- Email: [email protected]
p53 mutation in fresh lymphocytes, B-lymphoblastoid cell lines and their transformed cell lines originating from bloom syndrome patients
p53 Mutation in Fresh Lymphocytes, B-Lymphoblastoid Cell Lines and Their Transformed Cell Lines Originating from Bloom Syndrome Patients Yukimasa Shiraishi
To elucidate the molecular basis for malignant and premalignant states in Bloom syndrome (BS), p53 mutations were analyzed using Southern blot analysis and DNA sequencing of exons 5-9. p53 point mutations with and without loss of heterozygosity on 17p were detected in malignantly transformed BS cell lines carrying malignant lymphoma (ML) and stomach cancer (STC) antigens on the cell surface. However, p53 mutations were not detected in flesh lymphocytes and B-lymphoblastoid cell lines from four BS patients carrying high sister chromatid exchange (SCE) levels, using Southern blot and DNA sequencing of exons 5-9. Based on these results, we concluded that the p53 gene may not play a key role in the high spontaneous mutation rates (I-IGPRT locus) in somatic cells of BS patients and that the p53 mutation with an allelic loss of the p53 gene is an important factor in malignant conditions in BS. ABSTRACT:
INTRODUCTION Bloom syndrome (BS) is an autosomal recessive disease that is characterized clinically by growth retardation, immunodeficiency, solar sensitivity (especially of the facial skin), and predisposition to the development of cancer [1, 2]. Somatic cells (skin fibroblasts) from BS patients have been known to have a five- to tenfold increase in their spontaneous mutation rates at the hypoxanthine/guanine phosphoribosyltransferase (HGPRT) locus over that in normal skin fibroblasts [3, 4]. Because BS cells have elevated chromosome breakage and sister chromatid exchange (SCE) [5, 6], it is conceivable that the mechanism enhancing either deletions or unequal exchanges in the region distal to Xq26, where HGPRT maps, is responsible for the mutator activity. Patients with Bloom syndrome have an extremely high incidence of malignancy; therefore, a correlation with a high spontaneous mutation rate and somatic mutational theory of cancer should be readily apparent. Clinically, it has been considered as a pre-malignant condition. Recently, it has been shown that the p53 gene is a tumor suppressor gene and that its mutations play an important role in the development of many common human malignancies. The mutations are generally thought to be somatic, although in many cases this has not been directly demonstrated. In contrast, inherited p53 gene mutations have recently been reported in patients with the
From the Laboratory of Tumor Cell Biology, Department of Anatomy, Kochi Medical School, Nankoku-City 783, Kochi, Japan. Address reprint requests to: Dr. Yukimasa Shiraishi, Laboratory of Tumor Cell Biology, Department of Anatomy, Koch/ Medical School, Nankoku-City 783, Kochi, Japan. Received December 16, 1992; accepted April 7, 1993. 70 Cancer Genet Cytogenet68:70-73 (1993) 0165-4608/93/$06.00
Li-Franmeni syndrome [7-9]. There, patients have strong family histories of several tumor types, particularly leukemias, sarcomas, brain tumors, and breast cancers. The mode of inheritance appears to be autosomal dominant and more than 50% of the affected patients develop cancers before the age of 50. These studies prompted us to examine p53 mutation patterns in fresh somatic cells (lymphocytes), B-lymphoblastoid cell lines, and malignantly transformed cell lines from Bloom syndrome patients. In the present study, we analyzed the p53 mutation pattern by Southern blot restriction analysis and by DNA sequencing of exons 5, 6, 7, 8, and 9. Results, reported below, show that such mutations are rare in fresh lymphocytes and non-transformed B-lymphoblastoid cell lines from four BS patients, although point mutations were noted in the malignantly transformed BS cell line. MATERIALS AND METHODS
DNA was collected from fresh blood lymphocytes from four BS patients, from the father and mother of one BS patient, from five BS B-lymphoblastoid cell lines (Types I, II, and III cell lines) BSI_I, BS1_2, BS2_2, BS-SY3, and BS-SY4), and from two malignantly transformed BS cell lines (BS-SHI-4M ML and BS-SHI-4M STC) carrying malignant lymphoma (ML) and stomach cancer (STC) antigens [10-13]. A normal B-lymphoblastoid cell line was used as control. High molecular weight DNA was extracted by the sodium dodecyl sulfateproteinase K-phenol-chloroform method and precipitated in cold ethanol [14, 15]. Five micrograms of DNA was digested with appropriate restriction enzymes (EcoRI, BglII, and PvuII), size-fractionated by electrophoresis in 0.7%-1% agarose gel, and blotted on nitrocellulose membrane filters. Filters were subsequently
© 1993 Elsevier SciencePublishing Co., Inc.
655 Avenueof the Americas, New York, NY 10010
p53 Mutations in Bloom Syndrome Cells
71
Table 1 Oligonucleotide primers (5'-3') Exon
Upstream
Downstream
TTCCTCTTCCTGCAGTACTC CACTGATTGCTCTTAGGTCT GTGTTATCTCCTAGGTTGGC CCTATCCTGAGTAGTGGTAA TTGCCTCTTTCCTAGCACTG
CAGCTGCTCACCATCGCTAT AGTTGCAAACCAGACCTCAG CAAGTGGCTCCTGACCTGGA TCCTGCTTGCTTACCTCGCT CCCAAGACTTCGTACCTGAA
hybridized with 32p-labeled p53 gene cDNA probes (exons 5-10} {2-4 x 107 cpm/filter), washed at high stringency, and autoradiographed with intensifying screens.
PCR Amplification and Sequencing Oligonucleotide primers were synthesized by the phosphoramidite method using a 392 DNA synthesizer (Applied Biosystems, Inc., Foster City, CA). A set of PCR primers, flanking each of exons 5, 6, 7, 8, or 9, were used to generate a single specific amplification product from each sample [16]. The nucleotide sequences of the primers are summarized in Table 1. Polymerase chain reaction (PCR) was performed with the use of a thermal cycler (Astek, Fukuoka, Japan) with 100 ng of genomic DNA in a total volume of 100 I~1 containing 100 pmol of each oligonucleotide primer, 1.25 mM dNRP, and 2.5 units Taq polymerase in PCR buffer (Perkin-ElmerCetus) for 30 cycles in a programmable heat block. Each cycle included denaturation at 95°C for I minute, annealing at 55°C for 1.5 minute, and primer extension at 72°C for 2 minutes. After amplification, 70 ~tl of PCR reactions were fractionated in 2 % NuSieve GTG agarose gel electrophoresis. The amplified fragments were cut out and extracted by a Qiagen gel extraction kit (Qiagen, Inc., Chatsworth, CA). An aliquot (1-3 M) of the supernatant was then used as a DNA template in the PCR reaction. For direct sequencing, the primers were the same as those used in the original amplification, except that the 5' end of one primer contained M13, and the other contained the M13 reverse sequence. The double-stranded PCR product resulting from this amplification was purified by two centrifugal washes by using a SUPREC-2 microconcentrator (Takam Biomedicals, Kyoto, Japan). DNA sequences of the PCR products were determined by fluorescence-based dideoxy sequencing, using Taq polymerase in a thermal cycler, and fluorescently labeled M13 universal or reverse-sequencing primers. Followed by gel electrophoresis, data collection, and analysis on an Applied Biosystems Model 373A automated sequencer (Applied Biosystems, Inc.]. RESULTS Southern blot analysis revealed a normal migration pattern in all of the fresh lymphocytes from four BS patients and from the father and mother of a BS patient, as well as in all of the five BS B-lymphoblastoid cell lines (BS types I, II, and III) [10, 11]. As shown in Table 2, lymphocytes from three BS cases exhibited high SCE in 100% of the cells of PHAstimulated cultures and lymphocytes from one BS case (case 4} showed dimorphism of SCE levels (high-SCE cells, 85%;
low-SCE cells, 15%). There were no differences of p53 Southern blot patterns in BS types I, II, and III cell lines, p53 mutations in exons 5-9 (DNA sequencing) were not observed in all of the flesh lymphocytes from four BS cases, two BS heterozygotes, and all of BS types I, II, and III cell lines (Table 2). Two samples from malignantly transformed BS cell lines included in this study were informative for at least one marker on the short arm of chromosome 17. One of the BS malignantly transformed cell lines (malignant lymphoma antigen clone) showed loss of heterozygosity on 17p (Fig. 1, lane E). p53 mutations were identified at two different sites (codons 451 and 462) in BS-SHI-4M ML cells. Codon 451 (Fig. 2, examples 3 and 4) of CGC for Gly was mutated to TTG for Leu by a G to T transition; codon 462 (Fig. 2, examples 1 and 2) of A ~ for Met to ATT for Ile (Table 2). In the stomach cancer antigen clone BS-SHI-4M ST, codon 541 of CGC for Cys was mutated to CAC for Tyr by a G to A transition of the second letter (Fig. 2, examples 5 and 6), though loss of heterozygosity on 17p was not detected (Fig. 1F). Exons 6-9, also sequenced in these two BS-derived cancer antigen clones, had normal migration patterns; all exons proved to be of the wild type. DISCUSSION By using Southern blot analysis and DNA sequencing of Exons 5-9, we have detected p53 point mutations with and without loss of heterozygosity on 17p in malignantly transformed BS cell lines carrying ML and SIC antigens. However, p53 mutations were not detected in fresh lymphocytes and B-lymphoblastoid cell lines (BS types I, II, and III) from BS patients, using Southern blot and DNA sequencing of exons 5-9. Because BS has been known to dispose to malignancies at an early age and with high spontaneous mutation rates at the HGPRT locus, the association with p53 mutations was of special interest, especially in connection with genetic alterations on 17p. There seemed no correlation between high SCE levels and p53 mutation. From the viewpoint that patients with BS have a high incidence of various malignancies, high spontaneous mutations (HGPRT locus) in somatic cells, chromosome breakages and high SCE levels in somatic cells, the finding that no mutation was noted in the p53 gene in non-malignant BS cells might suggest the possibility of involvement of another mutation due to different cancer-suppressor genes. Because the p53 gene is located on 17p, the present study mainly examined the mutation of the cancer-suppressor gene mainly on 17p. Therefore, considering the high predisposition to var-
72
Y. S h i r a i s h i
Table 2
C h a r a c t e r i s t i c s o f B l o o m s y n d r o m e (BS) s o m a t i c c e l l s , B - l y m p h o b l a s t o i d their malignantly transformed cells, and p53 mutation pattern SCE level
Cell origin
M e a n ± S.E.
Fresh lymphocytes BS1 BS2 BS3 BS4 HBS1 HBS2 B - l y m p h o b l a s t o i d cell lines T y p e I BSI_, T y p e II BS-SY3 BS-SY4 T y p e III BS1-2
BS2-2 M a l i g n a n t l y t r a n s f o r m e d cell lines BS-SHI-4M ML
BS-SHI-4M STC
LOH 17p
1
2 3
1
Codon
Mutation nncleotide change
A m i n o acid change
72.4 71.8 76.6 70.4 5.4 4.9 5.1
± + ± + ± + ±
2.94 3.01 3.43 2.67 0.04 0.03 0.04
n n n n
Ex Ex Ex Ex
5-9 5-9 5-9 5-9
-
Wild Wild Wild Wild
type type type type
-
n n
Ex 5 - 7 Ex 5 - 7
-
Wild type Wild type
-
5.2 70.8 72.4 70.6 71.4
± + + ± +
0.05 2.89 2.78 2.91 3.01
n n n n n
Ex Ex Ex Ex Ex
5-9 5-9 5-9 5-9 5-9
--
Wild Wild Wild Wild Wild
-
60.6 + 3.12
LOH
71.5 + 2.65
n
Ex Ex Ex Ex Ex
5 5 6-9 5 6-9
451 462 -541 --
ious malignancies in BS, mutations of cancer-suppressor genes, except for p53, should be examined in BS. However, the present findings that L O H and point mutations were noted in the malignantly transformed BS clone carrying M L antigens clearly support other reports on p53 gene mutations. In summary, our study has shown the following: (a) the incidence of p53 mutations in BS cells is low. This was true
Kb
Exon
cell lines and
2 3
1 2 3
type type type type type
GGG~TTG ATG-~ATT W i l d type CGC~CAC Wild type
Gly-*Leu Met-'Ile Cys--Tyr
for fresh lymphocytes from four BS patients, a father and mother of a BS patient, and five BS B-lymphoblastoid cell l i n e s (BS t y p e s I, II, a n d m ) ; 0a) t h e p 5 3 p o i n t m u t a t i o n s w i t h and without LOH of p53 gene may be an important factor i n m a l i g n a n t t r a n s f o r m a t i o n , d u e to its p r e s e n c e i n t w o o f t w o B S - d e r i v e d m a l i g n a n t c l o n e s c a r r y i n g STC a n d M L a n t i g e n s . To f u r t h e r e x p l o r e t h e m o l e c u l a r b a s i s f o r B S m a l i g -
1
2
3
1
2
3
1
2
3
23.1 O
D
9.4
i
i
6.6-
i11
4.4-
t AI
LB
ILc-J
L-D
I L-E-J
LF-J
Figure 1 Southern blotanalysisof p53 gene in BS B-lymphoblastoid celllines {A, BSI_I;B, BS2_2; C, BS-SY3), BS fresh lymphocytes (D), BS-SHI-4M M L {E),and BS-SHI-4M STC {F) cells.Five micrograms D N A was digestedwith restrictionendonuclease {lane 1, EcoRI; lane 2, BgIII;lane 3, PvuII),electrophoresedin 0.7%-1% agarose gel and blotted on nitrocellulosefilters.Filterswere hybridized with a2p-labeledp53 gene cDNA {exon 5-10) probes. Loss of heterozygosityon 17p is noted in BgUI-treatedBS-SHI-4M M L D N A {E, lane 2). No specialrearrangements were detected from other samples (A, B, C, D, and F}.
p53 Mutations in Bloom Syndrome Cells
73
5' ;G.,~IGC1
3"
5'
3'
'
G AGA,~,
f
2
G~.CGC
."..". OGO
4~CGa~3.
G--OO.~". C
~C~,CC~ G,~OC,~C
V
It,/l I i!,lll Figure 2 Nucleotide sequence analysis of p53 genomic DNA. DNA fragments that showed a mobility shift on DNA from BS-SHI-4M ML and BS-SHI-4M STC ceils were PCR amplified and sequenced. The normal sequence of codons 451 (3), 462 (1), and 541 (5) are shown at the top, bottom panels show the G to T transversions at codons 451 (4) and 462 (2) and the G to A transversion at codon 541 (6). Mutated bases are indicated by arrows. n a n t t r a n s f o r m a t i o n i n the r e m a i n i n g m a j o r i t y w i t h o u t p53 m u t a t i o n s , o t h e r o n c o g e n e s or t u m o r - s u p p r e s s o r g e n e m u tations m u s t be systematically s t u d i e d .
8.
The author is grateful to Michiyo Ozawa for her technical assistance and photographic services. This work was supported in part by a special grant from the Kochi Medical School.
9.
REFERENCES 1. Pasarge E (1983): Bloom syndrome. In: German J (ed.)., Chromosome Mutation and Neoplasia. Alan R. Liss, New York, pp. 11-23. 2. German J (1983): Bloom's syndrome. X. The cancer proneness points to chromosome mutation as a crucial event in human neoplasia. In: German J (ed.)., Chromosome Mutation and Neoplasia. New York, Alan R. Liss, pp. 347-357. 3. Warren ST, Schultz RA, Chang C, Wada MH, Trosko JE (1981): Elevated spontaneous mutation rate in Bloom syndrome fibroblasts. Proc Natl Acad Sci USA 78:3133-3137. 4. Vijayalaxmi, Evans HJ, Ray JH, German J (1983): Bloom's syndrome: evidence for an increased mutation frequency in vivo. Science (Washington, D.C.) 221:851-853. 5. Chaganti RSK, Schonberg S, German J (1974): A manyfold increase in sister chromatic[ e~hanges in BloonYs syndrome lymphocytes. Proc Natl Acad Sci USA 71:4508-4512. 6. Shiraishi Y, Yosida TH, Sandberg AA (1983): Analyses ofbromodeaxyuridine-associated sister chromatid exchanges {SCEs) in Bloom syndrome based on cell fusion: Single and twin SCEs in endoreduplication. Proc Natl Acad Sci USA 80:4369-4373. Z Malkin D, Li FP, Strong LC, Fraumeni JF, Nelson CE, Kim DH, Kassei J, Gryka MA, Bischoff FZ, Tainsky MA, Friend SH {1990): Germ line p53 mutations in a familial syndrome of breast can-
10.
11.
12.
13.
14.
15.
16.
cer, sarcomas, and other neoplasms. Science ('Washington, D.C.) 250:1233-1238. Nigro JM, Baker SJ, Preisinger AC, Jassup JM, Hostetter R, Cleary K, Binger SH, Davidson N, Baylin S, Devilee P, Glover S, Collins FS, Weston A, Modali R, Harris CC, Vogelstein B (1989): Mutations in the p53 gene occur in diverse human tumor types. Nature (London) 342:705-708. Hollstein M, Sidransky D, Vogelstein B, Harris CC (1991): p53 mutations in human cancers. Science (Washington, D.C.) 253: 49-53. Shiraishi Y, Yosida TH, Sandberg AA (1985): Malignant transformation of Bloom syndrome B-lymphoblastoid cell lines by carcinogens. Proc Natl Acad Sci USA 82:5102-5106. Shiraishi Y (1985): Bloom syndrome B-lymphoblastoid cells are hypersensitive towards carcinogen and tumor promoter-induced chromosomal alterations and growth in agar. EMBO J 4:25532560. Shiraishi Y, Moriki T, Araki K, Kozuru M, Sandberg AA (1989): Malignant lymphoma antigen expressed in nude mice tumor cells originated from carcinogen-transformed Bloom syndrome B-lymphoblastoid cell lines. Cancer Res 50:3106-3112. Shiraishi Y (1990): Western blotting analysis for malignant lymphoma and stomach cancer antigens from carcinogen-transformed Bloom syndrome cells. Int J Cancer 45:783-787. Lyons J, Landis CA, Harsh G, Vallar L, Grnnewald K, Feichtinger H, Ouan-Yang D, Clark OH (1990): Two G protein oncogenes in human endocrine tumors. Science (Washington, D.C.) 249:655659. Yoshimoto K, lizuka M, Iwahana H, Yamasaki R, Saito H, Saito S, Sekiya T (1989): Loss of the same alleles of HRAS1 and DllS151 in two independent pancreatic cancers from a patient with multiple endocrine neoplasia type 1. Cancer Res 49:2716-2712. Buchman VL, Chumakov PM, Ninkina NN, Samarina PP, Geogre GP (1988): A variation in the structure of the protein-coding region of the human p53 gene. Gene Amst J 70:245-252.
To elucidate the molecular basis for malignant and premalignant states in Bloom syndrome (BS), p53 mutations were analyzed using Southern blot analysis and DNA sequencing of exons 5-9. p53 point mutations with and without loss of heterozygosity on 17p were detected in malignantly transformed BS cell lines carrying malignant lymphoma (ML) and stomach cancer (STC) antigens on the cell surface. However, p53 mutations were not detected in flesh lymphocytes and B-lymphoblastoid cell lines from four BS patients carrying high sister chromatid exchange (SCE) levels, using Southern blot and DNA sequencing of exons 5-9. Based on these results, we concluded that the p53 gene may not play a key role in the high spontaneous mutation rates (I-IGPRT locus) in somatic cells of BS patients and that the p53 mutation with an allelic loss of the p53 gene is an important factor in malignant conditions in BS. ABSTRACT:
INTRODUCTION Bloom syndrome (BS) is an autosomal recessive disease that is characterized clinically by growth retardation, immunodeficiency, solar sensitivity (especially of the facial skin), and predisposition to the development of cancer [1, 2]. Somatic cells (skin fibroblasts) from BS patients have been known to have a five- to tenfold increase in their spontaneous mutation rates at the hypoxanthine/guanine phosphoribosyltransferase (HGPRT) locus over that in normal skin fibroblasts [3, 4]. Because BS cells have elevated chromosome breakage and sister chromatid exchange (SCE) [5, 6], it is conceivable that the mechanism enhancing either deletions or unequal exchanges in the region distal to Xq26, where HGPRT maps, is responsible for the mutator activity. Patients with Bloom syndrome have an extremely high incidence of malignancy; therefore, a correlation with a high spontaneous mutation rate and somatic mutational theory of cancer should be readily apparent. Clinically, it has been considered as a pre-malignant condition. Recently, it has been shown that the p53 gene is a tumor suppressor gene and that its mutations play an important role in the development of many common human malignancies. The mutations are generally thought to be somatic, although in many cases this has not been directly demonstrated. In contrast, inherited p53 gene mutations have recently been reported in patients with the
From the Laboratory of Tumor Cell Biology, Department of Anatomy, Kochi Medical School, Nankoku-City 783, Kochi, Japan. Address reprint requests to: Dr. Yukimasa Shiraishi, Laboratory of Tumor Cell Biology, Department of Anatomy, Koch/ Medical School, Nankoku-City 783, Kochi, Japan. Received December 16, 1992; accepted April 7, 1993. 70 Cancer Genet Cytogenet68:70-73 (1993) 0165-4608/93/$06.00
Li-Franmeni syndrome [7-9]. There, patients have strong family histories of several tumor types, particularly leukemias, sarcomas, brain tumors, and breast cancers. The mode of inheritance appears to be autosomal dominant and more than 50% of the affected patients develop cancers before the age of 50. These studies prompted us to examine p53 mutation patterns in fresh somatic cells (lymphocytes), B-lymphoblastoid cell lines, and malignantly transformed cell lines from Bloom syndrome patients. In the present study, we analyzed the p53 mutation pattern by Southern blot restriction analysis and by DNA sequencing of exons 5, 6, 7, 8, and 9. Results, reported below, show that such mutations are rare in fresh lymphocytes and non-transformed B-lymphoblastoid cell lines from four BS patients, although point mutations were noted in the malignantly transformed BS cell line. MATERIALS AND METHODS
DNA was collected from fresh blood lymphocytes from four BS patients, from the father and mother of one BS patient, from five BS B-lymphoblastoid cell lines (Types I, II, and III cell lines) BSI_I, BS1_2, BS2_2, BS-SY3, and BS-SY4), and from two malignantly transformed BS cell lines (BS-SHI-4M ML and BS-SHI-4M STC) carrying malignant lymphoma (ML) and stomach cancer (STC) antigens [10-13]. A normal B-lymphoblastoid cell line was used as control. High molecular weight DNA was extracted by the sodium dodecyl sulfateproteinase K-phenol-chloroform method and precipitated in cold ethanol [14, 15]. Five micrograms of DNA was digested with appropriate restriction enzymes (EcoRI, BglII, and PvuII), size-fractionated by electrophoresis in 0.7%-1% agarose gel, and blotted on nitrocellulose membrane filters. Filters were subsequently
© 1993 Elsevier SciencePublishing Co., Inc.
655 Avenueof the Americas, New York, NY 10010
p53 Mutations in Bloom Syndrome Cells
71
Table 1 Oligonucleotide primers (5'-3') Exon
Upstream
Downstream
TTCCTCTTCCTGCAGTACTC CACTGATTGCTCTTAGGTCT GTGTTATCTCCTAGGTTGGC CCTATCCTGAGTAGTGGTAA TTGCCTCTTTCCTAGCACTG
CAGCTGCTCACCATCGCTAT AGTTGCAAACCAGACCTCAG CAAGTGGCTCCTGACCTGGA TCCTGCTTGCTTACCTCGCT CCCAAGACTTCGTACCTGAA
hybridized with 32p-labeled p53 gene cDNA probes (exons 5-10} {2-4 x 107 cpm/filter), washed at high stringency, and autoradiographed with intensifying screens.
PCR Amplification and Sequencing Oligonucleotide primers were synthesized by the phosphoramidite method using a 392 DNA synthesizer (Applied Biosystems, Inc., Foster City, CA). A set of PCR primers, flanking each of exons 5, 6, 7, 8, or 9, were used to generate a single specific amplification product from each sample [16]. The nucleotide sequences of the primers are summarized in Table 1. Polymerase chain reaction (PCR) was performed with the use of a thermal cycler (Astek, Fukuoka, Japan) with 100 ng of genomic DNA in a total volume of 100 I~1 containing 100 pmol of each oligonucleotide primer, 1.25 mM dNRP, and 2.5 units Taq polymerase in PCR buffer (Perkin-ElmerCetus) for 30 cycles in a programmable heat block. Each cycle included denaturation at 95°C for I minute, annealing at 55°C for 1.5 minute, and primer extension at 72°C for 2 minutes. After amplification, 70 ~tl of PCR reactions were fractionated in 2 % NuSieve GTG agarose gel electrophoresis. The amplified fragments were cut out and extracted by a Qiagen gel extraction kit (Qiagen, Inc., Chatsworth, CA). An aliquot (1-3 M) of the supernatant was then used as a DNA template in the PCR reaction. For direct sequencing, the primers were the same as those used in the original amplification, except that the 5' end of one primer contained M13, and the other contained the M13 reverse sequence. The double-stranded PCR product resulting from this amplification was purified by two centrifugal washes by using a SUPREC-2 microconcentrator (Takam Biomedicals, Kyoto, Japan). DNA sequences of the PCR products were determined by fluorescence-based dideoxy sequencing, using Taq polymerase in a thermal cycler, and fluorescently labeled M13 universal or reverse-sequencing primers. Followed by gel electrophoresis, data collection, and analysis on an Applied Biosystems Model 373A automated sequencer (Applied Biosystems, Inc.]. RESULTS Southern blot analysis revealed a normal migration pattern in all of the fresh lymphocytes from four BS patients and from the father and mother of a BS patient, as well as in all of the five BS B-lymphoblastoid cell lines (BS types I, II, and III) [10, 11]. As shown in Table 2, lymphocytes from three BS cases exhibited high SCE in 100% of the cells of PHAstimulated cultures and lymphocytes from one BS case (case 4} showed dimorphism of SCE levels (high-SCE cells, 85%;
low-SCE cells, 15%). There were no differences of p53 Southern blot patterns in BS types I, II, and III cell lines, p53 mutations in exons 5-9 (DNA sequencing) were not observed in all of the flesh lymphocytes from four BS cases, two BS heterozygotes, and all of BS types I, II, and III cell lines (Table 2). Two samples from malignantly transformed BS cell lines included in this study were informative for at least one marker on the short arm of chromosome 17. One of the BS malignantly transformed cell lines (malignant lymphoma antigen clone) showed loss of heterozygosity on 17p (Fig. 1, lane E). p53 mutations were identified at two different sites (codons 451 and 462) in BS-SHI-4M ML cells. Codon 451 (Fig. 2, examples 3 and 4) of CGC for Gly was mutated to TTG for Leu by a G to T transition; codon 462 (Fig. 2, examples 1 and 2) of A ~ for Met to ATT for Ile (Table 2). In the stomach cancer antigen clone BS-SHI-4M ST, codon 541 of CGC for Cys was mutated to CAC for Tyr by a G to A transition of the second letter (Fig. 2, examples 5 and 6), though loss of heterozygosity on 17p was not detected (Fig. 1F). Exons 6-9, also sequenced in these two BS-derived cancer antigen clones, had normal migration patterns; all exons proved to be of the wild type. DISCUSSION By using Southern blot analysis and DNA sequencing of Exons 5-9, we have detected p53 point mutations with and without loss of heterozygosity on 17p in malignantly transformed BS cell lines carrying ML and SIC antigens. However, p53 mutations were not detected in fresh lymphocytes and B-lymphoblastoid cell lines (BS types I, II, and III) from BS patients, using Southern blot and DNA sequencing of exons 5-9. Because BS has been known to dispose to malignancies at an early age and with high spontaneous mutation rates at the HGPRT locus, the association with p53 mutations was of special interest, especially in connection with genetic alterations on 17p. There seemed no correlation between high SCE levels and p53 mutation. From the viewpoint that patients with BS have a high incidence of various malignancies, high spontaneous mutations (HGPRT locus) in somatic cells, chromosome breakages and high SCE levels in somatic cells, the finding that no mutation was noted in the p53 gene in non-malignant BS cells might suggest the possibility of involvement of another mutation due to different cancer-suppressor genes. Because the p53 gene is located on 17p, the present study mainly examined the mutation of the cancer-suppressor gene mainly on 17p. Therefore, considering the high predisposition to var-
72
Y. S h i r a i s h i
Table 2
C h a r a c t e r i s t i c s o f B l o o m s y n d r o m e (BS) s o m a t i c c e l l s , B - l y m p h o b l a s t o i d their malignantly transformed cells, and p53 mutation pattern SCE level
Cell origin
M e a n ± S.E.
Fresh lymphocytes BS1 BS2 BS3 BS4 HBS1 HBS2 B - l y m p h o b l a s t o i d cell lines T y p e I BSI_, T y p e II BS-SY3 BS-SY4 T y p e III BS1-2
BS2-2 M a l i g n a n t l y t r a n s f o r m e d cell lines BS-SHI-4M ML
BS-SHI-4M STC
LOH 17p
1
2 3
1
Codon
Mutation nncleotide change
A m i n o acid change
72.4 71.8 76.6 70.4 5.4 4.9 5.1
± + ± + ± + ±
2.94 3.01 3.43 2.67 0.04 0.03 0.04
n n n n
Ex Ex Ex Ex
5-9 5-9 5-9 5-9
-
Wild Wild Wild Wild
type type type type
-
n n
Ex 5 - 7 Ex 5 - 7
-
Wild type Wild type
-
5.2 70.8 72.4 70.6 71.4
± + + ± +
0.05 2.89 2.78 2.91 3.01
n n n n n
Ex Ex Ex Ex Ex
5-9 5-9 5-9 5-9 5-9
--
Wild Wild Wild Wild Wild
-
60.6 + 3.12
LOH
71.5 + 2.65
n
Ex Ex Ex Ex Ex
5 5 6-9 5 6-9
451 462 -541 --
ious malignancies in BS, mutations of cancer-suppressor genes, except for p53, should be examined in BS. However, the present findings that L O H and point mutations were noted in the malignantly transformed BS clone carrying M L antigens clearly support other reports on p53 gene mutations. In summary, our study has shown the following: (a) the incidence of p53 mutations in BS cells is low. This was true
Kb
Exon
cell lines and
2 3
1 2 3
type type type type type
GGG~TTG ATG-~ATT W i l d type CGC~CAC Wild type
Gly-*Leu Met-'Ile Cys--Tyr
for fresh lymphocytes from four BS patients, a father and mother of a BS patient, and five BS B-lymphoblastoid cell l i n e s (BS t y p e s I, II, a n d m ) ; 0a) t h e p 5 3 p o i n t m u t a t i o n s w i t h and without LOH of p53 gene may be an important factor i n m a l i g n a n t t r a n s f o r m a t i o n , d u e to its p r e s e n c e i n t w o o f t w o B S - d e r i v e d m a l i g n a n t c l o n e s c a r r y i n g STC a n d M L a n t i g e n s . To f u r t h e r e x p l o r e t h e m o l e c u l a r b a s i s f o r B S m a l i g -
1
2
3
1
2
3
1
2
3
23.1 O
D
9.4
i
i
6.6-
i11
4.4-
t AI
LB
ILc-J
L-D
I L-E-J
LF-J
Figure 1 Southern blotanalysisof p53 gene in BS B-lymphoblastoid celllines {A, BSI_I;B, BS2_2; C, BS-SY3), BS fresh lymphocytes (D), BS-SHI-4M M L {E),and BS-SHI-4M STC {F) cells.Five micrograms D N A was digestedwith restrictionendonuclease {lane 1, EcoRI; lane 2, BgIII;lane 3, PvuII),electrophoresedin 0.7%-1% agarose gel and blotted on nitrocellulosefilters.Filterswere hybridized with a2p-labeledp53 gene cDNA {exon 5-10) probes. Loss of heterozygosityon 17p is noted in BgUI-treatedBS-SHI-4M M L D N A {E, lane 2). No specialrearrangements were detected from other samples (A, B, C, D, and F}.
p53 Mutations in Bloom Syndrome Cells
73
5' ;G.,~IGC1
3"
5'
3'
'
G AGA,~,
f
2
G~.CGC
."..". OGO
4~CGa~3.
G--OO.~". C
~C~,CC~ G,~OC,~C
V
It,/l I i!,lll Figure 2 Nucleotide sequence analysis of p53 genomic DNA. DNA fragments that showed a mobility shift on DNA from BS-SHI-4M ML and BS-SHI-4M STC ceils were PCR amplified and sequenced. The normal sequence of codons 451 (3), 462 (1), and 541 (5) are shown at the top, bottom panels show the G to T transversions at codons 451 (4) and 462 (2) and the G to A transversion at codon 541 (6). Mutated bases are indicated by arrows. n a n t t r a n s f o r m a t i o n i n the r e m a i n i n g m a j o r i t y w i t h o u t p53 m u t a t i o n s , o t h e r o n c o g e n e s or t u m o r - s u p p r e s s o r g e n e m u tations m u s t be systematically s t u d i e d .
8.
The author is grateful to Michiyo Ozawa for her technical assistance and photographic services. This work was supported in part by a special grant from the Kochi Medical School.
9.
REFERENCES 1. Pasarge E (1983): Bloom syndrome. In: German J (ed.)., Chromosome Mutation and Neoplasia. Alan R. Liss, New York, pp. 11-23. 2. German J (1983): Bloom's syndrome. X. The cancer proneness points to chromosome mutation as a crucial event in human neoplasia. In: German J (ed.)., Chromosome Mutation and Neoplasia. New York, Alan R. Liss, pp. 347-357. 3. Warren ST, Schultz RA, Chang C, Wada MH, Trosko JE (1981): Elevated spontaneous mutation rate in Bloom syndrome fibroblasts. Proc Natl Acad Sci USA 78:3133-3137. 4. Vijayalaxmi, Evans HJ, Ray JH, German J (1983): Bloom's syndrome: evidence for an increased mutation frequency in vivo. Science (Washington, D.C.) 221:851-853. 5. Chaganti RSK, Schonberg S, German J (1974): A manyfold increase in sister chromatic[ e~hanges in BloonYs syndrome lymphocytes. Proc Natl Acad Sci USA 71:4508-4512. 6. Shiraishi Y, Yosida TH, Sandberg AA (1983): Analyses ofbromodeaxyuridine-associated sister chromatid exchanges {SCEs) in Bloom syndrome based on cell fusion: Single and twin SCEs in endoreduplication. Proc Natl Acad Sci USA 80:4369-4373. Z Malkin D, Li FP, Strong LC, Fraumeni JF, Nelson CE, Kim DH, Kassei J, Gryka MA, Bischoff FZ, Tainsky MA, Friend SH {1990): Germ line p53 mutations in a familial syndrome of breast can-
10.
11.
12.
13.
14.
15.
16.
cer, sarcomas, and other neoplasms. Science ('Washington, D.C.) 250:1233-1238. Nigro JM, Baker SJ, Preisinger AC, Jassup JM, Hostetter R, Cleary K, Binger SH, Davidson N, Baylin S, Devilee P, Glover S, Collins FS, Weston A, Modali R, Harris CC, Vogelstein B (1989): Mutations in the p53 gene occur in diverse human tumor types. Nature (London) 342:705-708. Hollstein M, Sidransky D, Vogelstein B, Harris CC (1991): p53 mutations in human cancers. Science (Washington, D.C.) 253: 49-53. Shiraishi Y, Yosida TH, Sandberg AA (1985): Malignant transformation of Bloom syndrome B-lymphoblastoid cell lines by carcinogens. Proc Natl Acad Sci USA 82:5102-5106. Shiraishi Y (1985): Bloom syndrome B-lymphoblastoid cells are hypersensitive towards carcinogen and tumor promoter-induced chromosomal alterations and growth in agar. EMBO J 4:25532560. Shiraishi Y, Moriki T, Araki K, Kozuru M, Sandberg AA (1989): Malignant lymphoma antigen expressed in nude mice tumor cells originated from carcinogen-transformed Bloom syndrome B-lymphoblastoid cell lines. Cancer Res 50:3106-3112. Shiraishi Y (1990): Western blotting analysis for malignant lymphoma and stomach cancer antigens from carcinogen-transformed Bloom syndrome cells. Int J Cancer 45:783-787. Lyons J, Landis CA, Harsh G, Vallar L, Grnnewald K, Feichtinger H, Ouan-Yang D, Clark OH (1990): Two G protein oncogenes in human endocrine tumors. Science (Washington, D.C.) 249:655659. Yoshimoto K, lizuka M, Iwahana H, Yamasaki R, Saito H, Saito S, Sekiya T (1989): Loss of the same alleles of HRAS1 and DllS151 in two independent pancreatic cancers from a patient with multiple endocrine neoplasia type 1. Cancer Res 49:2716-2712. Buchman VL, Chumakov PM, Ninkina NN, Samarina PP, Geogre GP (1988): A variation in the structure of the protein-coding region of the human p53 gene. Gene Amst J 70:245-252.