentas), treated with 3 nM BMP7 and fixed with 4% paraformaldehyde 24 h after ligand addition as previously described (Podkowa et al., 2010). For PAK inhibitor studies, cells were pretreated with the PAK18 or the control peptide for 30 min prior to BMP7 addition.

496

Quantitative real-time PCR

497

506 507

Total RNA was isolated using the PureLink Mini Kit (Invitrogen) according to the manufacturer's instructions. cDNA was generated from the purified mRNA using oligo-dT primers and reverse transcriptase (Fermentas, Burlington, ON, Canada). Real-time PCR was performed using the SYBR Green PCR master mix (Applied Biosystems, USA) on the ABI Prism 7900 HT system (Applied Biosystems, USA) using validated primers for PAK1 (Forward: 5′ GAGGCTCAGCTAAAGAGCT GCTG 3′, Reverse: 5′GGTCGGAGTTCCTGAAACAAGTG 3′) and for GAPDH (Forward: 5′ CACACCGACCTTCACCATTTT 3′, Reverse: 5′ GAG ACAGCCGCATCTTCTTGT 3′). Gene expression was normalized to GAPDH and relative quantitation was calculated by the ΔΔCt method.

508

Acknowledgments

509 510 511

This work was supported by the Grant #178082 to L.A. from the Canadian Institute for Health Research (CIHR). L.A. is a Canada Research Chair.

512

References

513 514 515

Aberle, H., Haghighi, A.P., Fetter, R.D., McCabe, B.D., Magalhaes, T.R., Goodman, C.S., 2002. Wishful thinking encodes a BMP type II receptor that regulates synaptic growth in Drosophila. Neuron 33, 545–558.

498 499 500 501 502 503 504 505

C

E

R

492 493

R

485 486

N C O

484

U

482 483

O

MAP2-dependent protrusion formation in N1E115 cells

480 481

R O

489

478 479

P

487 488

Neuro2A cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% fetal bovine serum (FBS, Hyclone). For small interfering RNA (siRNA) silencing, cells were transfected with 80 pmol/well of control or PAK1 siRNA (Thermo Fisher Scientific, Dharmacon, Lafayette, CO, USA) by reverse-transfection in a 24-well plate using Lipofectamine RNAiMAX reagent (Invitrogen) as directed by the manufacturer. One day after transfection, cells were incubated in DMEM containing 1% FBS with or without 1 nM BMP2 or 3 nM BMP7 for 24 h. Bright field images were taken with a Zeiss inverted microscope equipped with a CCD camera (Hamamatsu Photonic Systems) and the neurite length and cell body diameter of neuritebearing cells were measured using Velocity 4 (Improvision) software. The ratio of neurite length to cell body diameter was calculated and the percentage of cells in the indicated categories was determined.

476 477

D

475

E

Differentiation assays in Neuro2A cells

T

474

Allen, K.M., Gleeson, J.G., Bagrodia, S., Partington, M.W., MacMillan, J.C., Cerione, R.A., Mulley, J.C., Walsh, C.A., 1998. PAK3 mutation in nonsyndromic X-linked mental retardation. Nat. Genet. 20, 25–30. Asrar, S., Meng, Y., Zhou, Z., Todorovski, Z., Huang, W.W., Jia, Z., 2009. Regulation of hippocampal long-term potentiation by p21-activated protein kinase 1 (PAK1). Neuropharmacology 56, 73–80. Barrios-Rodiles, M., Brown, K.R., Ozdamar, B., Bose, R., Liu, Z., Donovan, R.S., Shinjo, F., Liu, Y., Dembowy, J., Taylor, I.W., Luga, V., Przulj, N., Robinson, M., Suzuki, H., Hayashizaki, Y., Jurisica, I., Wrana, J.L., 2005. High-throughput mapping of a dynamic signaling network in mammalian cells. Science 307, 1621–1625. Beppu, H., Kawabata, M., Hamamoto, T., Chytil, A., Minowa, O., Noda, T., Miyazono, K., 2000. BMP type II receptor is required for gastrulation and early development of mouse embryos. Dev. Biol. 221, 249–258. Bernard, O., 2007. Lim kinases, regulators of actin dynamics. Int. J. Biochem. Cell Biol. 39, 1071–1076. Bond, A.M., Bhalala, O.G., Kessler, J.A., 2012. The dynamic role of bone morphogenetic proteins in neural stem cell fate and maturation. Dev. Neurobiol. 72, 1068–1084. Chan, P.M., Manser, E., 2012. PAKs in human disease. Prog. Mol. Biol. Transl. Sci. 106, 171–187. Chan, M.C., Nguyen, P.H., Davis, B.N., Ohoka, N., Hayashi, H., Du, K., Lagna, G., Hata, A., 2007. A novel regulatory mechanism of the bone morphogenetic protein (BMP) signaling pathway involving the carboxyl-terminal tail domain of BMP type II receptor. Mol. Cell Biol. 27, 5776–5789. Daniels, R.H., Hall, P.S., Bokoch, G.M., 1998. Membrane targeting of p21-activated kinase 1 (PAK1) induces neurite outgrowth from PC12 cells. EMBO J. 17, 754–764. Daub, H., Gevaert, K., Vandekerckhove, J., Sobel, A., Hall, A., 2001. Rac/Cdc42 and p65PAK regulate the microtubule-destabilizing protein stathmin through phosphorylation at serine 16. J. Biol. Chem. 276, 1677–1680. Du, Y., Yip, H., 2010. Effects of bone morphogenetic protein 2 on Id expression and neuroblastoma cell differentiation. Differentiation 79, 84–92. Eaton, B.A., Davis, G.W., 2005. LIM Kinase1 controls synaptic stability downstream of the type II BMP receptor. Neuron 47, 695–708. Etienne-Manneville, S., Hall, A., 2002. Rho GTPases in cell biology. Nature 420, 629–635. Foletta, V.C., Lim, M.A., Soosairajah, J., Kelly, A.P., Stanley, E.G., Shannon, M., He, W., Das, S., Massague, J., Bernard, O., 2003. Direct signaling by the BMP type II receptor via the cytoskeletal regulator LIMK1. J. Cell Biol. 162, 1089–1098. Frisch, A., Wright, C.V., 1998. XBMPRII, a novel Xenopus type II receptor mediating BMP signaling in embryonic tissues. Development 125, 431–442. Fukuda, T., Kohda, M., Kanomata, K., Nojima, J., Nakamura, A., Kamizono, J., Noguchi, Y., Iwakiri, K., Kondo, T., Kurose, J., Endo, K., Awakura, T., Fukushi, J., Nakashima, Y., Chiyonobu, T., Kawara, A., Nishida, Y., Wada, I., Akita, M., Komori, T., Nakayama, K., Nanba, A., Maruki, Y., Yoda, T., Tomoda, H., Yu, P.B., Shore, E.M., Kaplan, F.S., Miyazono, K., Matsuoka, M., Ikebuchi, K., Ohtake, A., Oda, H., Jimi, E., Owan, I., Okazaki, Y., Katagiri, T., 2009. Constitutively activated ALK2 and increased SMAD1/5 cooperatively induce bone morphogenetic protein signaling in fibrodysplasia ossificans progressiva. J. Biol. Chem. 284, 7149–7156. Gamell, C., Osses, N., Bartrons, R., Ruckle, T., Camps, M., Rosa, J.L., Ventura, F., 2008. BMP2 induction of actin cytoskeleton reorganization and cell migration requires PI3-kinase and Cdc42 activity. J. Cell Sci. 121, 3960–3970. Gamell, C., Susperregui, A.G., Bernard, O., Rosa, J.L., Ventura, F., 2011. The p38/MK2/Hsp25 pathway is required for BMP-2-induced cell migration. PLoS One 6, e16477. Georges, P.C., Hadzimichalis, N.M., Sweet, E.S., Firestein, B.L., 2008. The yin–yang of dendrite morphology: unity of actin and microtubules. Mol. Neurobiol. 38, 270–284. Govek, E.E., Newey, S.E., Van Aelst, L., 2005. The role of the Rho GTPases in neuronal development. Genes Dev. 19, 1–49. Haghighi, A.P., McCabe, B.D., Fetter, R.D., Palmer, J.E., Hom, S., Goodman, C.S., 2003. Retrograde control of synaptic transmission by postsynaptic CaMKII at the Drosophila neuromuscular junction. Neuron 39, 255–267. Hayashi, M.L., Choi, S.Y., Rao, B.S., Jung, H.Y., Lee, H.K., Zhang, D., Chattarji, S., Kirkwood, A., Tonegawa, S., 2004. Altered cortical synaptic morphology and impaired memory consolidation in forebrain-specific dominant-negative PAK transgenic mice. Neuron 42, 773–787. Henriquez, J.P., Krull, C.E., Osses, N., 2011. The Wnt and BMP families of signaling morphogens at the vertebrate neuromuscular junction. Int. J. Mol. Sci. 12, 8924–8946. Hocking, J.C., Hehr, C.L., Bertolesi, G., Funakoshi, H., Nakamura, T., McFarlane, S., 2009. LIMK1 acts downstream of BMP signaling in developing retinal ganglion cell axons but not dendrites. Dev. Biol. 330, 273–285. Huang, W., Zhou, Z., Asrar, S., Henkelman, M., Xie, W., Jia, Z., 2011. p21-Activated kinases 1 and 3 control brain size through coordinating neuronal complexity and synaptic properties. Mol. Cell Biol. 31, 388–403. Jacobs, T., Causeret, F., Nishimura, Y.V., Terao, M., Norman, A., Hoshino, M., Nikolic, M., 2007. Localized activation of p21-activated kinase controls neuronal polarity and morphology. J. Neurosci. 27, 8604–8615. Jaffe, A.B., Hall, A., 2005. Rho GTPases: biochemistry and biology. Annu. Rev. Cell Dev. Biol. 21, 247–269. Knaus, U.G., Morris, S., Dong, H.J., Chernoff, J., Bokoch, G.M., 1995. Regulation of human leukocyte p21-activated kinases through G protein-coupled receptors. Science 269, 221–223. Kreis, P., Barnier, J.V., 2009. PAK signalling in neuronal physiology. Cell. Signal. 21, 384–393. Labbe, E., Letamendia, A., Attisano, L., 2000. Association of Smads with lymphoid enhancer binding factor 1/T cell-specific factor mediates cooperative signaling by the transforming growth factor-beta and Wnt pathways. Proc. Natl. Acad. Sci. U. S. A. 97, 8358–8363. Lee-Hoeflich, S.T., Causing, C.G., Podkowa, M., Zhao, X., Wrana, J.L., Attisano, L., 2004. Activation of LIMK1 by binding to the BMP receptor, BMPRII, regulates BMPdependent dendritogenesis. EMBO J. 23, 4792–4801.

F

2013) or the control peptide for 30 min and then treated with 3 nM BMP7 for the indicated times. Actin was visualized with Alexa Fluor 462 568 phalloidin (Molecular Probes, A12380) and microtubules with 463 anti-beta tubulin (Sigma T4026) antibody by immunofluorescence 464 microscopy. The number of protrusions displaying expanded phalloidin 465 or tubulin staining at neurite tips was quantitated in 3 independent 466 experiments. To examine the effect of PAK inhibition on BMP-induced 467 cofilin phosphorylation, primary cortical neurons were incubated 468 with 15 μM of the PAK18 inhibitor or the control peptide for 30 min 469 prior to treatment with 3 nM BMP7 for 10 min. Phospho-cofilin 470 localization at the tips of the neurites was visualized by immuno471 fluorescence microscopy using rabbit anti-phospho-cofilin (Santa Cruz 472 Biotechnology) and anti-rabbit Alexa Fluor 546-conjugated antibodies 473 Q10 (Molecular Probes, Invitrogen).

9

Please cite this article as: Podkowa, M., et al., p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons, Mol. Cell. Neurosci. (2013), http://dx.doi.org/10.1016/j.mcn.2013.10.005

516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601

D

P

R O

O

F

Parrini, M.C., Lei, M., Harrison, S.C., Mayer, B.J., 2002. Pak1 kinase homodimers are autoinhibited in trans and dissociated upon activation by Cdc42 and Rac1. Mol. Cell 9, 73–83. Perron, J.C., Dodd, J., 2011. Inductive specification and axonal orientation of spinal neurons mediated by divergent bone morphogenetic protein signaling pathways. Neural Dev. 6, 36. Podkowa, M., Zhao, X., Chow, C.W., Coffey, E.T., Davis, R.J., Attisano, L., 2010. Microtubule stabilization by bone morphogenetic protein receptor-mediated scaffolding of c-Jun N-terminal kinase promotes dendrite formation. Mol. Cell Biol. 30, 2241–2250. Sanchez-Camacho, C., Bovolenta, P., 2009. Emerging mechanisms in morphogenmediated axon guidance. Bioessays 31, 1013–1025. Santiago-Medina, M., Gregus, K.A., Gomez, T.M., 2013. PAK–PIX interactions regulate adhesion dynamics and membrane protrusion to control neurite outgrowth. J. Cell Sci. 126, 1122–1133. Sieber, C., Kopf, J., Hiepen, C., Knaus, P., 2009. Recent advances in BMP receptor signaling. Cytokine Growth Factor Rev. 20, 343–355. Stiess, M., Bradke, F., 2011. Neuronal polarization: the cytoskeleton leads the way. Dev. Neurobiol. 71, 430–444. Suzuki, A., Thies, R.S., Yamaji, N., Song, J.J., Wozney, J.M., Murakami, K., Ueno, N., 1994. A truncated bone morphogenetic protein receptor affects dorsal–ventral patterning in the early Xenopus embryo. Proc. Natl. Acad. Sci. U. S. A. 91, 10255–10259. Taipale, M., Krykbaeva, I., Koeva, M., Kayatekin, C., Westover, K.D., Karras, G.I., Lindquist, S., 2012. Quantitative analysis of HSP90–client interactions reveals principles of substrate recognition. Cell 150, 987–1001. Tremblay, R.G., Sikorska, M., Sandhu, J.K., Lanthier, P., Ribecco-Lutkiewicz, M., BaniYaghoub, M., 2010. Differentiation of mouse Neuro 2A cells into dopamine neurons. J. Neurosci. Methods 186, 60–67. Varelas, X., Miller, B.W., Sopko, R., Song, S., Gregorieff, A., Fellouse, F.A., Sakuma, R., Pawson, T., Hunziker, W., McNeill, H., Wrana, J.L., Attisano, L., 2010. The Hippo pathway regulates Wnt/beta-catenin signaling. Dev. Cell 18, 579–591. Wen, Z., Han, L., Bamburg, J.R., Shim, S., Ming, G.L., Zheng, J.Q., 2007. BMP gradients steer nerve growth cones by a balancing act of LIM kinase and Slingshot phosphatase on ADF/cofilin. J. Cell Biol. 178, 107–119. Wieser, R., Wrana, J.L., Massague, J., 1995. GS domain mutations that constitutively activate T beta R-I, the downstream signaling component in the TGF-beta receptor complex. EMBO J. 14, 2199–2208. Wilkes, M.C., Murphy, S.J., Garamszegi, N., Leof, E.B., 2003. Cell-type-specific activation of PAK2 by transforming growth factor beta independent of Smad2 and Smad3. Mol. Cell Biol. 23, 8878–8889. Wong, W.K., Knowles, J.A., Morse, J.H., 2005. Bone morphogenetic protein receptor type II C-terminus interacts with c-Src: implication for a role in pulmonary arterial hypertension. Am. J. Respir. Cell Mol. Biol. 33, 438–446. Wu, G., Fang, Y., Lu, Z.H., Ledeen, R.W., 1998. Induction of axon-like and dendrite-like processes in neuroblastoma cells. J. Neurocytol. 27, 1–14.

T

Lei, M., Lu, W., Meng, W., Parrini, M.C., Eck, M.J., Mayer, B.J., Harrison, S.C., 2000. Structure of PAK1 in an autoinhibited conformation reveals a multistage activation switch. Cell 102, 387–397. Machado, R.D., Rudarakanchana, N., Atkinson, C., Flanagan, J.A., Harrison, R., Morrell, N.W., Trembath, R.C., 2003. Functional interaction between BMPR-II and Tctex-1, a light chain of Dynein, is isoform-specific and disrupted by mutations underlying primary pulmonary hypertension. Hum. Mol. Genet. 12, 3277–3286. Marques, G., Zhang, B., 2006. Retrograde signaling that regulates synaptic development and function at the Drosophila neuromuscular junction. Int. Rev. Neurobiol. 75, 267–285. Marques, G., Bao, H., Haerry, T.E., Shimell, M.J., Duchek, P., Zhang, B., O'Connor, M.B., 2002. The Drosophila BMP type II receptor Wishful Thinking regulates neuromuscular synapse morphology and function. Neuron 33, 529–543. Maruta, H., He, H., Nheu, T., 2002. Interfering with Ras signaling using membranepermeable peptides or drugs. Methods Mol. Biol. 189, 75–85. Miller, F.D., Kaplan, D.R., 2003. Signaling mechanisms underlying dendrite formation. Curr. Opin. Neurobiol. 13, 391–398. Miller, B.W., Lau, G., Grouios, C., Mollica, E., Barrios-Rodiles, M., Liu, Y., Datti, A., Morris, Q., Wrana, J.L., Attisano, L., 2009. Application of an integrated physical and functional screening approach to identify inhibitors of the Wnt pathway. Mol. Syst. Biol. 5, 315. Miyagi, M., Mikawa, S., Hasegawa, T., Kobayashi, S., Matsuyama, Y., Sato, K., 2011. Bone morphogenetic protein receptor expressions in the adult rat brain. Neuroscience 176, 93–109. Miyagi, M., Mikawa, S., Sato, T., Hasegawa, T., Kobayashi, S., Matsuyama, Y., Sato, K., 2012. BMP2, BMP4, noggin, BMPRIA, BMPRIB, and BMPRII are differentially expressed in the adult rat spinal cord. Neuroscience 203, 12–26. Miyazono, K., Kamiya, Y., Morikawa, M., 2010. Bone morphogenetic protein receptors and signal transduction. J. Biochem. 147, 35–51. Morrell, N.W., 2011. Role of bone morphogenetic protein receptors in the development of pulmonary arterial hypertension. Adv. Exp. Med. Biol. 661, 251–264. Mu, Y., Gudey, S.K., Landstrom, M., 2012. Non-Smad signaling pathways. Cell Tissue Res. 347, 11–20. Nahm, M., Lee, M.J., Parkinson, W., Lee, M., Kim, H., Kim, Y.J., Kim, S., Cho, Y.S., Min, B.M., Bae, Y.C., Broadie, K., Lee, S., 2013. Spartin regulates synaptic growth and neuronal survival by inhibiting BMP-mediated microtubule stabilization. Neuron 77, 680–695. Narimatsu, M., Bose, R., Pye, M., Zhang, L., Miller, B., Ching, P., Sakuma, R., Luga, V., Roncari, L., Attisano, L., Wrana, J.L., 2009. Regulation of planar cell polarity by Smurf ubiquitin ligases. Cell 137, 295–307. Ng, J., 2008. TGF-beta signals regulate axonal development through distinct Smadindependent mechanisms. Development 135, 4025–4035. Nikolic, M., 2008. The Pak1 kinase: an important regulator of neuronal morphology and function in the developing forebrain. Mol. Neurobiol. 37, 187–202. Park, K.S., Gumbiner, B.M., 2012. Cadherin-6B stimulates an epithelial mesenchymal transition and the delamination of cells from the neural ectoderm via LIMK/cofilin mediated non-canonical BMP receptor signaling. Dev. Biol. 366, 232–243.

C

602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645

M. Podkowa et al. / Molecular and Cellular Neuroscience xxx (2013) xxx–xxx

E

10

U

N

C

O

R

R

E

691

Please cite this article as: Podkowa, M., et al., p21-Activated kinase (PAK) is required for Bone Morphogenetic Protein (BMP)-induced dendritogenesis in cortical neurons, Mol. Cell. Neurosci. (2013), http://dx.doi.org/10.1016/j.mcn.2013.10.005

646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690