- Email: [email protected]
p53 gene mutations in brain tumors in Taiwan
CANCER LETTERS Cancer
Letters 78 (1994) 25-32
p.53 gene mutations in brain tumors in Taiwan Ling-Ling Hsieh*“, Chang-Feng Hsiab, Li-Yu Wang”, Chien-Jen Chenb, Yat-Sen Ho’ “Department of Public Health, Chang Gung Medical College, 259 Wen-Hwa I Road, Kwei-San. Tao- Yuan 3333-7. Taiwan. ROC hInslitule of Public Health, National Taiwan University. Taipei, 10018, Taiwan. ROC “Department of Pathology, Chang Gung Memorial Hospital. Tao- Yuan 33332, Tuiwan, ROC
(Received 3 December 1993: accepted 16 December 1993)
Abstract Mutations of the ~53 gene were investigated in 116 surgically removed primary brain tumor tissues by PCR-SSCP analysis. The mutations did not follow a random distribution among the various different subtypes, but occurred in 21.0% (13162) of astrocytomas, 13.0% (3/23) of oligodendrogliomas and 35% (7/20) of PNETs. No mutation was found in the ependymomas. The majority of mutations identified in this study were G:C to A:T or C:G to T:A transitions (56.0%, 14 of 25) and occurred most frequently (56.0X, 14 of 25) at sites of CpG dinucleotides. Interestingly, codon 158 is a new hot spot which occurred with a frequency of 16.0X (4 of 25) in the samples analyzed.
Key words: ~53 gene; Brain tumor; PCR-SSCP
1. Introduction
Tumors of the central nervous system account for approximately 1.84% of all human cancers in Taiwan. Most of adult primary brain tumors are gliomas, of which astrocytomas are the most common. These tumors are progressive, tend to recur following treatment, and are usually fatal. Recent studies have shown that cancers progress as a result of several sequential genetic events over time, and involve either activation of oncogenes or inactivation of tumor suppressor genes [2]. Loss of heterozygosity and chromosomal abnormalities have been observed in human brain tumors of * Corresponding author. 0304-3835/94/$06.00 0 1994 Elsevier Scientific SSDI 0304-3835(94)03252-E
Publishers
Ireland
variable histology [1,6,9,10,12-14,18,19,26,27]. These cytogenetic data suggest that several different suppressor genes may be involved and the loss or impaired function of any one may lead to genetic events resulting in the development of human brain tumors. The loss of heterozygosity of chromosome 17, the chromosome on which the ~53 gene resides, is one of the most common genetic abnormalities associated with human brain tumors. Tumor suppressor genes, especially ~53, are now known to play a crucial role in the development of a wide variety of human cancers [ 11,171. Most mutations are located in the conserved regions of the p.53 gene, which span exons 5-8. Recent studies have suggested a role for the inactivation of tumor suppressor gene ~53 in the formaLtd. All rights reserved.
L -L. Hsirh et (11./ Cunwr Lrlt. 78 (1994) 25-32
26
2.2. PCR-SSCP analysis DNA samples (500 ng) were subjected to the PCR reaction as described [8,22], using two oligonucleotides as primers. The nucleotide sequences of these primers are shown in Table 1 and, were custom made by Oligos Etc. Inc. (Wilsonville. OR, USA). The PCR mixture was heated to 95°C with an equal volume of formamide dye mixture (95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol, 20 mM EDTA); 2 ~1 of the preparation was applied onto a 6% polyacrylamide gel prepared with and without 10% glycerol. Electrophoresis was performed at 10 W for 12- 15 h at room temperature. The gel was dried on filter paper and exposed to X-ray film at -80°C for 1- 12 h with an intensifying screen.
tion of human brain tumors [7,10,14,2 1.241. In the present investigation, 116 cases of brain tumors, i.e. astrocytomas, oligodendrogliomas, ependymomas and primitive neuroectodermal tumors (PNET) were screened for the presence of aberrations in the evolutionary highly conserved regions (exons 5-9) of the ~53 gene, where the majority of mutations are localized. Aberrations of the ~53 gene were examined by single-strand conformation polymorphism (SSCP) analysis and direct sequencing of the polymerase chain reaction (PCR) products. Our data established the presence of point mutations at the p.53 gene locus in 23 of the 116 primary brain tumors. 2. Materials and methods 2.1. Tissue samples and preparation of DNA Brain tumor tissues were obtained by surgical excision from patients at the Chang Gung Memorial Hospital, Lin-Kou, Taiwan. Most tissue samples were paraffin-embedded. Some fresh tissue biopsies were immediately immersed in liquid nitrogen and stored at -80°C until processed. High molecular weight DNA was purified by digestion with proteinase K and extraction with phenol/chloroform, as previously described [8,16]. Histopathological grading of brain tumors was based on the classification scheme of the WHO. Glioblastoma multiformes were included in grade III of astrocytomas.
2.3. Direct DNA sequencing of PCR products PCR was performed with 5 pg of genomic DNA, 200 ng of each primer, 200 PM dNTPs, 1 x PCR reaction buffer and 2.5 units of Taq polymerase. Aliquots of PCR amplified mixtures were diluted with 2 ml of distilled Hz0 and spun in a Centricon 30 micro-concentrator (Amicon) to remove excess primers and dNTPs. DNA was then resuspended in 50 ~1 of 10 mM Tris (pH 8.0) and 1 mM EDTA. Direct sequencing of the amplified products was performed as described in the Promega fmol TM DNA sequencing system Technical Manual.
Table I Primers and annealing temperature used for amplification of the pS3 exons S-Y ~53 Exon amplified
Oligonucleotides
5
5’TTCCTCTTCCTGCAGTACTCIi’
6
5 ‘ACCCTGGGCAACCAGCCCTGT3 5’ACAGGGCTGGTTGCCCAGGGT3’
7
5’AGTTGCAAACCAGACCTCAG3’ 5 ‘GTGTTGTCTCCTAGGTTGGC3
8
5’GTCAGAGGCAAGCAGAGGCT3’ 5’TATCCTGAGTAGTGGTAATC3’
9
5’AAGTGAATCTGAGGCATAAC3’ 5’GCAGTTATGCCTCAGATTCAC3’ 5’AAGACTTAGTACCTGAAGGGT?’
Size of fragment (bp)
Annealing temperature (“C)
745
61
184
61
I89
61
213
58
13s
61
’ ’
L.-L. Hsieh et al. /Cancer
21
Lett. 78 (1994) 25-32
2.4. Experimental plan
A two-step experimental approach was devised. Using SSCP analysis, all tumor samples and two normal controls were analyzed for mutations in exons 5-9 of the ~53 gene, which are the regions most frequently affected in human tumors [ 11,171. Fragments displaying an altered electrophoretic mobility by SSCP analysis were subsequently reamplified in a separate PCR reaction and reanalyzed by SSCP. Under our experimental conditions, 100% concordance was found between the 1st and 2nd SSCP analyses. In addition, fragments with an altered electrophoretic mobility were reamplified in a separate reaction and subjected to direct sequencing of both strands to confirm and characterize the nature of the mutations. Two samples which exhibited a mobility shift in the SSCP analysis could not be sequenced due to lack of sufficient DNA material.
Table 2 Frequency
of ~53 mutations
in brain tumors
Diagnosis Normal
Positive/tested brain
o/2
(0.0)
13/62 l/IO 4/21 8131
(21.0) (10.0) (19.0) (25.8)
Oligodendroglioma Grade I Grade II Grade III
3123 O/6 l/8 219
( 13.0)
Ependymoma Grade II Grade III
Oil1 O/8 o/3
(0.0) (0.0) (0.0)
PNET
7120 (35.0)
Other types of brain tumors
013
Other types of non-brain
117 (14.3)
Astrocytoma Grade I Grade II Grade III
(%)
(0.0) (12.5) (22.2)
(0.0)
3. Results tumors
3.1. Frequency of p53 mutations in brain tumors
Of 116 brain tumor samples analyzed, 62 were astrocytomas, 23 oligodendrogliomas, 11 ependymomas and 20 PNETs; 2 normal controls from Chang Gung Memorial Hospital were also included. The SSCP data are summarized in Table 2, while representative results are shown in Fig. 1. The overall frequency of ~53 mutated samples in the primary brain tumors studied is 19.8% (23/l 16). The mutations occurred in 21 .O% (13/62) of astrocytomas, 13.00/o(3/23) of oligodendrogliomas and 35% (7/20) of PNETs. No mutation was found among the 11 ependymomas. Furthermore, higher grade tumors tend to show a higher mutation rate in the ~53 gene within the same subtype of brain tumors. This indicates a possible role of the ~53 tumor suppressor gene in the development of several central nervous system neoplasms of divergent histogenesis. 3.2. Type and position of p53 mutations
The characteristics of the ~53 mutations detected by SSCP analysis were further examined by direct sequencing of the PCR-amplified exons (Table 3; Fig. 2). All of the ~53 mutations detected were represented by single nucleotide changes,
mainly missense mutations (20 events) and occasionally point deletions (2 events), nonsense mutations (2 events), or point insertion (1 event). The prevailing mutations were G:C to A:T and C:G to T:A transitions (56.0%, 14 of 25) and occurred frequently (56.0%, 14 of 25) at CpG dinucleotide sites, which are known to be hot spots in the ~53 gene for many types of human cancer. The location of mutations affecting the ~53 gene has been reported to correspond to regions of the gene which display a high degree of homology among different species [ 11,251. Sixteen point mutations (64.0%) fell within these regions, while 9 were located at other sites, with 4 at codon 158. The majority of mutations that we identified were localized in exon 5 (11 of 24), exon 7 (6 of 24) and exon 8 (6 of 24). As shown in Table 3, the frequency of mutations at ‘hot spot’ codons 175, 248 and 273 was 12.0% (3 of 25), 8.0% (2 of 25) and 12.0% (3 of 25) respectively. It is noteworthy that residue 158 is a novel hot spot, which occurred with a frequency of 16.0% (4 of 25).
a
Exon 9
Exon
Fig. I. SSCP analysis of ~53 mutations in brain tumors. PCR-amplified fragments corresponding to individual exons 5-9 were amplified from genomic DNA in presence of [ol-32P]dCTP. denatured by heat and run on a 6% acrylamide gel containing 10% glycerol. Representative samples are shown for exons 5-8. Samples w scored positive for mutations when bands different from the normal control were detectable.
Exon 7
Exon 6
Exon 5
f
2 2
2
f’ 2 T c‘ $
PC
L.-L. Hsieh et al. /Cancer
29
Lett. 78 (1994) 25-32
Table 3 ~53 Mutations in brain tumors Sample
Diagnosis
Codon
Mutation
Amino acid substitution
Br 10
Astrocytoma, grade III
Br Br Br Br Br Br Br Br
PNET Oligodendroglioma, Astrocytoma, grade Astrocytoma, grade Astrocytoma, grade Oligodendroglioma, Astrocytoma, grade Astrocytoma, grade
158 248 245 273 Exon 196 Exon 278 288 158 248 175 175 240 306 179 306 162 239 173 158 245 273 I58 175 195 131 193
C GC-CAC CGG-TGG GGC-AGC CGT-TGT 5” CGA-TGA 7
Arg-His Arg-Trp Gly-Ser Arg-Cys
C CT-CAT AAT-AT CGC-CAC C GG-TGG CGC-CAC C??C-CAC A-GT-ACT CGA-GA CAT-CGT CGA-TGA
Pro-His Frameshift Arg-His Arg-Trp Arg-His Arg-His Ser-Thr Frameshift His-Arg Arg-Stop Ile-Val Frameshift Val-Leu Arg-His Gly-Ser Arg-Cys Arg-His Arg-His Ile-Thr Asn-Be His-Arg
12 21 28 30 32 44 52 55
grade II III III I grade III III III
Br 57 Br 67 Br 69
Astrocytoma, grade II Astrocytoma, grade II Oligodendroglioma, grade III
Br Br Br Br Br Br Br
77 88 106 II7 120 123 I25
PNET Astrocytoma, grade II Astrocytoma, grade II PNET PNET Astrocytoma, grade III PNET
Br Br Br Br Br
I55 164 I65 181 I6
PNET Astrocytoma, grade III PNET Astrocytoma, grade III Osteosarcoma
ATC-GTC AAC-AAAC GTG-TTG CGC-CAC Gk-AGC CCT-TGT CGC-CTC C GC-CAC A-J-ACC A AC-ATC CAT-CG-I -
Arg-Stop
“Not enough DNA for confirmation by DNA sequencing.
As noted above, a large proportion of the mutations of p53 in this study on brain tumors occurred within exon 5. Five of 11 of these mutations were clustered within codons 158-162, an area of the p.53 gene corresponding to a region of unknown biological function which lies outside the domains II and III. This finding is similar to a previous study on brain tumors [lo]. In contrast to G:C to T:A transversion by Frankel et al. [lo], however, four of the five mutations were a G:C to A:T or A:T to G:C transition. In general, the mutant-type sequence at the mutation site was present at a low intensity in lowgrade tumors, presumably reflecting contamination of DNAs from non-neoplastic cells in the
tumors. In four tumors, two mutations were observed at different codons in the presence of a wildtype band. 4. Discussion The etiology of brain tumors is still unresolved. The genetic events which predispose to the development of brain tumors are also largely unknown. Tumor suppressor genes, especially ~53, are now thought to play a major role in the genesis of a wide variety of human cancers [ 11,171. Most mutations are located in the conserved regions of the p53 gene, which spans exons 5-8. In this report, we have analyzed different types of brain
30
L.-L. Hsieh CI al. / C’ancrr Leti. 78 (1994) 25-32 G
A
T
GA
C
TC
GATC
COdOIl
246
Er 55T
Br 67T
G
ATC
Br 52T
Fig. 2. ~53 Mutations is shown 5’ (bottom)
Br 10T
G
A
T
C
Br 68T
detected by PCR-amplified fragments. The codon at which the mutation occurs is indicated. Each sequence to 3’ (top). Coding strands arc shown for (A) Br 55T and Br 67T (exon 5). (B) Br 16T (exon 6) and Br IOT (exon 7) and (C) Br 52T and Br 88T (exon 8).
62 astrocytomas, 23 oligodendrogliomas, 11 ependymomas, and 20 PNETs for specific genetic changes in the ~53 gene exon 5 to exon 9 which might contribute to their evolution. Aberrations of the ~53 gene were examined by PCR-SSCP analysis and direct sequencing of the PCR products. The overall frequency of p.53 mutated samples in the primary brain tumors studied was 19.8% (23/l 16). However, the mutations did not follow a random distribution profile tumors:
G G T
among different subtypes, but occurred in 21.0% (13162) of astrocytomas, 13.0% (3/23) of oligodendrogliomas and 3.5% (7120) of PNETs. No mutation was detected in the 11 ependymomas. This finding is consistent with a study by Ohgaki et al. (1992) on 15 ependymomas. Thus, the molecular mechanism involved in the development of ependymomas is likely different from other types of brain tumors. Higher grade tumors tend to have a higher mutation rate than lower grade tumors in
L.-L. Hsieh et al. /Cancer
31
Leit. 78 (1994) 25-32
astrocytomas and oligodendrogliomas. PNETs, which are the most poorly differentiated brain tumors exhibited the highest mutation rate in the ~5.3 gene. These results are consistent with previous findings [7,14,21,24]. Thus, the ~53 gene mutation appears to be associated with brain tumor progression. The predominant mutations identified in our study were G:C to A:T and C:G to T:A transitions (56.0%, 14 of 25), frequently at CpG dinucleotide sites, which are known mutational hot spots in the ~53 gene in many types of human cancers [ 10,l 1,171. However, 2 of 7 mutations in PNETs are G:C to T:A transversions. G to T transversions have also been found in 2 of 13 mutations in gliblastoma multiforme brain tumors [IO]. Transversions of this type have been observed in lung cancers and hepatocellular carcinomas [ 111, which are usually associated with exposure to chemical carcinogens. Taken together, environmental chemical carcinogen exposure may play an important role in the genesis of some malignant brain tumors. This possibility warrants further investigation. We observed that a large proportion of the mutations ofp53 occurred in exon 5 (11 of 25), and 5 of the 11 (45.5%) mutations were clustered within codons 158-162. Frankel et al. [lo] noted in their study of gliomas that 4 of 8 (50%) mutations in exon 5 were situated within codons 156-168. Chiba et al. [4] reported that 6 of 10 (60%) mutations in exon 5 occurred between codons 151 and 159 in the case of non-small cell lung cancer. Casson et al. [3] also found 2 of 5 (40%) mutations in exon 5 at codons 152 and 155 in Barrett’s epithelium, a premalignant stage of esophageal carcinoma. This region (codons 151-168) of the ~53 gene lies between the two highly conserved domains, II and III, which bind the SV40 large T antigen [25], and has not been shown previously to have a specific function. These data provide evidence for an additional hot region in the ~53 gene where mutations may alter an important function of the ~53 protein. There are three mutation ‘hot spots’ affecting codons 175 (7.4%, 24 of 324) 248 ( 10.8%, 35 of 324) and 273 (7.4%, 24/324) [ll]. The frequency and distribution of these hot spots differ among
cancers from different types of tissue. In the brain tumors studied, an almost equal mutation frequency was found at codons 175 (10.9%, 7 of 64), 248 (9.4%, 6 of 64) and 273 (7.8%, 5 of 64) [5,7,14,20,21,23, 241. In the present study, we found a frequency of mutations at codons 175, 248 and 273 of 12.0% (3 of 25) 8.0% (2 of 25) and 12.0% (3 of 25) respectively. It is noteworthy that codon 158 is a new hot spot with a 16.0% (4 of 25) frequency in our samples. It is possible that a mutation at this novel hot spot may be associated with special risk factors for the development of brain tumors in Taiwan, and requires further investigation. It has been demonstrated that many brain tumors contain an abundance of non-neoplastic cells. Therefore, the DNA extracted from such tumors is often heavily contaminated with DNA derived from normal cells. In this study, the mutant-type sequence at the mutation site was of a low intensity in low-grade tumors, most likely reflecting contamination with DNA from nonneoplastic cells. Possibly then, ~53 gene mutations are being underestimated in surgical specimens of primary low-grade brain tumors. Taken together, ~53 mutations do occur at a significant frequency in brain tumors and perhaps play a role in the development of these tumors. 5. Acknowledgments This study was supported by NSC Grant NSC82-0115-B182-108 (to Y.T.H. and L.L.H.) and Chang Gung Medical Research Grant CMRP296 (to L.L.H.) 6. References Bigner. S.H.. Mark, J., Burger, P.C.. Mahaley, MS., Jr., Bullard. D.E., Muhlbaier, L.H. and Bigner, D.D. ( 1988) Specific chromosomal abnormalities in malignant human gliomas. Cancer Res., 48, 405-41 I, Bishop, J.M. (1991) Molecular themes in oncogenesis. Cell. 64, 235-248. Casson, A.G., Mukhopadhyay, T.. Cleary, K.R.. Ro. J.Y.. Levin. B. and Roth, J.A. (199l)p53 Gene mutations in Barrett’s epithelium and esophageal cancer. Cancer Res.. 51, 4495-4499. Chiba. I., Takahashi. T., Nau. M.M., D’Amico. D.. Curiel. D.T., Mitsudomi, T.. Buchhagen, D.L., Carbone.
L.-L. Hsieh et al. /Cancer
32
5
6
7
8
9
D., Piantadosi, S., Koga, H.. Reissman. P.T., Slamon. D.J., Holmes, E.C. and Minna, J.D. (1990) Mutations in the ~53 gene are frequent in primary, resected non-small cell lung cancer. Oncogene, 5. 1603-1610. Chung R., Whaley, J., Kley. N., Anderson, K.. Louis, D.. Menon, A., Hettlich, C.. Freiman, R., Hedley-Whyte. E.T., Martuza, R., Jenkins, R.. Yandell, D. and Seizinger. B.R. (1991) TP53 gene mutation and l7p deletions in human astrocytomas. Genes Chromosomes Cancer, 3, 323-331. Cogen, P.H., Daneshaar, L., Metzger. A.K. and Edwards, M.S. (1990) Deletion mapping of the medulloblastoma locus on chromosome 17~. Genomics, 8, 279-285. von Deimling, A., Eibl, R.H., Ohgaki, H., Louis, D.N.. von Ammon, K., Petersen, 1.. Kleihues, P.. Chung, R.Y.. Wiestler, O.D. and Seizinger, B.R. (1992) ~53 Mutations are associated with l7p allelic loss in grade II and grade III astrocytoma. Cancer Res.. 52, 2987-2990. Dubeau. L., Chandler, LA, Gralow, J.R., Nichols. P.W. and Jones, P.A. (1986) Southern blot analysis of DNA extracted from formalin-lixed pathology specimens. Cancer Res., 46. 2964-2969. El-Azouzi, M., Chung. R.Y.. Farmer. G.E., Martuza. R.L.. Black, P.M., Rouleau, G.A., Hettlich. C., HedleyWhyte, E.T., Zervas, N.T., Panagopoulos, K., Nakamura. Y.. Gusella, J.F. and Seizinger, B.R. (1989) Loss of distinct regions of the short arm of chromosome I7 associated with tumorigenesis of human astrocytomas. Proc.
Natl. Acad. Sci. USA, 86, 7186-7190. IO Frankel, R.H., Bayona, W.. Koslow, M. and Newcomb, E.W. (1992) ~53 Mutations in human malignant gliomas: comparison of loss heterozygosity with mutation frequency. Cancer Res., 52, 1427-1433. II de Fromentel, C.C. and Soussi, T. (1992) TP53 tumor suppressor gene: a model for investigating human mutagenesis. Gene Chromosome Cancer., 4, I-15. 12 Fults, D.. Tippets. R.H.. Thomas, G.A., Nakamura. Y. and White, R. (1989) Loss of heterozygosity for loci on chromosome l7p in human malignant astrocytoma. Cancer Res., 49, 6572-6577. 13 Fults, D., Pedone. C.A.. Thomas. G.A. and White. R. (1990) Allelotype of human malignant astrocytoma. Cancer Res.. 50. 5784-5789. 14 Fults, D.. Brockmeyer. D., Tullous. M.W., Pedone, C.A. and Cawthon. R.M. (1992) ~53 Mutation and loss of heterozygosity on chromosome 17 and IO during human astrocytoma progression. Cancer Res.. 52, 674-679. 15 Gaidano, G.. Ballerini, P.. Gong, J.Z.. Inghirami, G.. Neri. A., Newcomb, E.W., Magrath, I.T.. Knowles. D.M. and Dalla-Favera, R. (1991) ~53 Mutations in human lymphoid malignancies: association with Burkitt lympho-
I6
I7
Lett. 78 (1994) 25-32
ma and chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. USA, 88, 5413-5417. Goelz, SE., Hamilton, S.R. and Vogelstein, B. (1985) Purification of DNA from formaldehyde fixed and paraffin embedded human tissue. Biochem. Biophys. Res. Commun.. 130. 118-126. Hollstein, M., Sidransky, D.. Vogelstein, B. and Harris, C.C. (1991) ~53 Mutations in human cancers. Science. 253, 49-53.
I8
James, C.D., Carlbom. E.. Dumanski, J.P.. Hansen. M., Nordenskjold, M.. Collins, V.P. and Cavenee. W.K. (1988) Clonal genomic alterations in glioma malignancy stages. Cancer Res.. 48. 5546-5551.
I9
James, C.D.. He, L., Carlbom, E.. Mikkelsen. T.. Ridderheim, P.A., Cavanee, W.K. and Collins. V.P. (1990) Loss of genetic information in central nervous system tumors common to children and young adults. Genes Chromosomes Cancer, 2, 94-102. Mashiyama. S., Murakami. Y.. Yoshimoto, T.. Sekiya. T. and Hayashi. K. (1991) Detection of p53 gene mutations in human brain tumors by single-strand conformation polymorphism analysis of polymerase chain reaction products. Oncogene, 6, 1313-1318. Ohgaki, H.. Eibl. R.H., Wiestler. O.D.. Yasargil, M.G.. Newcomb, E.W. and Kleihues. P. (199l)p53 Mutations in nonastrocytic human brain tumors. Cancer Res.. 51, 6202-6205. Orita, M., Suzuki, Y., Sekiya, T. and Hayashi, K. (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics, 5, 874-879. Saxena, A., Clark, W.C.. Robertson, J.T.. Ikejiri. B.. Oldlield. E.H. and Ah, I.U. (1992) Evidence for the involvement of a potential second tumor suppressor gene on chromosome I7 distinct from ~53 in malignant astrocytomas. Cancer Res., 52. 67 16-672 I Sidransky, D., Mikkelsen, T., Schwechheimer. K., Rosenblum. M.L.. Cavanee. W. and Vogelstein, B. (1992) Clonal expansion of ~53 mutant cells is associated with brain tumor progression. Nature, 355, 846-847. Soussi, T.. de Fromentel. C.C. and May, P. (1990) Structural aspects of the ~53 protein in relation to gene evolution. Oncogene, 5, 945-952. Stratton, M.R., Darling, J., Lantos. P.L.. Cooper, C.S. and Reenes. B.R. (1989) Cytogenetic abnormalities in human ependymomas. Int. J. Cancer. 15, 579-581. Thomas, G.A. and Raffel, C. (1991) Loss of heterozygosity on 6q, l6q and l7p in human central nervous system primitive neuroectodermal tumors. Cancer Res.. 5 I, 639-643.
20
?I
22
23
24
25
26
21
Letters 78 (1994) 25-32
p.53 gene mutations in brain tumors in Taiwan Ling-Ling Hsieh*“, Chang-Feng Hsiab, Li-Yu Wang”, Chien-Jen Chenb, Yat-Sen Ho’ “Department of Public Health, Chang Gung Medical College, 259 Wen-Hwa I Road, Kwei-San. Tao- Yuan 3333-7. Taiwan. ROC hInslitule of Public Health, National Taiwan University. Taipei, 10018, Taiwan. ROC “Department of Pathology, Chang Gung Memorial Hospital. Tao- Yuan 33332, Tuiwan, ROC
(Received 3 December 1993: accepted 16 December 1993)
Abstract Mutations of the ~53 gene were investigated in 116 surgically removed primary brain tumor tissues by PCR-SSCP analysis. The mutations did not follow a random distribution among the various different subtypes, but occurred in 21.0% (13162) of astrocytomas, 13.0% (3/23) of oligodendrogliomas and 35% (7/20) of PNETs. No mutation was found in the ependymomas. The majority of mutations identified in this study were G:C to A:T or C:G to T:A transitions (56.0%, 14 of 25) and occurred most frequently (56.0X, 14 of 25) at sites of CpG dinucleotides. Interestingly, codon 158 is a new hot spot which occurred with a frequency of 16.0X (4 of 25) in the samples analyzed.
Key words: ~53 gene; Brain tumor; PCR-SSCP
1. Introduction
Tumors of the central nervous system account for approximately 1.84% of all human cancers in Taiwan. Most of adult primary brain tumors are gliomas, of which astrocytomas are the most common. These tumors are progressive, tend to recur following treatment, and are usually fatal. Recent studies have shown that cancers progress as a result of several sequential genetic events over time, and involve either activation of oncogenes or inactivation of tumor suppressor genes [2]. Loss of heterozygosity and chromosomal abnormalities have been observed in human brain tumors of * Corresponding author. 0304-3835/94/$06.00 0 1994 Elsevier Scientific SSDI 0304-3835(94)03252-E
Publishers
Ireland
variable histology [1,6,9,10,12-14,18,19,26,27]. These cytogenetic data suggest that several different suppressor genes may be involved and the loss or impaired function of any one may lead to genetic events resulting in the development of human brain tumors. The loss of heterozygosity of chromosome 17, the chromosome on which the ~53 gene resides, is one of the most common genetic abnormalities associated with human brain tumors. Tumor suppressor genes, especially ~53, are now known to play a crucial role in the development of a wide variety of human cancers [ 11,171. Most mutations are located in the conserved regions of the p.53 gene, which span exons 5-8. Recent studies have suggested a role for the inactivation of tumor suppressor gene ~53 in the formaLtd. All rights reserved.
L -L. Hsirh et (11./ Cunwr Lrlt. 78 (1994) 25-32
26
2.2. PCR-SSCP analysis DNA samples (500 ng) were subjected to the PCR reaction as described [8,22], using two oligonucleotides as primers. The nucleotide sequences of these primers are shown in Table 1 and, were custom made by Oligos Etc. Inc. (Wilsonville. OR, USA). The PCR mixture was heated to 95°C with an equal volume of formamide dye mixture (95% formamide, 0.05% bromophenol blue, 0.05% xylene cyanol, 20 mM EDTA); 2 ~1 of the preparation was applied onto a 6% polyacrylamide gel prepared with and without 10% glycerol. Electrophoresis was performed at 10 W for 12- 15 h at room temperature. The gel was dried on filter paper and exposed to X-ray film at -80°C for 1- 12 h with an intensifying screen.
tion of human brain tumors [7,10,14,2 1.241. In the present investigation, 116 cases of brain tumors, i.e. astrocytomas, oligodendrogliomas, ependymomas and primitive neuroectodermal tumors (PNET) were screened for the presence of aberrations in the evolutionary highly conserved regions (exons 5-9) of the ~53 gene, where the majority of mutations are localized. Aberrations of the ~53 gene were examined by single-strand conformation polymorphism (SSCP) analysis and direct sequencing of the polymerase chain reaction (PCR) products. Our data established the presence of point mutations at the p.53 gene locus in 23 of the 116 primary brain tumors. 2. Materials and methods 2.1. Tissue samples and preparation of DNA Brain tumor tissues were obtained by surgical excision from patients at the Chang Gung Memorial Hospital, Lin-Kou, Taiwan. Most tissue samples were paraffin-embedded. Some fresh tissue biopsies were immediately immersed in liquid nitrogen and stored at -80°C until processed. High molecular weight DNA was purified by digestion with proteinase K and extraction with phenol/chloroform, as previously described [8,16]. Histopathological grading of brain tumors was based on the classification scheme of the WHO. Glioblastoma multiformes were included in grade III of astrocytomas.
2.3. Direct DNA sequencing of PCR products PCR was performed with 5 pg of genomic DNA, 200 ng of each primer, 200 PM dNTPs, 1 x PCR reaction buffer and 2.5 units of Taq polymerase. Aliquots of PCR amplified mixtures were diluted with 2 ml of distilled Hz0 and spun in a Centricon 30 micro-concentrator (Amicon) to remove excess primers and dNTPs. DNA was then resuspended in 50 ~1 of 10 mM Tris (pH 8.0) and 1 mM EDTA. Direct sequencing of the amplified products was performed as described in the Promega fmol TM DNA sequencing system Technical Manual.
Table I Primers and annealing temperature used for amplification of the pS3 exons S-Y ~53 Exon amplified
Oligonucleotides
5
5’TTCCTCTTCCTGCAGTACTCIi’
6
5 ‘ACCCTGGGCAACCAGCCCTGT3 5’ACAGGGCTGGTTGCCCAGGGT3’
7
5’AGTTGCAAACCAGACCTCAG3’ 5 ‘GTGTTGTCTCCTAGGTTGGC3
8
5’GTCAGAGGCAAGCAGAGGCT3’ 5’TATCCTGAGTAGTGGTAATC3’
9
5’AAGTGAATCTGAGGCATAAC3’ 5’GCAGTTATGCCTCAGATTCAC3’ 5’AAGACTTAGTACCTGAAGGGT?’
Size of fragment (bp)
Annealing temperature (“C)
745
61
184
61
I89
61
213
58
13s
61
’ ’
L.-L. Hsieh et al. /Cancer
21
Lett. 78 (1994) 25-32
2.4. Experimental plan
A two-step experimental approach was devised. Using SSCP analysis, all tumor samples and two normal controls were analyzed for mutations in exons 5-9 of the ~53 gene, which are the regions most frequently affected in human tumors [ 11,171. Fragments displaying an altered electrophoretic mobility by SSCP analysis were subsequently reamplified in a separate PCR reaction and reanalyzed by SSCP. Under our experimental conditions, 100% concordance was found between the 1st and 2nd SSCP analyses. In addition, fragments with an altered electrophoretic mobility were reamplified in a separate reaction and subjected to direct sequencing of both strands to confirm and characterize the nature of the mutations. Two samples which exhibited a mobility shift in the SSCP analysis could not be sequenced due to lack of sufficient DNA material.
Table 2 Frequency
of ~53 mutations
in brain tumors
Diagnosis Normal
Positive/tested brain
o/2
(0.0)
13/62 l/IO 4/21 8131
(21.0) (10.0) (19.0) (25.8)
Oligodendroglioma Grade I Grade II Grade III
3123 O/6 l/8 219
( 13.0)
Ependymoma Grade II Grade III
Oil1 O/8 o/3
(0.0) (0.0) (0.0)
PNET
7120 (35.0)
Other types of brain tumors
013
Other types of non-brain
117 (14.3)
Astrocytoma Grade I Grade II Grade III
(%)
(0.0) (12.5) (22.2)
(0.0)
3. Results tumors
3.1. Frequency of p53 mutations in brain tumors
Of 116 brain tumor samples analyzed, 62 were astrocytomas, 23 oligodendrogliomas, 11 ependymomas and 20 PNETs; 2 normal controls from Chang Gung Memorial Hospital were also included. The SSCP data are summarized in Table 2, while representative results are shown in Fig. 1. The overall frequency of ~53 mutated samples in the primary brain tumors studied is 19.8% (23/l 16). The mutations occurred in 21 .O% (13/62) of astrocytomas, 13.00/o(3/23) of oligodendrogliomas and 35% (7/20) of PNETs. No mutation was found among the 11 ependymomas. Furthermore, higher grade tumors tend to show a higher mutation rate in the ~53 gene within the same subtype of brain tumors. This indicates a possible role of the ~53 tumor suppressor gene in the development of several central nervous system neoplasms of divergent histogenesis. 3.2. Type and position of p53 mutations
The characteristics of the ~53 mutations detected by SSCP analysis were further examined by direct sequencing of the PCR-amplified exons (Table 3; Fig. 2). All of the ~53 mutations detected were represented by single nucleotide changes,
mainly missense mutations (20 events) and occasionally point deletions (2 events), nonsense mutations (2 events), or point insertion (1 event). The prevailing mutations were G:C to A:T and C:G to T:A transitions (56.0%, 14 of 25) and occurred frequently (56.0%, 14 of 25) at CpG dinucleotide sites, which are known to be hot spots in the ~53 gene for many types of human cancer. The location of mutations affecting the ~53 gene has been reported to correspond to regions of the gene which display a high degree of homology among different species [ 11,251. Sixteen point mutations (64.0%) fell within these regions, while 9 were located at other sites, with 4 at codon 158. The majority of mutations that we identified were localized in exon 5 (11 of 24), exon 7 (6 of 24) and exon 8 (6 of 24). As shown in Table 3, the frequency of mutations at ‘hot spot’ codons 175, 248 and 273 was 12.0% (3 of 25), 8.0% (2 of 25) and 12.0% (3 of 25) respectively. It is noteworthy that residue 158 is a novel hot spot, which occurred with a frequency of 16.0% (4 of 25).
a
Exon 9
Exon
Fig. I. SSCP analysis of ~53 mutations in brain tumors. PCR-amplified fragments corresponding to individual exons 5-9 were amplified from genomic DNA in presence of [ol-32P]dCTP. denatured by heat and run on a 6% acrylamide gel containing 10% glycerol. Representative samples are shown for exons 5-8. Samples w scored positive for mutations when bands different from the normal control were detectable.
Exon 7
Exon 6
Exon 5
f
2 2
2
f’ 2 T c‘ $
PC
L.-L. Hsieh et al. /Cancer
29
Lett. 78 (1994) 25-32
Table 3 ~53 Mutations in brain tumors Sample
Diagnosis
Codon
Mutation
Amino acid substitution
Br 10
Astrocytoma, grade III
Br Br Br Br Br Br Br Br
PNET Oligodendroglioma, Astrocytoma, grade Astrocytoma, grade Astrocytoma, grade Oligodendroglioma, Astrocytoma, grade Astrocytoma, grade
158 248 245 273 Exon 196 Exon 278 288 158 248 175 175 240 306 179 306 162 239 173 158 245 273 I58 175 195 131 193
C GC-CAC CGG-TGG GGC-AGC CGT-TGT 5” CGA-TGA 7
Arg-His Arg-Trp Gly-Ser Arg-Cys
C CT-CAT AAT-AT CGC-CAC C GG-TGG CGC-CAC C??C-CAC A-GT-ACT CGA-GA CAT-CGT CGA-TGA
Pro-His Frameshift Arg-His Arg-Trp Arg-His Arg-His Ser-Thr Frameshift His-Arg Arg-Stop Ile-Val Frameshift Val-Leu Arg-His Gly-Ser Arg-Cys Arg-His Arg-His Ile-Thr Asn-Be His-Arg
12 21 28 30 32 44 52 55
grade II III III I grade III III III
Br 57 Br 67 Br 69
Astrocytoma, grade II Astrocytoma, grade II Oligodendroglioma, grade III
Br Br Br Br Br Br Br
77 88 106 II7 120 123 I25
PNET Astrocytoma, grade II Astrocytoma, grade II PNET PNET Astrocytoma, grade III PNET
Br Br Br Br Br
I55 164 I65 181 I6
PNET Astrocytoma, grade III PNET Astrocytoma, grade III Osteosarcoma
ATC-GTC AAC-AAAC GTG-TTG CGC-CAC Gk-AGC CCT-TGT CGC-CTC C GC-CAC A-J-ACC A AC-ATC CAT-CG-I -
Arg-Stop
“Not enough DNA for confirmation by DNA sequencing.
As noted above, a large proportion of the mutations of p53 in this study on brain tumors occurred within exon 5. Five of 11 of these mutations were clustered within codons 158-162, an area of the p.53 gene corresponding to a region of unknown biological function which lies outside the domains II and III. This finding is similar to a previous study on brain tumors [lo]. In contrast to G:C to T:A transversion by Frankel et al. [lo], however, four of the five mutations were a G:C to A:T or A:T to G:C transition. In general, the mutant-type sequence at the mutation site was present at a low intensity in lowgrade tumors, presumably reflecting contamination of DNAs from non-neoplastic cells in the
tumors. In four tumors, two mutations were observed at different codons in the presence of a wildtype band. 4. Discussion The etiology of brain tumors is still unresolved. The genetic events which predispose to the development of brain tumors are also largely unknown. Tumor suppressor genes, especially ~53, are now thought to play a major role in the genesis of a wide variety of human cancers [ 11,171. Most mutations are located in the conserved regions of the p53 gene, which spans exons 5-8. In this report, we have analyzed different types of brain
30
L.-L. Hsieh CI al. / C’ancrr Leti. 78 (1994) 25-32 G
A
T
GA
C
TC
GATC
COdOIl
246
Er 55T
Br 67T
G
ATC
Br 52T
Fig. 2. ~53 Mutations is shown 5’ (bottom)
Br 10T
G
A
T
C
Br 68T
detected by PCR-amplified fragments. The codon at which the mutation occurs is indicated. Each sequence to 3’ (top). Coding strands arc shown for (A) Br 55T and Br 67T (exon 5). (B) Br 16T (exon 6) and Br IOT (exon 7) and (C) Br 52T and Br 88T (exon 8).
62 astrocytomas, 23 oligodendrogliomas, 11 ependymomas, and 20 PNETs for specific genetic changes in the ~53 gene exon 5 to exon 9 which might contribute to their evolution. Aberrations of the ~53 gene were examined by PCR-SSCP analysis and direct sequencing of the PCR products. The overall frequency of p.53 mutated samples in the primary brain tumors studied was 19.8% (23/l 16). However, the mutations did not follow a random distribution profile tumors:
G G T
among different subtypes, but occurred in 21.0% (13162) of astrocytomas, 13.0% (3/23) of oligodendrogliomas and 3.5% (7120) of PNETs. No mutation was detected in the 11 ependymomas. This finding is consistent with a study by Ohgaki et al. (1992) on 15 ependymomas. Thus, the molecular mechanism involved in the development of ependymomas is likely different from other types of brain tumors. Higher grade tumors tend to have a higher mutation rate than lower grade tumors in
L.-L. Hsieh et al. /Cancer
31
Leit. 78 (1994) 25-32
astrocytomas and oligodendrogliomas. PNETs, which are the most poorly differentiated brain tumors exhibited the highest mutation rate in the ~5.3 gene. These results are consistent with previous findings [7,14,21,24]. Thus, the ~53 gene mutation appears to be associated with brain tumor progression. The predominant mutations identified in our study were G:C to A:T and C:G to T:A transitions (56.0%, 14 of 25), frequently at CpG dinucleotide sites, which are known mutational hot spots in the ~53 gene in many types of human cancers [ 10,l 1,171. However, 2 of 7 mutations in PNETs are G:C to T:A transversions. G to T transversions have also been found in 2 of 13 mutations in gliblastoma multiforme brain tumors [IO]. Transversions of this type have been observed in lung cancers and hepatocellular carcinomas [ 111, which are usually associated with exposure to chemical carcinogens. Taken together, environmental chemical carcinogen exposure may play an important role in the genesis of some malignant brain tumors. This possibility warrants further investigation. We observed that a large proportion of the mutations ofp53 occurred in exon 5 (11 of 25), and 5 of the 11 (45.5%) mutations were clustered within codons 158-162. Frankel et al. [lo] noted in their study of gliomas that 4 of 8 (50%) mutations in exon 5 were situated within codons 156-168. Chiba et al. [4] reported that 6 of 10 (60%) mutations in exon 5 occurred between codons 151 and 159 in the case of non-small cell lung cancer. Casson et al. [3] also found 2 of 5 (40%) mutations in exon 5 at codons 152 and 155 in Barrett’s epithelium, a premalignant stage of esophageal carcinoma. This region (codons 151-168) of the ~53 gene lies between the two highly conserved domains, II and III, which bind the SV40 large T antigen [25], and has not been shown previously to have a specific function. These data provide evidence for an additional hot region in the ~53 gene where mutations may alter an important function of the ~53 protein. There are three mutation ‘hot spots’ affecting codons 175 (7.4%, 24 of 324) 248 ( 10.8%, 35 of 324) and 273 (7.4%, 24/324) [ll]. The frequency and distribution of these hot spots differ among
cancers from different types of tissue. In the brain tumors studied, an almost equal mutation frequency was found at codons 175 (10.9%, 7 of 64), 248 (9.4%, 6 of 64) and 273 (7.8%, 5 of 64) [5,7,14,20,21,23, 241. In the present study, we found a frequency of mutations at codons 175, 248 and 273 of 12.0% (3 of 25) 8.0% (2 of 25) and 12.0% (3 of 25) respectively. It is noteworthy that codon 158 is a new hot spot with a 16.0% (4 of 25) frequency in our samples. It is possible that a mutation at this novel hot spot may be associated with special risk factors for the development of brain tumors in Taiwan, and requires further investigation. It has been demonstrated that many brain tumors contain an abundance of non-neoplastic cells. Therefore, the DNA extracted from such tumors is often heavily contaminated with DNA derived from normal cells. In this study, the mutant-type sequence at the mutation site was of a low intensity in low-grade tumors, most likely reflecting contamination with DNA from nonneoplastic cells. Possibly then, ~53 gene mutations are being underestimated in surgical specimens of primary low-grade brain tumors. Taken together, ~53 mutations do occur at a significant frequency in brain tumors and perhaps play a role in the development of these tumors. 5. Acknowledgments This study was supported by NSC Grant NSC82-0115-B182-108 (to Y.T.H. and L.L.H.) and Chang Gung Medical Research Grant CMRP296 (to L.L.H.) 6. References Bigner. S.H.. Mark, J., Burger, P.C.. Mahaley, MS., Jr., Bullard. D.E., Muhlbaier, L.H. and Bigner, D.D. ( 1988) Specific chromosomal abnormalities in malignant human gliomas. Cancer Res., 48, 405-41 I, Bishop, J.M. (1991) Molecular themes in oncogenesis. Cell. 64, 235-248. Casson, A.G., Mukhopadhyay, T.. Cleary, K.R.. Ro. J.Y.. Levin. B. and Roth, J.A. (199l)p53 Gene mutations in Barrett’s epithelium and esophageal cancer. Cancer Res.. 51, 4495-4499. Chiba. I., Takahashi. T., Nau. M.M., D’Amico. D.. Curiel. D.T., Mitsudomi, T.. Buchhagen, D.L., Carbone.
L.-L. Hsieh et al. /Cancer
32
5
6
7
8
9
D., Piantadosi, S., Koga, H.. Reissman. P.T., Slamon. D.J., Holmes, E.C. and Minna, J.D. (1990) Mutations in the ~53 gene are frequent in primary, resected non-small cell lung cancer. Oncogene, 5. 1603-1610. Chung R., Whaley, J., Kley. N., Anderson, K.. Louis, D.. Menon, A., Hettlich, C.. Freiman, R., Hedley-Whyte. E.T., Martuza, R., Jenkins, R.. Yandell, D. and Seizinger. B.R. (1991) TP53 gene mutation and l7p deletions in human astrocytomas. Genes Chromosomes Cancer, 3, 323-331. Cogen, P.H., Daneshaar, L., Metzger. A.K. and Edwards, M.S. (1990) Deletion mapping of the medulloblastoma locus on chromosome 17~. Genomics, 8, 279-285. von Deimling, A., Eibl, R.H., Ohgaki, H., Louis, D.N.. von Ammon, K., Petersen, 1.. Kleihues, P.. Chung, R.Y.. Wiestler, O.D. and Seizinger, B.R. (1992) ~53 Mutations are associated with l7p allelic loss in grade II and grade III astrocytoma. Cancer Res.. 52, 2987-2990. Dubeau. L., Chandler, LA, Gralow, J.R., Nichols. P.W. and Jones, P.A. (1986) Southern blot analysis of DNA extracted from formalin-lixed pathology specimens. Cancer Res., 46. 2964-2969. El-Azouzi, M., Chung. R.Y.. Farmer. G.E., Martuza. R.L.. Black, P.M., Rouleau, G.A., Hettlich. C., HedleyWhyte, E.T., Zervas, N.T., Panagopoulos, K., Nakamura. Y.. Gusella, J.F. and Seizinger, B.R. (1989) Loss of distinct regions of the short arm of chromosome I7 associated with tumorigenesis of human astrocytomas. Proc.
Natl. Acad. Sci. USA, 86, 7186-7190. IO Frankel, R.H., Bayona, W.. Koslow, M. and Newcomb, E.W. (1992) ~53 Mutations in human malignant gliomas: comparison of loss heterozygosity with mutation frequency. Cancer Res., 52, 1427-1433. II de Fromentel, C.C. and Soussi, T. (1992) TP53 tumor suppressor gene: a model for investigating human mutagenesis. Gene Chromosome Cancer., 4, I-15. 12 Fults, D.. Tippets. R.H.. Thomas, G.A., Nakamura. Y. and White, R. (1989) Loss of heterozygosity for loci on chromosome l7p in human malignant astrocytoma. Cancer Res., 49, 6572-6577. 13 Fults, D., Pedone. C.A.. Thomas. G.A. and White. R. (1990) Allelotype of human malignant astrocytoma. Cancer Res.. 50. 5784-5789. 14 Fults, D.. Brockmeyer. D., Tullous. M.W., Pedone, C.A. and Cawthon. R.M. (1992) ~53 Mutation and loss of heterozygosity on chromosome 17 and IO during human astrocytoma progression. Cancer Res.. 52, 674-679. 15 Gaidano, G.. Ballerini, P.. Gong, J.Z.. Inghirami, G.. Neri. A., Newcomb, E.W., Magrath, I.T.. Knowles. D.M. and Dalla-Favera, R. (1991) ~53 Mutations in human lymphoid malignancies: association with Burkitt lympho-
I6
I7
Lett. 78 (1994) 25-32
ma and chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. USA, 88, 5413-5417. Goelz, SE., Hamilton, S.R. and Vogelstein, B. (1985) Purification of DNA from formaldehyde fixed and paraffin embedded human tissue. Biochem. Biophys. Res. Commun.. 130. 118-126. Hollstein, M., Sidransky, D.. Vogelstein, B. and Harris, C.C. (1991) ~53 Mutations in human cancers. Science. 253, 49-53.
I8
James, C.D., Carlbom. E.. Dumanski, J.P.. Hansen. M., Nordenskjold, M.. Collins, V.P. and Cavenee. W.K. (1988) Clonal genomic alterations in glioma malignancy stages. Cancer Res.. 48. 5546-5551.
I9
James, C.D.. He, L., Carlbom, E.. Mikkelsen. T.. Ridderheim, P.A., Cavanee, W.K. and Collins. V.P. (1990) Loss of genetic information in central nervous system tumors common to children and young adults. Genes Chromosomes Cancer, 2, 94-102. Mashiyama. S., Murakami. Y.. Yoshimoto, T.. Sekiya. T. and Hayashi. K. (1991) Detection of p53 gene mutations in human brain tumors by single-strand conformation polymorphism analysis of polymerase chain reaction products. Oncogene, 6, 1313-1318. Ohgaki, H.. Eibl. R.H., Wiestler. O.D.. Yasargil, M.G.. Newcomb, E.W. and Kleihues. P. (199l)p53 Mutations in nonastrocytic human brain tumors. Cancer Res.. 51, 6202-6205. Orita, M., Suzuki, Y., Sekiya, T. and Hayashi, K. (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics, 5, 874-879. Saxena, A., Clark, W.C.. Robertson, J.T.. Ikejiri. B.. Oldlield. E.H. and Ah, I.U. (1992) Evidence for the involvement of a potential second tumor suppressor gene on chromosome I7 distinct from ~53 in malignant astrocytomas. Cancer Res., 52. 67 16-672 I Sidransky, D., Mikkelsen, T., Schwechheimer. K., Rosenblum. M.L.. Cavanee. W. and Vogelstein, B. (1992) Clonal expansion of ~53 mutant cells is associated with brain tumor progression. Nature, 355, 846-847. Soussi, T.. de Fromentel. C.C. and May, P. (1990) Structural aspects of the ~53 protein in relation to gene evolution. Oncogene, 5, 945-952. Stratton, M.R., Darling, J., Lantos. P.L.. Cooper, C.S. and Reenes. B.R. (1989) Cytogenetic abnormalities in human ependymomas. Int. J. Cancer. 15, 579-581. Thomas, G.A. and Raffel, C. (1991) Loss of heterozygosity on 6q, l6q and l7p in human central nervous system primitive neuroectodermal tumors. Cancer Res.. 5 I, 639-643.
20
?I
22
23
24
25
26
21