- Email: [email protected]
Qrfp sequence polymorphisms in SAMP6 osteopenic mouse
Available online at www.sciencedirect.com
Genomics 90 (2007) 629 – 635 www.elsevier.com/locate/ygeno
P518/Qrfp sequence polymorphisms in SAMP6 osteopenic mouse Qing Zhang a , Ping Qiu a , M. Gladys Arreaza a , Jason S. Simon a , Andrei Golovko a,1 , Maureen Laverty a , Galya Vassileva a , Eric L. Gustafson a , Alberto Rojas-Triana b , Loretta A. Bober b , Joseph A. Hedrick a , Frederick J. Monsma Jr. a , Jonathan R. Greene a , Marvin L. Bayne a , Nicholas J. Murgolo a,⁎ b
a Department of Discovery Technologies, Schering–Plough Research Institute, 2015 Galloping Hill Road, Kenilworth, NJ 07033, USA Department of Inflammation and Infectious Diseases, Schering–Plough Research Institute, 2015 Galloping Hill Road, Kenilworth, NJ 07033, USA
Received 19 December 2006; accepted 24 July 2007 Available online 17 September 2007
Abstract Mice lacking GPR103A expression display osteopenia. Analysis of mouse quantitative trait loci literature associated with bone mineral density suggested GPR103A ligand P518/Qrfp (chromosome 2qB) as a candidate osteoporosis gene. Promoter and coding regions of mouse P518/Qrfp were sequenced from genomic DNA obtained from the osteoporosis-prone strain SAMP6 and control strains SAMR1, A/J, AKR/J, BALB/c, C3H/HeJ, C57BL/6J, and DBA/2J. Four single-nucleotide polymorphisms (SNPs) were identified in only SAMP6 genomic DNA, g.−1773 T → C, g.110 A → G (N37S), g.188 G → A (R63K), and g.135 T → C (H45H). The promoter SNP generated a novel neuron-restrictive silencing factor binding site, a repressor that decreases gene expression in nonneuronal tissues. TaqMan analysis demonstrated fivefold lower P518/Qrfp liver expression in SAMP6 versus SAMR1 or C57BL/6J control strains. Tissue distribution of human, mouse, and rat P518/Qrfp and its receptors showed expression in bone and spinal cord. A direct role for P518/Qrfp function in maintaining bone mineral density is suggested. © 2007 Elsevier Inc. All rights reserved. Keywords: Osteoporosis; SNPs; Polymorphisms; SAMP6; P518/Qrfp; Bone mineral density
The identification of P518/Qrfp (a.k.a. RF26amide (arginine–phenylalanine amide of length 26 amino acids) and QRFP-26 (pyroglutamyl–arginine–phenylalanine amide of length 26 amino acids)) as an RFamide (arginine–phenylalanine amide) peptide agonist ligand of the G-protein-coupled receptor SP9155 (a.k.a. GPR103 and AQ27) has been previously reported [1]. Several subsequent studies have identified biological roles for P518/Qrfp and its receptor. Intracerebroventricular (icv) administration of P518/Qrfp was demonstrated to be orexigenic in partially food-deprived mice [2] and 13-day chronic icv administration of a longer form, QRFP-43, caused obesity (15% weight gain), hyperphagia, decreased expression of brown adipose uncoupling protein-1, and reduced thermogenesis [3]. QRFP-43 regulates appetite and energy expenditure ⁎ Corresponding author. Fax: +1 908 740 7664. E-mail address: [email protected] (N.J. Murgolo). 1 Present address: Texas Institute for Genomic Medicine, 2121 W. Holcombe Boulevard, Houston, TX 77030-3303, USA. 0888-7543/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ygeno.2007.07.011
in mice. Additionally, P518/Qrfp acts as an endocrine hormone: Intravenous administration of QRFP-43 to rats results in elevated levels of aldosterone [4]. Administration of a shorter form, P52, or P518/Qrfp or QRFP-43 enhances basal or GnRHstimulated LH secretion from pituitary in rats, and icv administration of P52, P518/Qrfp, or QRFP-43 to rats invokes increased serum LH in normal and ovariectomized rats [5]. Intracerebroventricular QRFP-43 administration in mice induces feeding, increased general locomotor activity, increased blood pressure, increased heart rate, and increased metabolic rate [6]. Recently, intravenous administration of P518/Qrfp to rats has been demonstrated to inhibit glucose-stimulated insulin release in pancreas [7]. P518/Qrfp induces both feeding and locomotor activity on icv administration in mice but the feeding activity is centered in the C-terminus of this RFamide and the locomotor activity resides in the N-terminus [8]. The central portion of the P518/Qrfp peptide adopts a helical structure in solution [9]. Extensive analysis of the completed human genome sequence has identified only one isoform of the
630
Q. Zhang et al. / Genomics 90 (2007) 629–635
P518/Qrfp receptor. However, two rodent orthologs of the human P518/Qrfp receptor GPR103 have been identified that are similar with regard to sequence, response to P518/Qrfp, and tissue distribution [6,10]. Genetically engineered mice lacking GPR103A expression displayed osteopenia, suggesting a role for GPR103A and/or its ligand in bone formation [11]. We searched for quantitative trait loci (QTL) associated with bone mineral density within 5 Mb of the genomic regions encoding the human, mouse, and rat P518/ Qrfp ligand (a.k.a. RF26a and QRFP-43) and its receptor GPR103A using a novel tool we have recently developed for mapping phenotype literature to genomic regions (Q. Zhang, manuscript in preparation). Interestingly, two independently performed, genome-wide scans had mapped a chromosome 2 locus associated with bone mineral density [12,13], but had not been resolved to a single gene. P518/Qrfp maps within the critical region of both scans. One of the studies identified this region by comparing SAMP6 and SAMR1 control mice, as well as by comparing SAMP6 mice to the parent strain AKR/J. SAMP mouse strains were developed by extensive inbreeding of AKR/J mice; the SAMP6 strain demonstrates marked osteopenia [12]. We rationalized that polymorphisms in mouse P518/Qrfp could be associated with altered ligand level and/or protein sequence and sought to identify strainassociated single-nucleotide polymorphisms (SNPs) in the
inbred senescent mouse strain SAMP6. We also examined the expression and distribution of GPR103A, GPR103B, and P518/ Qrfp precursor in humans and rodents and liver expression of P518/Qrfp in the SAMP6 and SAMR1 mouse strains. Results A prior QTL study on SAMP6 × AKR/J and SAMP6 × SAMR1 crosses identified a mouse chromosome 2qB locus associated with bone mineral density between the type V collagen 5α1 and the prostaglandin G/H synthase 1 (Ptgs1, a.k.a. COX1) genes [12]. The P518/Qrfp precursor is located in the center of this locus (Fig. 1). P518/Qrfp was not considered as a candidate gene at the time of the QTL study as the study predated P518/Qrfp identification [1]. Variations were found only in DNA isolated from SAMP6 mice; all other mouse strains had the same sequence, including control strains SAMR1 and AKR/J (from which SAMR1 and SAMP6 were derived) and the strains A/J, BALB/c, C3H.HeJ, C57BL/6J, and DBA/2J. The four SNPs identified were g.−1773 T → C in the promoter region; two coding SNPs, g.110 A → G (N37S) and g.188 G → A (R63K); and one silent SNP, g.135 T → C (H45H). A schematic map of the SNPs associated with the genomic sequence is provided (Fig. 2). Since the two coding SNPs changed the protein coding sequence to
Fig. 1. Map of 3.875-Mb mouse chromosome 2 bone mineral density-associated locus [12]. Boundary genes Col5a1, Ptgs1, and P518/Qrfp boxed in red. Coordinates are from the mm8 mouse genome assembly of February 2006, Chr2 base pairs 27,690,000–36,075,000. Graphic is a snapshot generated with the UCSC Genome Browser [26,27].
Q. Zhang et al. / Genomics 90 (2007) 629–635
631
Fig. 2. (A) SAMP6 P518/Qrfp SNPs mapped to genomics structure and (B) P518/Qrfp protein sequences (numbering is that of mouse P518/Qrfp). Nomenclature is according to the Human Genome Variation Society recommendations [28]. NRSF, TATA promoter elements, exon boundaries, and coding regions are indicated above the diagram. Reference mRNA for exon structure is GenBank entry NM_183424.1 and those for protein sequences are NP_906269.1, NP_937843.1, and NP_937823.1 for mouse, rat and human P518/Qrfp, respectively.
their rat residue counterparts and since both residues were upstream of known biologically active peptide fragments in the message, we focused on the g.−1773 T → C SNP. Promotor region analysis was performed using a TRANSFAC database search with the MATCH program [14,15]. A transcription factor binding site was identified for neuronrestrictive silencing factor (a.k.a. NRSF and RE1-silencing transcription factor, or REST) that matched TRANSFAC Entry M00256. The NRSF consensus pattern is a 21-mer, TTCAGCACCACGGACAGMGSC, that matched SAMP6 P518/Qrfp g.− 1787:g.− 1767, TGCAGCAcagagagcatcatc [16]. The 15th position of the pattern in known NRSF binding sites is C and infrequently G. The SAMP6 g.−1773 T → C SNP generates an improved NRSF binding site match in the mouse P518/Qrfp promoter. NRSF represses transcription of neuronal genes in nonneuronal cells, including the GPCR peptide ligand precursors for CRF and proenkephalin [17]. Thus, the − 1773 T → G SNP could result in lower expression of P518/Qrfp in nonneuronal tissues in osteopenic SAMP6 mice, consistent with the decrease in bone mineral density seen in GPR103A receptor knockouts. We therefore measured the expression level of P518/Qrfp in mRNA isolated from SAMP6 and SAMR1. Measurement of P518/Qrfp mRNA by TaqMan analysis demonstrated that liver levels of P518/Qrfp message were reduced fivefold in SAMP6 mice (Fig. 3). TaqMan analysis of tissue expression of P518/Qrfp and its receptor(s) in human, mouse, and rat was also performed. Little if any GPR103A or GPR103B receptor was observed in mouse
liver, but message for P518/Qrfp was present (Fig. 4A). Surprisingly, rat GPR103A and GPR103B distribution was quite similar, unlike that observed for the mouse receptors (Figs. 4A and 4B). Prior studies had shown higher expression of mouse GPR103B in testis and eye [6] and expression of mouse GPR103A in eye and spine and human GPR103 in bone and heart [11]. We saw expression of mouse P518/Qrfp in bone and
Fig. 3. Expression of P518/Qrfp in mouse liver. Expression values are plotted as the average and standard deviation for three animals/strain.
632
Q. Zhang et al. / Genomics 90 (2007) 629–635
higher expression of GPR103A than GPR103B in retina (Fig. 4A). Human GPR103 was also expressed in retina and heart (Fig. 4C). We also observed expression of human GPR103, mouse GPR103A and GPR103B, and rat GPR103A and GPR103B in spinal cord (Figs. 4A–4C) and mouse GPR103A and GPR103B in bone (Fig. 4A). During final preparation of this article, a report was published characterizing expression of rat P518/Qrfp and GPR103A and GPR103B in brain by in situ hybridization, showing message for P518/Qrfp in hypothalamus and GPR103B in thalamus and brain stem [18], and a report appeared demonstrating expression of human P518/Qrfp in brain and spinal cord [19], consistent with our findings. We examined the expression of P518/Qrfp, GPR103A, and GPR103B in SAMP6 and SAMR1 in additional tissues including lumbar spine, brain, hypothalamus, heart, and kidney (Fig. 5). Peripheral expression of P518/Qrfp is reduced in SAMP6 lumbar spine, which is significant because this is the site of the phenotype observed in GPR103A knockout mice [11]. GPR103A and GPR103B expression was similar in lumbar spine. We also observed that P518/Qrfp expression is reduced in SAMP6 brain and hypothalamus. GPR103A and GPR103B expression is increased in SAMP6 heart.
Discussion Several genomic loci have been associated with osteoporosis, some of which have been resolved to sequence polymorphisms in specific genes, described in detail in a recent review [20]. To our knowledge this is the first identification of a molecular candidate for the mouse chromosome 2qB QTL and the first identification of osteopenia-associated SNPs in the P518/Qrfp message. Searches of public SNP data did not reveal prior identification of the four SNPs reported in this study. The SAMP6 osteoporosis-prone mouse strain has a SNP in the P518/Qrfp promoter region resulting in generation of a putative repressive transcription factor binding site correlating with reduced peripheral expression. This coupled with observation of osteopenia in GPR103A knockout mice [11] suggests P518/Qrfp function is important for maintaining mineral bone density. The presence of ligand and receptor in spinal cord, bone, and osteoblasts [11] and inverse correlation of peripheral P518/Qrfp levels with osteopenia suggest that P518/Qrfp role in maintaining bone mineral density is direct as opposed to centrally mediated. Direct proof of SAMP6 P518/Qrfp NRSF promoter function has yet to be established. Proof might be obtained by direct binding
Fig. 4. Expression of P518/Qrfp and receptor(s). (A) Mouse P518/Qrfp and GPR103A and B. (B) Rat P518/Qrfp and GPR103A and B. (C) Human P518/Qrfp and GPR103.
Q. Zhang et al. / Genomics 90 (2007) 629–635
633
Fig. 4 (continued).
studies, cloning into a reporter gene construct, segregating the SAMP6 variant into a different strain, or characterizing heterozygotes. P518/Qrfp expression was also reduced in SAMP6 brain and hypothalamus (Fig. 5). NRSF neuronal silencing has been observed previously. NRSF silences nonneuronal expression and its neuronal expression is developmentally regulated [16], and it has also been shown to repress expression of mu opioid receptor in neuronal cells [29]. Use of P518/Qrfp and/or receptor agonists may be of benefit in osteoporosis. Presence of human GPR103 in heart (Fig. 4C) and reported effects of QRFP-43 on blood pressure and heart rate [6], which may be directly as opposed to centrally mediated, should be considered as a cautionary factor.
Polymerase chain reaction
Materials and methods
The general strategy for SNP discovery was as previously described [21] with modifications as detailed below. PCR primers were designed using the Primer3 software [22] (http://www.genome.wi.mit.edu/cgi-bin/primer/primer3.cgi) to amplify the P518/Qrfp promoter and coding region. One amplicon was produced using the forward primer 5′-CATATACCAGAACACCTCATCTGC-3′ and reverse 5′-CAGAGATTAATACTTCCTGGCTGG-3′, and the second was amplified using the forward primer 5′-GCTACAGGTGAATAGGAATCAGAC-3′ and reverse 5′TAGTGCACTGTGATACTCTCTCCG-3′. Forward and reverse primers were 5′ tailed with universal sequencing primers (−21M13, 5′-TGTAAAACGACGGCCAGT, and M13Rev, CAGGAAACAGCTATGACC, respectively). PCRs contained genomic DNA (24 ng) in the presence of USB FideliTaq (USB Corp., Cleveland, OH, USA) and 0.2 pmol/μl forward and reverse primers in 12 μl total volume. Thermocycling was performed in 96-well microplates (PTC-200 thermocycler; MJ Research) with an initial denaturation at 94 °C for 5 min followed by 35 cycles of denaturation at 94 °C for 30 s, primer annealing at 65 °C for 30 s, and primer extension at 68 °C for 1 min. After 35 cycles, a final extension was carried out for 7 min at 68 °C.
Mouse DNA and RNA samples
DNA sequencing and analysis
The promoter and coding region of P518/Qrfp were sequenced from genomic DNA obtained from mouse strains SAMP6, SAMR1, A/J, AKR/J, BALB/c, C3H/HeJ, C57BL/6J, and DBA/2J (n = 3 per strain). Genomic DNA was isolated from liver using the DNeasy Tissue kit (Qiagen, Valencia, CA, USA). RNA was obtained from livers of SAMP6 and SAMR1 mice using QIAZOL and RNeasy kits (Qiagen). Tissues from SAMP6 and SAMR1 mice were obtained from Harlan Laboratories (Indianapolis, IN, USA, and UK).
Following DNA amplification, PCRs were diluted to 50 μl in PCR buffer containing 0.5 μl of ExoSAP-IT (USB Corp.) and were incubated 15 min at 37 °C followed by inactivation of the enzymes at 80 °C for 15 min. Cycle sequencing in the forward and reverse directions was performed using the ABI Prism BigDye Terminator v3.1 Cycle Sequencing DNA Sequencing Kit (Applied Biosystems (ABI), Foster City, CA, USA) according to the manufacturer's instructions. Briefly, 1 μl of each PCR product was used as
634
Q. Zhang et al. / Genomics 90 (2007) 629–635
Fig. 4 (continued).
template and combined with 4 μl sequencing reaction mix containing 5 pmol M13 sequencing primer (− 21M13 or M13Rev), 0.5× Sequencing buffer and BDTv3.1 mix. Sequencing reactions were denatured for 1 min at 96 °C followed by 25 cycles at 96 °C for 10 s, 50 °C for 5 s, and 60 °C for 4 min. Sequencing reactions were purified by filtration using Montage SEQ96 plates (Millipore Corp., Bedford, MA, USA), dissolved in 25 μl deionized water, and resolved by
capillary gel electrophoresis on an Applied Biosystems 3730XL DNA analyzer. Chromatograms were transferred to a Unix workstation (DEC alpha; Compaq Corp), bases were called with Phred (version 0.990722.g), assembled with Phrap version 3.01 [23,24], and scanned with PolyPhred [21], and the results were viewed with Consed [25] version 9.0 (Phred, Phrap, and Consed available at http://www.genome.washington.edu, PolyPhred is available at http://droog.mbt.
Fig. 5. Expression of P518/Qrfp, GPR103A, and GPR103B in SAMP6 and SAMR1 tissues. Expression values are plotted as the average and standard deviation for three animals/strain. *p b 0.05.
Q. Zhang et al. / Genomics 90 (2007) 629–635
635
Table 1 Primer and probe sequences used in quantitative PCRs Human
Mouse
Rat
P518/Qrfp Forward Reverse Probe
GGCCTTACCCCCTGATCTACTT CTTCTGTCCAGTAGAGGGAAGCA TCTTCCTGCCGCTGGGCGC
TCGGAGCCAGGATGAACTG CTGTGGATTTTGAACCGAGTTG TGGCTGAGGGACATC
GTGCCTCTGCTCTTGGCTTT GATGTCTGTGGGTCCCCTTCT CTCCTGCCTCTGAGTGCCTGC
GPR103A Forward Reverse Probe
AGAAATGTCCAAAATAGCCAGGAAG GGACAACATGGAATGGTGCC TGTCATTATGATGGTGACAGTGGTGGCTCTC
CACCGCGGAGCAGTTTT TGTTCCCGAGTCAGGTTGTGT CGGCTGCTGAGCG
GCACGGAAGCCTGGGAAT ATGTGTCTCCTTTGGTTTCTTCCA AGCAAAGTTATCTCGACCACAGCGTCCA
GPR103B Forward Reverse Probe
N/A N/A N/A
TTGCTATTGCATTGTGAAGGAAA CACCATAGCTCCTGAACTTCCAT ACCTTCTTCAGCACGGAA
TGTGATGCACAGAAGAGTGAAGTTAG TGCTGCCCCCAAATGCT TGTGGGAGAGAATCCTGTAGAGATCA
washington.edu). Analysis parameters were all maintained at the individual software's default settings. SNPs were scored only if identified in both forward and reverse runs.
Quantitative PCR TaqMan primers and probes were designed with Primer Express software (ABI) and purchased from ABI. Primer and probe sequences are provided in Table 1. Tissue preparations, assay conditions, and quantitation were as described previously [1].
References [1] Y. Jiang, et al., Identification and characterization of a novel RF-amide peptide ligand for orphan G-protein coupled receptor SP9155, J. Biol. Chem. 278 (2003) 27652–27657. [2] N. Chartrel, et al., Identification of 26RFa, a hypothalamic neuropeptide of the RFamide peptide family with orexigenic activity, Proc. Natl. Acad. Sci. USA 100 (2003) 15247–15252. [3] R. Moriya, et al., RFamide peptide QRFP43 causes obesity with hyperphagia and reduced thermogenesis in mice, Endocrinology 147 (2006) 2916–2922. [4] S. Fukusumi, et al., A new peptidic ligand and its receptor regulating adrenal function in rats, J. Biol. Chem. 278 (2003) 46387–46395. [5] V.M. Navarro, et al., Novel role of 26RFa, a hypothalamic RFamide orexigenic peptide, as putative regulator of the gonadotropic axis, J. Physiol. 573 (2006) 237–249. [6] S. Takayasu, et al., A neuropeptide ligand of the G protein-coupled receptor GPR103 regulates feeding, behavioral arousal, and blood pressure in mice, Proc. Natl. Acad. Sci. USA 103 (2006) 7438–7443. [7] E.M. Egido, et al., 26RFa, a novel orexigenic neuropeptide, inhibits insulin secretion in the rat pancreas, Peptides 28 (2007) 725–730. [8] J.C. do Rego, J. Leprince, N. Chartrel, H. Vaudry, J. Marco, R.A. Silvestre, Behavioral effects of 26RFamide and related peptides, Peptides 27 (2006) 2715–2721. [9] R. Thuau, et al., Structural studies on 26RFa, a novel human RFamiderelated peptide with orexigenic activity, Peptides 26 (2005) 779–789. [10] T.K. Bjarnadottir, D.E. Gloriam, S.H. Hellstrand, H. Kristiansson, R. Frederiksson, H.B. Schioth, Comprehensive repertoire and phylogenetic analysis of the G protein-coupled receptors in human and mouse, Genomics 88 (2006) 263–273. [11] H. Baribault, et al., The G-protein coupled receptor GPR103 regulates bone formation, Mol. Cell. Biol. 26 (2006) 709–717. [12] H. Benes, et al., Chromosomal mapping of osteopenia-associated quantitative trait loci using closely related mouse strains, J. Bone Miner. Res. 15 (2000) 626–633.
[13] R.F. Klein, et al., Confirmation and fine mapping of chromosomal regions influencing peak bone mass in mice, J. Bone Miner. Res. 16 (2001) 1953–1961. [14] A.E. Kel, E. Gossling, I. Reuter, E. Cheremushkin, O.V. Kel-Margoulis, T. Werner, MATCH: a tool for searching transcription factor binding sites in DNA sequences, Nucleic Acids Res. 31 (2003) 3576–3579. [15] V. Matys, et al., TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes, Nucleic Acids Res. 34 (2006) D108–D110. [16] C.J. Schoenherr, A.J. Paquette, D.J. Anderson, Identification of potential target genes for the neuron-restrictive silencer factor, Proc. Natl. Acad. Sci. USA 93 (1996) 9881–9886. [17] Z.F. Chen, A.J. Paquette, D.J. Anderson, NRSF/REST is required in vivo for repression of multiple neuronal target genes during embryogenesis, Nat. Genet. 20 (1998) 136–142. [18] J. Kampe, et al., Effect of central administration of QRFP(26) peptide on energy balance and characterization of a second QRFP receptor in rat, Brain Res. 1119 (2006) 113–149. [19] F. Bruzzone, et al., Anatomical distribution and biochemical characterization of the novel RFamide peptide 26RFa in the human hypothalamus and spinal cord, J. Neurochem. 99 (2006) 616–627. [20] Q.A. Huang, W.C. Kung, Genetics of osteoporosis (minireview), Mol. Genet. Metab. 88 (2006) 295–306. [21] D.A. Nickerson, V.O. Tobe, S.L. Taylor, PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing, Nucleic Acids Res. 25 (1997) 2745–2751. [22] S.A. Rosen, H.J. Skaletsky, Primer3 on the WWW for general users and for biologist programmers, Methods Mol. Biol. 132 (2000) 365–382. [23] B. Ewing, P. Green, Basecalling of automated sequencer traces using phred: II. Error probabilities, Genome Res. 8 (1998) 186–194. [24] B. Ewing, L. Hillier, M. Wendl, P. Green, Basecalling of automated sequencer traces using phred. I. Accuracy assessment, Genome Res. 8 (1998) 175–185. [25] D. Gordon, C. Abajian, P. Green, Consed: a graphical tool for sequence finishing, Genome Res. 8 (1998) 195–202. [26] W.J. Kent, et al., The human genome browser at UCSC, Genome Res. 12 (2002) 996–1006. [27] D. Karolchik, et al., The UCSC genome browser database, Nucleic Acids Res. 31 (2003) 51–54. [28] J.T. den Dunnen, S.E. Antonarakis, Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion, Hum. Mutat. 15 (2000) 7–12. [29] C.S. Kim, et al., Neuron-restrictive silencer factor (NRSF) functions as a repressor in neuronal cells to regulate the mu opioid receptor gene, J. Biol. Chem. 279 (2004) 46464–46473.
Genomics 90 (2007) 629 – 635 www.elsevier.com/locate/ygeno
P518/Qrfp sequence polymorphisms in SAMP6 osteopenic mouse Qing Zhang a , Ping Qiu a , M. Gladys Arreaza a , Jason S. Simon a , Andrei Golovko a,1 , Maureen Laverty a , Galya Vassileva a , Eric L. Gustafson a , Alberto Rojas-Triana b , Loretta A. Bober b , Joseph A. Hedrick a , Frederick J. Monsma Jr. a , Jonathan R. Greene a , Marvin L. Bayne a , Nicholas J. Murgolo a,⁎ b
a Department of Discovery Technologies, Schering–Plough Research Institute, 2015 Galloping Hill Road, Kenilworth, NJ 07033, USA Department of Inflammation and Infectious Diseases, Schering–Plough Research Institute, 2015 Galloping Hill Road, Kenilworth, NJ 07033, USA
Received 19 December 2006; accepted 24 July 2007 Available online 17 September 2007
Abstract Mice lacking GPR103A expression display osteopenia. Analysis of mouse quantitative trait loci literature associated with bone mineral density suggested GPR103A ligand P518/Qrfp (chromosome 2qB) as a candidate osteoporosis gene. Promoter and coding regions of mouse P518/Qrfp were sequenced from genomic DNA obtained from the osteoporosis-prone strain SAMP6 and control strains SAMR1, A/J, AKR/J, BALB/c, C3H/HeJ, C57BL/6J, and DBA/2J. Four single-nucleotide polymorphisms (SNPs) were identified in only SAMP6 genomic DNA, g.−1773 T → C, g.110 A → G (N37S), g.188 G → A (R63K), and g.135 T → C (H45H). The promoter SNP generated a novel neuron-restrictive silencing factor binding site, a repressor that decreases gene expression in nonneuronal tissues. TaqMan analysis demonstrated fivefold lower P518/Qrfp liver expression in SAMP6 versus SAMR1 or C57BL/6J control strains. Tissue distribution of human, mouse, and rat P518/Qrfp and its receptors showed expression in bone and spinal cord. A direct role for P518/Qrfp function in maintaining bone mineral density is suggested. © 2007 Elsevier Inc. All rights reserved. Keywords: Osteoporosis; SNPs; Polymorphisms; SAMP6; P518/Qrfp; Bone mineral density
The identification of P518/Qrfp (a.k.a. RF26amide (arginine–phenylalanine amide of length 26 amino acids) and QRFP-26 (pyroglutamyl–arginine–phenylalanine amide of length 26 amino acids)) as an RFamide (arginine–phenylalanine amide) peptide agonist ligand of the G-protein-coupled receptor SP9155 (a.k.a. GPR103 and AQ27) has been previously reported [1]. Several subsequent studies have identified biological roles for P518/Qrfp and its receptor. Intracerebroventricular (icv) administration of P518/Qrfp was demonstrated to be orexigenic in partially food-deprived mice [2] and 13-day chronic icv administration of a longer form, QRFP-43, caused obesity (15% weight gain), hyperphagia, decreased expression of brown adipose uncoupling protein-1, and reduced thermogenesis [3]. QRFP-43 regulates appetite and energy expenditure ⁎ Corresponding author. Fax: +1 908 740 7664. E-mail address: [email protected] (N.J. Murgolo). 1 Present address: Texas Institute for Genomic Medicine, 2121 W. Holcombe Boulevard, Houston, TX 77030-3303, USA. 0888-7543/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.ygeno.2007.07.011
in mice. Additionally, P518/Qrfp acts as an endocrine hormone: Intravenous administration of QRFP-43 to rats results in elevated levels of aldosterone [4]. Administration of a shorter form, P52, or P518/Qrfp or QRFP-43 enhances basal or GnRHstimulated LH secretion from pituitary in rats, and icv administration of P52, P518/Qrfp, or QRFP-43 to rats invokes increased serum LH in normal and ovariectomized rats [5]. Intracerebroventricular QRFP-43 administration in mice induces feeding, increased general locomotor activity, increased blood pressure, increased heart rate, and increased metabolic rate [6]. Recently, intravenous administration of P518/Qrfp to rats has been demonstrated to inhibit glucose-stimulated insulin release in pancreas [7]. P518/Qrfp induces both feeding and locomotor activity on icv administration in mice but the feeding activity is centered in the C-terminus of this RFamide and the locomotor activity resides in the N-terminus [8]. The central portion of the P518/Qrfp peptide adopts a helical structure in solution [9]. Extensive analysis of the completed human genome sequence has identified only one isoform of the
630
Q. Zhang et al. / Genomics 90 (2007) 629–635
P518/Qrfp receptor. However, two rodent orthologs of the human P518/Qrfp receptor GPR103 have been identified that are similar with regard to sequence, response to P518/Qrfp, and tissue distribution [6,10]. Genetically engineered mice lacking GPR103A expression displayed osteopenia, suggesting a role for GPR103A and/or its ligand in bone formation [11]. We searched for quantitative trait loci (QTL) associated with bone mineral density within 5 Mb of the genomic regions encoding the human, mouse, and rat P518/ Qrfp ligand (a.k.a. RF26a and QRFP-43) and its receptor GPR103A using a novel tool we have recently developed for mapping phenotype literature to genomic regions (Q. Zhang, manuscript in preparation). Interestingly, two independently performed, genome-wide scans had mapped a chromosome 2 locus associated with bone mineral density [12,13], but had not been resolved to a single gene. P518/Qrfp maps within the critical region of both scans. One of the studies identified this region by comparing SAMP6 and SAMR1 control mice, as well as by comparing SAMP6 mice to the parent strain AKR/J. SAMP mouse strains were developed by extensive inbreeding of AKR/J mice; the SAMP6 strain demonstrates marked osteopenia [12]. We rationalized that polymorphisms in mouse P518/Qrfp could be associated with altered ligand level and/or protein sequence and sought to identify strainassociated single-nucleotide polymorphisms (SNPs) in the
inbred senescent mouse strain SAMP6. We also examined the expression and distribution of GPR103A, GPR103B, and P518/ Qrfp precursor in humans and rodents and liver expression of P518/Qrfp in the SAMP6 and SAMR1 mouse strains. Results A prior QTL study on SAMP6 × AKR/J and SAMP6 × SAMR1 crosses identified a mouse chromosome 2qB locus associated with bone mineral density between the type V collagen 5α1 and the prostaglandin G/H synthase 1 (Ptgs1, a.k.a. COX1) genes [12]. The P518/Qrfp precursor is located in the center of this locus (Fig. 1). P518/Qrfp was not considered as a candidate gene at the time of the QTL study as the study predated P518/Qrfp identification [1]. Variations were found only in DNA isolated from SAMP6 mice; all other mouse strains had the same sequence, including control strains SAMR1 and AKR/J (from which SAMR1 and SAMP6 were derived) and the strains A/J, BALB/c, C3H.HeJ, C57BL/6J, and DBA/2J. The four SNPs identified were g.−1773 T → C in the promoter region; two coding SNPs, g.110 A → G (N37S) and g.188 G → A (R63K); and one silent SNP, g.135 T → C (H45H). A schematic map of the SNPs associated with the genomic sequence is provided (Fig. 2). Since the two coding SNPs changed the protein coding sequence to
Fig. 1. Map of 3.875-Mb mouse chromosome 2 bone mineral density-associated locus [12]. Boundary genes Col5a1, Ptgs1, and P518/Qrfp boxed in red. Coordinates are from the mm8 mouse genome assembly of February 2006, Chr2 base pairs 27,690,000–36,075,000. Graphic is a snapshot generated with the UCSC Genome Browser [26,27].
Q. Zhang et al. / Genomics 90 (2007) 629–635
631
Fig. 2. (A) SAMP6 P518/Qrfp SNPs mapped to genomics structure and (B) P518/Qrfp protein sequences (numbering is that of mouse P518/Qrfp). Nomenclature is according to the Human Genome Variation Society recommendations [28]. NRSF, TATA promoter elements, exon boundaries, and coding regions are indicated above the diagram. Reference mRNA for exon structure is GenBank entry NM_183424.1 and those for protein sequences are NP_906269.1, NP_937843.1, and NP_937823.1 for mouse, rat and human P518/Qrfp, respectively.
their rat residue counterparts and since both residues were upstream of known biologically active peptide fragments in the message, we focused on the g.−1773 T → C SNP. Promotor region analysis was performed using a TRANSFAC database search with the MATCH program [14,15]. A transcription factor binding site was identified for neuronrestrictive silencing factor (a.k.a. NRSF and RE1-silencing transcription factor, or REST) that matched TRANSFAC Entry M00256. The NRSF consensus pattern is a 21-mer, TTCAGCACCACGGACAGMGSC, that matched SAMP6 P518/Qrfp g.− 1787:g.− 1767, TGCAGCAcagagagcatcatc [16]. The 15th position of the pattern in known NRSF binding sites is C and infrequently G. The SAMP6 g.−1773 T → C SNP generates an improved NRSF binding site match in the mouse P518/Qrfp promoter. NRSF represses transcription of neuronal genes in nonneuronal cells, including the GPCR peptide ligand precursors for CRF and proenkephalin [17]. Thus, the − 1773 T → G SNP could result in lower expression of P518/Qrfp in nonneuronal tissues in osteopenic SAMP6 mice, consistent with the decrease in bone mineral density seen in GPR103A receptor knockouts. We therefore measured the expression level of P518/Qrfp in mRNA isolated from SAMP6 and SAMR1. Measurement of P518/Qrfp mRNA by TaqMan analysis demonstrated that liver levels of P518/Qrfp message were reduced fivefold in SAMP6 mice (Fig. 3). TaqMan analysis of tissue expression of P518/Qrfp and its receptor(s) in human, mouse, and rat was also performed. Little if any GPR103A or GPR103B receptor was observed in mouse
liver, but message for P518/Qrfp was present (Fig. 4A). Surprisingly, rat GPR103A and GPR103B distribution was quite similar, unlike that observed for the mouse receptors (Figs. 4A and 4B). Prior studies had shown higher expression of mouse GPR103B in testis and eye [6] and expression of mouse GPR103A in eye and spine and human GPR103 in bone and heart [11]. We saw expression of mouse P518/Qrfp in bone and
Fig. 3. Expression of P518/Qrfp in mouse liver. Expression values are plotted as the average and standard deviation for three animals/strain.
632
Q. Zhang et al. / Genomics 90 (2007) 629–635
higher expression of GPR103A than GPR103B in retina (Fig. 4A). Human GPR103 was also expressed in retina and heart (Fig. 4C). We also observed expression of human GPR103, mouse GPR103A and GPR103B, and rat GPR103A and GPR103B in spinal cord (Figs. 4A–4C) and mouse GPR103A and GPR103B in bone (Fig. 4A). During final preparation of this article, a report was published characterizing expression of rat P518/Qrfp and GPR103A and GPR103B in brain by in situ hybridization, showing message for P518/Qrfp in hypothalamus and GPR103B in thalamus and brain stem [18], and a report appeared demonstrating expression of human P518/Qrfp in brain and spinal cord [19], consistent with our findings. We examined the expression of P518/Qrfp, GPR103A, and GPR103B in SAMP6 and SAMR1 in additional tissues including lumbar spine, brain, hypothalamus, heart, and kidney (Fig. 5). Peripheral expression of P518/Qrfp is reduced in SAMP6 lumbar spine, which is significant because this is the site of the phenotype observed in GPR103A knockout mice [11]. GPR103A and GPR103B expression was similar in lumbar spine. We also observed that P518/Qrfp expression is reduced in SAMP6 brain and hypothalamus. GPR103A and GPR103B expression is increased in SAMP6 heart.
Discussion Several genomic loci have been associated with osteoporosis, some of which have been resolved to sequence polymorphisms in specific genes, described in detail in a recent review [20]. To our knowledge this is the first identification of a molecular candidate for the mouse chromosome 2qB QTL and the first identification of osteopenia-associated SNPs in the P518/Qrfp message. Searches of public SNP data did not reveal prior identification of the four SNPs reported in this study. The SAMP6 osteoporosis-prone mouse strain has a SNP in the P518/Qrfp promoter region resulting in generation of a putative repressive transcription factor binding site correlating with reduced peripheral expression. This coupled with observation of osteopenia in GPR103A knockout mice [11] suggests P518/Qrfp function is important for maintaining mineral bone density. The presence of ligand and receptor in spinal cord, bone, and osteoblasts [11] and inverse correlation of peripheral P518/Qrfp levels with osteopenia suggest that P518/Qrfp role in maintaining bone mineral density is direct as opposed to centrally mediated. Direct proof of SAMP6 P518/Qrfp NRSF promoter function has yet to be established. Proof might be obtained by direct binding
Fig. 4. Expression of P518/Qrfp and receptor(s). (A) Mouse P518/Qrfp and GPR103A and B. (B) Rat P518/Qrfp and GPR103A and B. (C) Human P518/Qrfp and GPR103.
Q. Zhang et al. / Genomics 90 (2007) 629–635
633
Fig. 4 (continued).
studies, cloning into a reporter gene construct, segregating the SAMP6 variant into a different strain, or characterizing heterozygotes. P518/Qrfp expression was also reduced in SAMP6 brain and hypothalamus (Fig. 5). NRSF neuronal silencing has been observed previously. NRSF silences nonneuronal expression and its neuronal expression is developmentally regulated [16], and it has also been shown to repress expression of mu opioid receptor in neuronal cells [29]. Use of P518/Qrfp and/or receptor agonists may be of benefit in osteoporosis. Presence of human GPR103 in heart (Fig. 4C) and reported effects of QRFP-43 on blood pressure and heart rate [6], which may be directly as opposed to centrally mediated, should be considered as a cautionary factor.
Polymerase chain reaction
Materials and methods
The general strategy for SNP discovery was as previously described [21] with modifications as detailed below. PCR primers were designed using the Primer3 software [22] (http://www.genome.wi.mit.edu/cgi-bin/primer/primer3.cgi) to amplify the P518/Qrfp promoter and coding region. One amplicon was produced using the forward primer 5′-CATATACCAGAACACCTCATCTGC-3′ and reverse 5′-CAGAGATTAATACTTCCTGGCTGG-3′, and the second was amplified using the forward primer 5′-GCTACAGGTGAATAGGAATCAGAC-3′ and reverse 5′TAGTGCACTGTGATACTCTCTCCG-3′. Forward and reverse primers were 5′ tailed with universal sequencing primers (−21M13, 5′-TGTAAAACGACGGCCAGT, and M13Rev, CAGGAAACAGCTATGACC, respectively). PCRs contained genomic DNA (24 ng) in the presence of USB FideliTaq (USB Corp., Cleveland, OH, USA) and 0.2 pmol/μl forward and reverse primers in 12 μl total volume. Thermocycling was performed in 96-well microplates (PTC-200 thermocycler; MJ Research) with an initial denaturation at 94 °C for 5 min followed by 35 cycles of denaturation at 94 °C for 30 s, primer annealing at 65 °C for 30 s, and primer extension at 68 °C for 1 min. After 35 cycles, a final extension was carried out for 7 min at 68 °C.
Mouse DNA and RNA samples
DNA sequencing and analysis
The promoter and coding region of P518/Qrfp were sequenced from genomic DNA obtained from mouse strains SAMP6, SAMR1, A/J, AKR/J, BALB/c, C3H/HeJ, C57BL/6J, and DBA/2J (n = 3 per strain). Genomic DNA was isolated from liver using the DNeasy Tissue kit (Qiagen, Valencia, CA, USA). RNA was obtained from livers of SAMP6 and SAMR1 mice using QIAZOL and RNeasy kits (Qiagen). Tissues from SAMP6 and SAMR1 mice were obtained from Harlan Laboratories (Indianapolis, IN, USA, and UK).
Following DNA amplification, PCRs were diluted to 50 μl in PCR buffer containing 0.5 μl of ExoSAP-IT (USB Corp.) and were incubated 15 min at 37 °C followed by inactivation of the enzymes at 80 °C for 15 min. Cycle sequencing in the forward and reverse directions was performed using the ABI Prism BigDye Terminator v3.1 Cycle Sequencing DNA Sequencing Kit (Applied Biosystems (ABI), Foster City, CA, USA) according to the manufacturer's instructions. Briefly, 1 μl of each PCR product was used as
634
Q. Zhang et al. / Genomics 90 (2007) 629–635
Fig. 4 (continued).
template and combined with 4 μl sequencing reaction mix containing 5 pmol M13 sequencing primer (− 21M13 or M13Rev), 0.5× Sequencing buffer and BDTv3.1 mix. Sequencing reactions were denatured for 1 min at 96 °C followed by 25 cycles at 96 °C for 10 s, 50 °C for 5 s, and 60 °C for 4 min. Sequencing reactions were purified by filtration using Montage SEQ96 plates (Millipore Corp., Bedford, MA, USA), dissolved in 25 μl deionized water, and resolved by
capillary gel electrophoresis on an Applied Biosystems 3730XL DNA analyzer. Chromatograms were transferred to a Unix workstation (DEC alpha; Compaq Corp), bases were called with Phred (version 0.990722.g), assembled with Phrap version 3.01 [23,24], and scanned with PolyPhred [21], and the results were viewed with Consed [25] version 9.0 (Phred, Phrap, and Consed available at http://www.genome.washington.edu, PolyPhred is available at http://droog.mbt.
Fig. 5. Expression of P518/Qrfp, GPR103A, and GPR103B in SAMP6 and SAMR1 tissues. Expression values are plotted as the average and standard deviation for three animals/strain. *p b 0.05.
Q. Zhang et al. / Genomics 90 (2007) 629–635
635
Table 1 Primer and probe sequences used in quantitative PCRs Human
Mouse
Rat
P518/Qrfp Forward Reverse Probe
GGCCTTACCCCCTGATCTACTT CTTCTGTCCAGTAGAGGGAAGCA TCTTCCTGCCGCTGGGCGC
TCGGAGCCAGGATGAACTG CTGTGGATTTTGAACCGAGTTG TGGCTGAGGGACATC
GTGCCTCTGCTCTTGGCTTT GATGTCTGTGGGTCCCCTTCT CTCCTGCCTCTGAGTGCCTGC
GPR103A Forward Reverse Probe
AGAAATGTCCAAAATAGCCAGGAAG GGACAACATGGAATGGTGCC TGTCATTATGATGGTGACAGTGGTGGCTCTC
CACCGCGGAGCAGTTTT TGTTCCCGAGTCAGGTTGTGT CGGCTGCTGAGCG
GCACGGAAGCCTGGGAAT ATGTGTCTCCTTTGGTTTCTTCCA AGCAAAGTTATCTCGACCACAGCGTCCA
GPR103B Forward Reverse Probe
N/A N/A N/A
TTGCTATTGCATTGTGAAGGAAA CACCATAGCTCCTGAACTTCCAT ACCTTCTTCAGCACGGAA
TGTGATGCACAGAAGAGTGAAGTTAG TGCTGCCCCCAAATGCT TGTGGGAGAGAATCCTGTAGAGATCA
washington.edu). Analysis parameters were all maintained at the individual software's default settings. SNPs were scored only if identified in both forward and reverse runs.
Quantitative PCR TaqMan primers and probes were designed with Primer Express software (ABI) and purchased from ABI. Primer and probe sequences are provided in Table 1. Tissue preparations, assay conditions, and quantitation were as described previously [1].
References [1] Y. Jiang, et al., Identification and characterization of a novel RF-amide peptide ligand for orphan G-protein coupled receptor SP9155, J. Biol. Chem. 278 (2003) 27652–27657. [2] N. Chartrel, et al., Identification of 26RFa, a hypothalamic neuropeptide of the RFamide peptide family with orexigenic activity, Proc. Natl. Acad. Sci. USA 100 (2003) 15247–15252. [3] R. Moriya, et al., RFamide peptide QRFP43 causes obesity with hyperphagia and reduced thermogenesis in mice, Endocrinology 147 (2006) 2916–2922. [4] S. Fukusumi, et al., A new peptidic ligand and its receptor regulating adrenal function in rats, J. Biol. Chem. 278 (2003) 46387–46395. [5] V.M. Navarro, et al., Novel role of 26RFa, a hypothalamic RFamide orexigenic peptide, as putative regulator of the gonadotropic axis, J. Physiol. 573 (2006) 237–249. [6] S. Takayasu, et al., A neuropeptide ligand of the G protein-coupled receptor GPR103 regulates feeding, behavioral arousal, and blood pressure in mice, Proc. Natl. Acad. Sci. USA 103 (2006) 7438–7443. [7] E.M. Egido, et al., 26RFa, a novel orexigenic neuropeptide, inhibits insulin secretion in the rat pancreas, Peptides 28 (2007) 725–730. [8] J.C. do Rego, J. Leprince, N. Chartrel, H. Vaudry, J. Marco, R.A. Silvestre, Behavioral effects of 26RFamide and related peptides, Peptides 27 (2006) 2715–2721. [9] R. Thuau, et al., Structural studies on 26RFa, a novel human RFamiderelated peptide with orexigenic activity, Peptides 26 (2005) 779–789. [10] T.K. Bjarnadottir, D.E. Gloriam, S.H. Hellstrand, H. Kristiansson, R. Frederiksson, H.B. Schioth, Comprehensive repertoire and phylogenetic analysis of the G protein-coupled receptors in human and mouse, Genomics 88 (2006) 263–273. [11] H. Baribault, et al., The G-protein coupled receptor GPR103 regulates bone formation, Mol. Cell. Biol. 26 (2006) 709–717. [12] H. Benes, et al., Chromosomal mapping of osteopenia-associated quantitative trait loci using closely related mouse strains, J. Bone Miner. Res. 15 (2000) 626–633.
[13] R.F. Klein, et al., Confirmation and fine mapping of chromosomal regions influencing peak bone mass in mice, J. Bone Miner. Res. 16 (2001) 1953–1961. [14] A.E. Kel, E. Gossling, I. Reuter, E. Cheremushkin, O.V. Kel-Margoulis, T. Werner, MATCH: a tool for searching transcription factor binding sites in DNA sequences, Nucleic Acids Res. 31 (2003) 3576–3579. [15] V. Matys, et al., TRANSFAC and its module TRANSCompel: transcriptional gene regulation in eukaryotes, Nucleic Acids Res. 34 (2006) D108–D110. [16] C.J. Schoenherr, A.J. Paquette, D.J. Anderson, Identification of potential target genes for the neuron-restrictive silencer factor, Proc. Natl. Acad. Sci. USA 93 (1996) 9881–9886. [17] Z.F. Chen, A.J. Paquette, D.J. Anderson, NRSF/REST is required in vivo for repression of multiple neuronal target genes during embryogenesis, Nat. Genet. 20 (1998) 136–142. [18] J. Kampe, et al., Effect of central administration of QRFP(26) peptide on energy balance and characterization of a second QRFP receptor in rat, Brain Res. 1119 (2006) 113–149. [19] F. Bruzzone, et al., Anatomical distribution and biochemical characterization of the novel RFamide peptide 26RFa in the human hypothalamus and spinal cord, J. Neurochem. 99 (2006) 616–627. [20] Q.A. Huang, W.C. Kung, Genetics of osteoporosis (minireview), Mol. Genet. Metab. 88 (2006) 295–306. [21] D.A. Nickerson, V.O. Tobe, S.L. Taylor, PolyPhred: automating the detection and genotyping of single nucleotide substitutions using fluorescence-based resequencing, Nucleic Acids Res. 25 (1997) 2745–2751. [22] S.A. Rosen, H.J. Skaletsky, Primer3 on the WWW for general users and for biologist programmers, Methods Mol. Biol. 132 (2000) 365–382. [23] B. Ewing, P. Green, Basecalling of automated sequencer traces using phred: II. Error probabilities, Genome Res. 8 (1998) 186–194. [24] B. Ewing, L. Hillier, M. Wendl, P. Green, Basecalling of automated sequencer traces using phred. I. Accuracy assessment, Genome Res. 8 (1998) 175–185. [25] D. Gordon, C. Abajian, P. Green, Consed: a graphical tool for sequence finishing, Genome Res. 8 (1998) 195–202. [26] W.J. Kent, et al., The human genome browser at UCSC, Genome Res. 12 (2002) 996–1006. [27] D. Karolchik, et al., The UCSC genome browser database, Nucleic Acids Res. 31 (2003) 51–54. [28] J.T. den Dunnen, S.E. Antonarakis, Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion, Hum. Mutat. 15 (2000) 7–12. [29] C.S. Kim, et al., Neuron-restrictive silencer factor (NRSF) functions as a repressor in neuronal cells to regulate the mu opioid receptor gene, J. Biol. Chem. 279 (2004) 46464–46473.