- Email: [email protected]
p53 regulates katanin-p60 promoter in HCT 116 cells
Journal Pre-proofs Research paper p53 Regulates Katanin-p60 Promoter in HCT 116 Cells Koray Kırımtay, Ece Selçuk, Dolunay Kelle, Batu Erman, Arzu Karabay PII: DOI: Reference:
S0378-1119(19)30900-X https://doi.org/10.1016/j.gene.2019.144241 GENE 144241
To appear in:
Gene Gene
Received Date: Revised Date: Accepted Date:
10 April 2019 25 October 2019 28 October 2019
Please cite this article as: K. Kırımtay, E. Selçuk, D. Kelle, B. Erman, A. Karabay, p53 Regulates Katanin-p60 Promoter in HCT 116 Cells, Gene Gene (2019), doi: https://doi.org/10.1016/j.gene.2019.144241
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Elsevier B.V. All rights reserved.
p53 Regulates Katanin-p60 Promoter in HCT 116 Cells Koray Kırımtay1#, Ece Selçuk1,2#, Dolunay Kelle1, Batu Erman3, Arzu Karabay1* 1Department
of Molecular Biology and Genetics, Istanbul Technical University, Istanbul, Turkey
2Department of Molecular Biology and Genetics, Istanbul Medeniyet University, Istanbul, Turkey 3 Department
of Molecular Biology and Genetics, Sabancı University, Istanbul, Turkey
# Equal contribution *Corresponding author E-mail: [email protected] (AK) Phone: 90 212 285 7257
p53 Regulates Katanin-p60 Promoter in HCT 116 Cells Koray Kırımtay1#, Ece Selçuk1,2#, Dolunay Kelle1, Batu Erman3, Arzu Karabay1* 1Department
of Molecular Biology and Genetics, Istanbul Technical University, Istanbul, Turkey
2Department of Molecular Biology and Genetics, Istanbul Medeniyet University, Istanbul, Turkey 3 Department
of Molecular Biology and Genetics, Sabancı University, Istanbul, Turkey # Equal contribution *Corresponding author E-mail: [email protected] (AK) Phone: 90 212 285 7257
Abstract Tumor suppressor protein p53, which functions in the cell cycle, apoptosis and neuronal differentiation via transcriptional regulations of target genes or interactions with several proteins, has been associated with neurite outgrowth through microtubule re-organization. We previously demonstrated in neurons that upon p53 induction, the level of microtubule severing protein Katanin-p60 increases, indicating that p53 might be a transcriptional regulator of the KATNA1 gene encoding Katanin-p60. In this context, we firstly elucidated the activity of KATNA1 regulatory regions and endogenous KATNA1 mRNA levels in the presence or absence of p53 using
HCT 116 WT and HCT 116 p53 (-/-) cells. Next, we demonstrated the binding of p53 to the KATNA1 promoter and then investigated the role of p53 on KATNA1 gene expression by ascertaining KATNA1 mRNA and Katanin-p60 protein levels upon p53 overexpression and activation in both cells. Moreover, we showed changes in microtubule network upon increased Katanin-p60 level due to p53 overexpression. Also, the changes in KATNA1 mRNA and Kataninp60 protein levels upon p53 knockdown were investigated. Our results indicate that p53 is an activator of KATNA1 gene expression and we show that both p53 and Katanin-p60 expression have strict regulations and are maintained in balanced levels as they are vital proteins to orchestrate either survival and apoptosis or differentiation. Keywords: p53, Katanin, microtubule, transcriptional regulation, gene expression Abbreviations: AAA, ATPases Associated with various cellular Activities; RE, Response element; PKC-, Protein kinase C-alpha; EMSA, Electrophoretic mobility shift assay; Mut, Mutated; MAPs, microtubule-associated proteins.
1. Introduction Katanin, which is a well-characterized microtubule severing protein, is a heterodimer consisting of p60 and p80 subunits encoded by the KATNA1 and KATNB1 genes respectively. Katanin-p60 is an ATPase that conducts severing reaction while Katanin-p80 localizes Katanin-p60 to the centrosome and regulates its microtubule severing activity [1, 2]. Katanin-p60 has an N-terminal microtubule binding domain and a C-terminal AAA (ATPases Associated with various cellular Activities) domain [1, 3]. Katanin-p60 has essential roles in various cellular activities including cell division, intracellular motility, cytoskeletal regulation as well as neuronal branching [2, 4]. Microtubule severing plays a role in regulating poleward flux of tubulin in the metaphase spindle during cell division and releasing of centrosome-nucleated microtubules [5, 6, 7]. In nonproliferative cells like neurons, there are also non-centrosomal microtubules formed by microtubule severing and this severing mechanism is crucial for neuronal branching and axonal growth [2-8]. The levels of Katanin-p60 are regulated in different stages of neuronal development. In early embryonic stage, Katanin-p60 level is high to form neuronal network [9]; when the axons reach to target cells, their growing stops, and Katanin-p60 level decreases [10].
p53 protein is a tumor suppressor protein that functions as a transcription factor regulating gene expressions by either activating or repressing target genes having roles in cell cycle, apoptosis, angiogenesis, and neuronal differentiation [11-14]. For the regulation of these genes, p53 binds to a consensus response element (RE) on DNA identified as RRRCWWGYYY (R: Purine; C: Cytosine; W: Adenine or Thymine; G: Guanine; Y: Pyrimidine) [15, 16]. For p53 activation, it has to recognize two REs interrupted by a 0-13 bp spacer and bind as tetramers [17]. The CWWG motif is crucial for high binding affinity of p53 to the DNA. Neighboring bases of the motif and spacer length have also found to be important in the transcriptional activity of p53 as well [18-20]. The long spacer length between REs has been specifically associated with transcriptional repression by p53 [14]. In neuroblastoma cells, p53 has a role in differentiation by affecting process lengths and increasing expression of neuronal markers [21, 22]. Besides, we previously reported that the activation of Protein Kinase C-alpha (PKC-), which is an up-regulator of cell cycle protein cyclinD1, results in alteration of neuronal morphology by increasing neuronal processes and the levels of Kataninp60 and p53 proteins [23]. Since both p53 and Katanin-p60 have similar functions on neuronal differentiation and upon PKC activation, their protein levels are simultaneously upregulated causing an increase in neuronal process numbers; we hypothesized that p53 might be a transcriptional regulator of the KATNA1 gene. Therefore, we examined mRNA and protein levels of KATNA1 gene expression in HCT 116 WT and HCT 116 p53 (-/-) double knockout human colorectal carcinoma cells. Our data show that p53 upregulates KATNA1 in both transcript and protein levels; and both p53 and Katanin-p60 gene expressions are tightly regulated.
2. Materials and Methods 2.1.
Constructs
The fragments containing putative regulatory elements of either “promoter” (-442 to +1), or “5’ UTR” (+1 to +336) or “promoter + 5’ UTR” (-442 to +336) of KATNA1 gene, which were previously cloned into a pGL3-basic vector [24], were used to conduct luciferase reporter assays. pcDNA3 flag p53 was a gift from Thomas Roberts (Addgene plasmid # 10838) [25]. pMKO.1 puro p53 shRNA 1 (Addgene plasmid # 10671) was used for transient knockdown of p53.
2.2.
Cell Culture
HCT 116 WT and HCT 116 p53 (-/-) (p53 double knock-out) colorectal carcinoma, cells were kind gifts from Dr. Matthias Dobblestein of the Georg-August-Universität Göttingen. HCT 116 WT and HCT 116 p53 (-/-) cells were maintained in medium containing DMEM (4,5 g/L glucose), 10% FBS and 1% Penicillin/Streptomycin solution at a final concentration of 100 U/mL and 100 µg/ml, respectively. The cells were cultivated in a 5% CO2 incubator at 37°C.
2.3.
Luciferase Assay
HCT 116 WT and HCT 116 p53 (-/-) cells were seeded at 4x104 cells/well onto 24-well dishes. Both cell types were transfected using TransfastTM Transfection Reagent (Promega, E2431) at 1:2.5 ratio of total DNA to Transfast reagent. Total of 1630 ng DNA (1600 ng pGL3 vectors and 30 ng pRL-TK Renilla control vector (Promega, E2241)) and transfection reagent were mixed in serum-free DMEM and incubated for 15 min at room temperature. After 15 min, growth medium of the cells was removed and the mixture was added onto the cells and incubated for 1 h in a 5% CO2 incubator at 37°C. Then, fresh growth medium was added and cells were cultivated for an additional 24 h. Dual-Luciferase Reporter Assay System (Promega, E1910) and Fluoroskan Ascent FL Luminometer (Thermo Electron Co., Hudson, USA) were used to measure Firefly and Renilla activities. 24 h post-transfection, growth medium was removed and the cells were lysed with 60 µL 1X Passive Lysis Buffer incubating on an orbital shaker at 40 rpm and room temperature for 15 min. The cell lysate was collected and mixed with Luciferase Assay Reagent II (LAR II) for the induction of luminescent signal in a luminometric plate. After measurement of firefly activity, Stop&Glo Buffer containing Stop&Glo Reagent was immediately added into the same well to quench the reaction and measure Renilla activity. Luminometer device had been adjusted to delay 2 sec pre-measurement and to shake the plate followed by a 10 sec period at 600 PTM for the measurement of each sample. The promoter activity was analyzed by normalizing firefly to Renilla luciferase activity. All experiments were performed as triplicates and were repeated 3 times on separate days for both HCT 116 WT and HCT 116 p53 (-/-) cells to obtain statistically meaningful data. In order to determine fold activity, Firefly luciferase in each pGL3 vector was normalized to Renilla luciferase; then, pGL3 vectors containing regulatory regions were normalized to empty pGL3-basic vector.
2.4.
Electrophoretic Mobility Shift Assay (EMSA)
The binding sites of p53 on KATNA1 were searched by using TFBIND tool (http://tfbind.hgc.jp) and a binding site was detected on the promoter with 85% possibility, which is located from -116 to
-94.
The
oligonucleotide
probes
containing
binding
site
(p53_WT-probe:
5'-
GAGGGAAAGTGAGCAAGCACCTGAACAAGGTACAGAGGCGCG -3'; p53_Mut-probe: 5'-GAGGGAAAGTGAGTGGACACCTGAATGGAGTACAGAGGCGCG-3') were designed and labeled separately by using Biotin 3’ End DNA Labeling Kit (Thermo Scientific, Pierce). Labeled forward and reverse oligonucleotides were then annealed at a ratio of 1:1 in 10 mM Tris, 1 mM EDTA by heating to 95°C for 5 min, slow cooling by 2°C/min to their annealing temperature, annealing for 30 min and cooling to 4°C by 2°C/min. For binding reactions, LightShift™ Chemiluminescent EMSA Kit (Thermo Scientific, 20148) was used. Whole extracts of p53 overexpressing cell lysate (2 µg per sample) were incubated with 20 fmol biotinylated oligonucleotides in binding buffer (pH 7.5), including 10 mM Tris, 50 mM KCl, 1 mM dithiothreitol (DTT), 1 mg Poly (dI·dC), 5% glycerol, 1 mM EDTA, 0.3% bovine serum albumin (BSA) and 1X Protease Inhibitor Cocktail for 20 min at room temperature. 1000-fold molar excess of unlabeled WT competitor oligonucleotide was also used in binding of competition reaction. Complexes and free DNAs were resolved on a 5–8% non-denaturating polyacrylamide gel in 0.5X TBE by electrophoresis for 1 h at 120V at 4°C. The gel was then transferred to Biodyne A Nylon Membranes (Thermo Scientific, Pierce) by using Trans-Blot SD (Bio-Rad) at 20V for 30 min at 4°C. Crosslink transfer of DNA to membrane was achieved by incubating the membrane with 254 nm UV bulbs for 12 min in order to detect biotin-labeled DNA in which Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific, Pierce 89880) was used. The membrane was exposed to X-ray film for 2 min and then was analyzed by using Kodak Medical X-ray Processor according to the manufacturer’s instruction.
2.5.
Chromatin immunoprecipitation assay (ChIP)
ChIP assay was performed by using SimpleChIP® Enzymatic Chromatin IP Kit (Magnetic Beads) (Cell Signaling Technology). Formaldehyde (37%) was added to 3x107 of HCT 116 WT cells at the final concentration of 1% in order to crosslink proteins to DNA. Micrococcal nuclease (5 µl per sample) was used for chromatin digestion followed by sonication in order to break the nuclear membrane. Sonicator was programmed to perform 3 sets of 20 sec pulses at 30 W and 30 sec rest periods on ice. For immunoprecipitation reactions, each 10 µg digested chromatin was incubated
with 10 µl positive control Histone H3, 1 µl negative control Normal Rabbit IgG, 2.5 µl (1:200 dilution) p53 antibody (Cell Signaling Technology) overnight at 4°C. 30 µl ChIP-Grade Protein G Magnetic Beads was mixed with IP reactions and incubated for 2 h at 4°C. Protein G Magnetic Beads were washed three times in order to remove unbounded proteins and DNA fragments. Crosslinked protein/DNA complexes were eluted and DNA fragments were purified by using SimpleChIP® Enzymatic Chromatin IP Kit. iProof™ High-Fidelity PCR Kit (Bio-Rad) was used for PCR amplification. PCR products which had been amplified by specific primers (forward 5’CGAATTGCTTGATCCTGGACATTC -3′; reverse 5- CAGCGGAGACCAGGGATAGTA -3′) were analyzed on agarose gel and the gel was visualized using ChemiDoc™ Imaging System (BioRad).
2.6.
Hypoxia treatment
Before hypoxia treatment, 6x105 of HCT 116 WT and HCT 116 p53 (-/-) cells were incubated for 24 h. To induce p53 activation, 25 mM stock solution of CoCl2 was prepared and cells were treated with serial CoCl2 concentrations (100, 200 and 400 M) diluted in culture medium. Untreated cells were used as control. After 24 h of CoCl2 treatment, whole cell extracts were isolated using 1% NP40 solution including 150 mM NaCl, and 50 mM Tris-HCl (pH 8.0).
2.7.
Transient transfection and protein isolation
For p53 overexpression, 6x105 of HCT 116 WT and HCT 116 p53 (-/-) cells were transfected with 5 µg of either p53 or mock vector by using TransfastTM Transfection Reagent (Promega, E2431). At 24 h post-transfection, whole cell extract was isolated using Mammalian Cell Extraction Kit (BioVision). For p53 knockdown, 6x105 of HCT 116 WT and HCT 116 p53 (-/-) cells were transfected with 5 µg of either p53 shRNA or mock vector by using TransfastTM Transfection Reagent (Promega, E2431). At 24 h post-transfection, whole cell extract was isolated using 1% NP40 solution including 150 mM NaCl, and 50 mM Tris-HCl (pH 8.0).
2.8.
Total RNA extraction, cDNA Synthesis and Quantitative Real Time PCR
MN NucleoSpin RNA Kit (Macherey-Nagel) was used for total RNA isolation from either transiently transfected cells to analyze the changes in KATNA1 and TP53 mRNA levels or untransfected cells to investigate endogenous KATNA1 mRNA level. 1 µg total RNA was reverse
transcribed by using Oligo dT primers and ProtoScript® II First Strand cDNA Synthesis Kit (New England BioLabs). Human Katanin-p60 and p53 probe and primers (Table 1) were purchased from Universal Probe Library (Roche Applied Science) and Alpha DNA, respectively. ACTB (Roche Universal Probe Library Human ACTB Gene Assay) or GAPDH (Roche Universal Probe Library Human GAPD Gene Assay) gene was used as housekeeping controls for relative expression analysis. Quantitative Real Time – PCR (qRT-PCR) reactions were performed with Light Cycler® 480 Probes Master qRT-PCR Kit using a Roche Light Cycler 480 device according to the following program: pre-incubation at 95°C for 10 min for 1 cycle, amplification at 95°C for 10 sec, 60°C for 30 sec, 72°C for 1 sec for 45 cycles, and cooling at 40°C for 30 sec for 1 cycle. ΔΔCT method was used to analyze qRT-PCR data. In order to calculate the expression rate based on fold change (relative quantification), following equation is used; 2- ΔΔCT= [(CT control) treated sample
2.9.
gene of interest
- CT
internal
- (CT gene of interest - CT internal control) control sample)] [26].
Western Blot
Total protein extract was loaded into polyacrylamide gel (30 µg protein/lane) and run by SDSPAGE system. Then, the proteins were transferred onto the nitrocellulose membrane by TransBlot Turbo Transfer System (Bio-Rad). The membrane was blocked in 5% skim milk powder dissolved in TBS-T (Tris-buffered saline and 0,1% Tween-20) for 1 h at room temperature by shaking. After the blocking, the membrane was incubated overnight at 4°C with primary antibodies (rabbit monoclonal anti-Katanin-p60 antibody (1:500, Abcam), rabbit polyclonal anti-FLAG antibody (1:500), and rabbit monoclonal anti-p53 antibody, rabbit monoclonal anti-ß-actin antibody, mouse monoclonal anti-GAPDH antibody and rabbit monoclonal anti-vinculin antibody (all in 1:1000) (Cell Signaling Technology)) were prepared in blocking solution. Following day, the membrane was washed 6 times for 5 min with TBS-T to eliminate unbound primary antibodies and then incubated with HRP conjugated secondary antibody (anti-rabbit (1:3000, Cell Signaling Technology)) for 1 h at room temperature and washed 6 times for 5 min. Finally, the membrane was visualized by using VisualizerTM Western Blot Detection Kit (EMD Millipore) and ChemiDocTM MP System (Bio-Rad). In order to determine the relative intensity of protein bands on the Western blot membrane, Adobe Photoshop CS5 Software was used. The intensity value of each protein band in the membrane was calculated by measuring the selected band area and pixel values. Obtained values were normalized to the values of ß-actin, GAPDH or vinculin which were used as loading control.
2.10. Immunocytochemistry HCT 116 p53 (-/-) cells seeded as 4x104 cells/well on 8-chamber slides (SPL Life Science, Korea) were transfected with 0.2 µg p53 expression vector using TransFastTM Transfection Reagent. After 24 h of transfection, cells were fixed with 4% paraformaldehyde for 15 min at room temperature. Then, cells were washed with 1X PBS (phosphate-buffered saline) 3 times for 5 min and blocked with blocking buffer (3% (w/v) Bovine serum albumin in PBS, 0.1% Triton X-100) for 1 h at the room temperature. Cells were treated with primary antibodies (rabbit monoclonal anti-p53 antibody 1:500 Cell Signaling Technology; mouse polyclonal anti-p60 katanin antibody 1:200 Abcam; chicken polyclonal anti--tubulin antibody 1:500 Abcam) overnight at 4°C. Next day, cells were washed with 1X PBS 3 times for 5 min to remove unbound primary antibodies, and then incubated with secondary antibodies (anti-rabbit Alexa Fluor® 488 Conjugate and anti-mouse Alexa Fluor® 594 Conjugate (Cell Signaling Technology) and anti-chicken Alexa Fluor® 647 Conjugate (Invitrogen Life Technologies) all in 1:500 dilution) prepared in blocking buffer for 1 h at room temperature. After incubation, cells were washed with 1X PBS 3 times for 5 min. ProLong™ Diamond Antifade Mounting Medium (Thermo Fisher Scientific, USA) was added onto slides and coverslips were placed onto samples. The imaging was performed by Leica TCS SP2 SE Confocal Microscope (Germany).
2.11. Statistical analysis Statistical analyses were performed using GraphPad Prism 7 Software. The results of luciferase reporter assay and qRT-PCR experiments investigating endogenous KATNA1 mRNA level, were analyzed using two-tailed unpaired student’s test. Further experiments were analyzed using onetailed unpaired student’s test. Error bars in the graphs were generated using ± SEM values. p<0.05 was considered as significant for all statistical analysis.
3. Results 3.1.
KATNA1 expression differs based on p53
In order to investigate if p53 may act as a transcriptional regulator of KATNA1, we first performed luciferase reporter assay in HCT 116 WT and HCT 116 p53 (-/-) cells to elucidate the regulation of KATNA1 transcription depending on presence or absence of p53. Luciferase reporter assay was
carried out with the constructs containing putative regulatory elements of “Promoter”, “5’ UTR” and “Promoter+5’ UTR” (Figure 1). The results indicated that the “5’ UTR” was the critical region for KATNA1 regulation in both HCT 116 WT and HCT 116 p53 (-/-) cells (Figure 2), correlating with our previous results with SH-SY5Y cells [24] and its activity was similar in both cells. However, only “Promoter” and “Promoter+5’ UTR” showed lower activity in HCT 116 p53 (-/-) cells compared to HCT 116 WT cells. The difference between 5’ UTR and Promoter + 5’ UTR activity was not significant in HCT 116 WT cells, whereas it was significant in HCT 116 p53 (-/) cells (Figure 2). Since luciferase reporter assay indicated that KATNA1 gene regulatory sequencemediated reporter gene expression increased in the presence of p53, we performed qRT-PCR in order to elucidate endogenous KATNA1 transcript levels in HCT 116 WT and HCT 116 p53 (-/-) cells. The results showed that the endogenous mRNA level of KATNA1 decreased in the absence of p53 protein in HCT 116 p53 (-/-) cells (Figure 3).
3.2.
Confirmation of p53 binding through ChIP assay and EMSA
We searched for the presence of p53 consensus sequence on the regulatory regions of KATNA1 gene using TFBIND tool, and determined a putative binding site of p53 between -116 to -94 nucleotides located on the promoter. In order to investigate the physical binding ability of p53 to this site on KATNA1, we performed EMSA and ChIP assays using total cell extract of HCT 116 WT cells. EMSA results revealed the presence of a shifted band indicating the complex formation of p53 and WT KATNA1 oligo (Figure 4, lane 2). No complex formation was detected in the reaction which contained mutated oligo (Mut-oligo) and the cell extract (lane 4). Binding specificity was supported by control reactions including either WT or Mut-oligo without cell extract (lane 1 and 3), and competition reaction (lane 5) in which unlabeled WT-oligo had excess amount than labeled WT-oligo, thereby no complex formation was observed. ChIP-PCR results showed the amplification of p53 binding site including DNA fragment in input and p53 precipitated reactions (Figure 5). H3 precipitation was used as a positive control, and amplified fragment was also detected in this reaction, while IgG and beads only were used as negative controls (), which did not allow amplification of p53, since it was not able to be precipitated in these reactions.
3.3.
p53 is a positive regulator of KATNA1 gene expression
We examined the role of p53 on KATNA1 gene expression by qRT-PCR and Western blot in order to detect Katanin-p60 mRNA and protein levels in p53 overexpressing cells. Both HCT 116 WT and HCT 116 p53 (-/-) cells were used for these experiments and separately transfected with p53 construct. Since HCT 116 p53 (-/-) cells do not have endogenous p53 expression, the results for these cells would directly indicate the effect of exogenously expressed p53. Overexpression levels of p53 in both cells were determined by normalization of p53 to their loading controls seen in Figure 6A. Also, the overexpression level in HCT 116 WT cells was accepted as a baseline in order to determine the fold change of p53 overexpression; thus, data were normalized to the overexpressed level of p53 in HCT 116 WT cells. Results showed that p53 overexpression was 8.35 fold increased in HCT 116 p53 (-/-) cells compared to HCT 116 WT cells (Figure 6B). Relative quantification analysis of qRT-PCR data revealed that KATNA1 mRNA level significantly increased in p53 overexpressing HCT 116 p53 (-/-) cells whereas the increase was not significant in p53 overexpressing HCT 116 WT cells (Figure 7). According to Western blot analysis, Katanin-p60 protein level increased 1.79 and 2.20 folds in p53 overexpressing HCT 116 WT and p53 overexpressing HCT 116 p53 (-/-) cells, respectively (Figure 8). Thus, these results have demonstrated that p53 has an activator role in KATNA1 gene expression.
3.4.
Increased Katanin-p60 protein level via p53 overexpression dysregulates microtubule network
We wanted to see if the increase in Katanin-p60 level due to p53 overexpression would cause any change in microtubule organization. We demonstrated an elevation in Katanin-p60 protein level in p53 overexpressing cells compared to untransfected cells by immunocytochemistry (Figure 9). Moreover, we observed diminution in microtubule length based on the severing activity of Katanin-p60, and disruption of microtubule network resulting in alteration of cell morphology in p53 overexpressing cells (Figure 9).
3.5.
Hypoxia causing p53 activation results in Katanin-p60 induction
To activate p53 through cellular stress, HCT 116 WT cells were treated with serial concentrations of CoCl2 to induce hypoxia. Untreated cells were used as control. HCT 116 p53 (-/-) cells were also treated with the same concentrations of CoCl2 in order to be used as a negative control. Results showed that p53 was gradually induced by the increasing CoCl2 concentrations in HCT 116 WT
cells and p53 expression was not detected in HCT 116 p53 (-/-) cells (Figure 10A and B). Kataninp60 protein level in HCT 116 WT cells was then detected by Western blot (Figure 11A). It was revealed that Katanin-p60 level was not changed in 100 and 200 M CoCl2 treated cells, and significantly increased in 400 M CoCl2 treated cells. CoCl2 treatment reduced Katanin-p60 expression in HCT 116 p53 (-/-) cells (Figure 11B).
3.6.
p53 knockdown leads to Katanin-p60 repression
In addition to activation and overexpression, p53 knockdown was performed to determine the change in Katanin-p60 level due to p53 inhibition. HCT 116 WT and HCT 116 p53 (-/-) cells used as control were transfected with p53 shRNA construct. In HCT 116 WT cells, the percentage of reduction in TP53 mRNA p53 protein were detected as 18% and 36%, respectively (Figure 12A and B). Upon p53 knockdown, KATNA1 mRNA level was reduced by 16% in HCT 116 WT cells (Figure 13A); however, it was not changed in HCT 116 p53 (-/-) cells (Figure 13B). Accordingly, Katanin-p60 protein was also decreased by 20% in HCT 116 WT cells (Figure 14A), but not changed in HCT 116 p53 (-/-) cells (Figure 14B).
Discussion We present here KATNA1 as a new transcriptional target of p53. Since both Katanin-p60 and p53 proteins are important for determining the cell fate, their regulation is highly critical for understanding the mechanism of either survival or differentiation. Here we show that p53 promotes Katanin-p60 expression and both proteins are tightly regulated in cells. In our previous study, we identified that up-regulation of PKC- shuttles it into the nucleus, causing shortened neuronal processes and increased process numbers in neurons by increasing p53 and Katanin-p60 expressions in hippocampal neurons [23]. Borgatti et al. [27] also showed that nuclear PKCs play a pivotal role in the induction and persistence of the differentiation of PC12 cells into neuronal phenotype. Based on these findings and the importance of p53 in neuronal differentiation, we considered that p53 might also be a transcriptional regulator of Katanin-p60. In order to determine whether the activity of KATNA1 regulatory regions differs depending on p53 existence, we first performed luciferase reporter assay in both HCT 116 WT and HCT 116 p53 (/-) cells which have been widely used cell lines to ascertain p53 effect. Consistent with our results
in SH-SY5Y cells [24], 5’ UTR had the highest regulatory activity in both HCT 116 cells, and also fold activation of 5’ UTR was almost the same in both HCT 116 cells. Fold activation of Promoter and Promoter + 5’ UTR, however, varied by the cell line (Figure 2) suggesting that p53 might have a role in KATNA1 transcription due to putative binding site on the promoter region located between -116 and -94 nucleotides (Figure 1). We investigated the endogenous KATNA1 transcript levels in both HCT 116 WT and HCT 116 p53 (-/-) cells and found out that KATNA1 mRNA level decreased by ~15% in the absence of p53 (Figure 3). Thus, we speculated that p53 might positively regulate KATNA1 gene expression. In order to ascertain if p53 directly affects KATNA1 expression, we first confirmed the binding of p53 to the bioinformatically identified site (Figure 1) on the KATNA1 promoter (Figure 4 and 5). Confirmation of the p53 binding validated our data in which endogenous mRNA level of KATNA1 and activities of Promoter and Promoter+5’UTR constructs showed significant increase due to the binding of p53 to the promoter region in HCT 116 WT cells. To reveal the regulatory effect of p53 on KATNA1 gene expression, p53 was overexpressed in both HCT 116 WT and HCT 116 p53 (-/-) cells. The overexpression level of p53 was lower in HCT 116 WT cells than HCT 116 p53 (-/-) cells (Figure 6). It has been known that p53 is a crucial transcription factor to operate cellular processes such as apoptosis, growth arrest, DNA repair [28], and its aberrant overexpression leads to cell death [29]; thus, its expression is maintained at a quite balanced level in cells [30]. We, therefore, argue that since WT cells have endogenous p53 protein, exogenous p53 could not be overexpressed in HCT 116 WT cells as much as in HCT 116 p53 (/-) cells (Figure 6) as the cells tend to maintain a certain level of p53 to keep the balance between cell survival and apoptosis. Upon p53 overexpression Katanin-p60 mRNA and protein levels increased (Figure 7,8 and 9) indicating that p53 promotes KATNA1 expression. However, the increase was not equal in HCT 116 WT and HCT 116 p53 (-/-) cells since endogenous Katanin-p60 mRNA and protein levels are already high in HCT 116 WT cells compared to HCT 116 p53 (-/-) cells. Thus, the increase in KATNA1 mRNA in HCT 116 p53 (-/-) cells was higher than the increase in HCT 116 WT cells (Figure 7). The reason why Katanin-p60 protein level was significantly increased in both cell types (Figure 8), might be related to the availability of KATNA1 mRNA for a longer period due to posttranscriptional regulatory mechanism.
Katanin-p60, like p53, is another key protein affecting cell survival depending on its expression level of which excessive amounts often result in cell death due to disrupting microtubule network [10, 31]. We previously reported that even about 20% increase in Katanin-p60 level is sufficient to regulate microtubule reorganization for the transition from interphase to mitosis [10]. Moreover, here we also showed that two fold increase in Katanin-p60 level due to p53 caused significant changes in microtubule organization resulting in dramatic alterations of cell morphology (Figure 9). In order to analyze Katanin-p60 level through p53 activation apart from p53 overexpression we treated HCT 116 WT and HCT 116 p53 (-/-) cells with CoCl2 to mimic hypoxia in which condition p53 is known to be activated (Figure 10). Upon CoCl2 treatment, Katanin-p60 level was increased in HCT 116 WT cells, (Figure 11A); while it was reduced in HCT 116 p53 (-/-) cells (Figure 11B). The decrease in p53 depleted cells suggests that Katanin-p60 may be downregulated by another transcription factor or pathway under hypoxia conditions, and that needs further investigation. In spite of other possible downregulatory factors present in both cells, increase in Katanin-p60 level due to existence of p53 indicates that p53 is a major positive regulatory factor on Katanin-p60 expression. We also analyzed Katanin-p60 mRNA and protein levels upon knockdown of p53 with shRNA in HCT 116 WT and HCT 116 p53 (-/-) cells. Inhibition of p53 was confirmed both in transcriptional and translational levels (Figure 12A and B) and repression of p53 caused decreases in both KATNA1 mRNA (Figure 13A) and Katanin-p60 protein (Figure 14A) levels in HCT 116 WT cells. On the other hand, treatment of HCT 116 p53 (-/-) cells with p53 shRNA did not affect KATNA1 mRNA (Figure 13B) and Katanin-p60 protein (Figure 14B) levels. The study by Galmarini et al. [32] indicated an increased ratio of polymerized tubulin to soluble tubulin in mutant p53 containing cells compared to wild-type p53 containing cells. Our results contribute to understanding the reason for this differential ratio of polymerized tubulin to soluble tubulin based on the function of p53 since p53 increases the level of Katanin-p60 allowing it to severe microtubules and depolymerize them; whereas in the presence of mutant p53, Katanin-p60 would not be increased, and thereby leading to inhibit microtubule severing and hence microtubules would remain intact, in the polymerized form of tubulin. In addition to this, another study performed with HCT 116 WT cells demonstrated that treatment of anti-cancer agent PMN results in upregulation of p53 and p53-mediated apoptosis, and disruption of microtubule
organization [33], allowing us to speculate that upregulation of p53 via PMN treatment may also result in an increase in the expression of Katanin-p60 which would lead to disruption of microtubule organization. Consequently, we conclude that p53 binds to response element located on KATNA1 promoter region and has an activator role on KATNA1 gene expression. Furthermore, this study has a great impact on emphasizing the tight regulation of p53 and Katanin-p60 from gene to protein level since they both achieve crucial roles in the cell.
Acknowledgement This study was funded by TUBİTAK [Project ID: 113Z462] to AK.
References 1. Hartman, J.J., Mahr, J., McNally, K., Okawa, K., Iwamatsu, A., Thomas, S., Cheesman, S., Heuser, J., Vale, R.D., McNally, F.J., 1998. Katanin, a microtubule-severing protein, is a novel AAA ATPase that targets to the centrosome using a WD40-containing subunit. Cell. 93, 277-87. https://doi.org/10.1016/S0092-8674(00)81578-0. 2. Quarmby, L., 2000. Cellular Samurai: Katanin and the severing of microtubules. J. Cell Sci. 113, 2821-7. 3. Hartman, J.J., Vale, R.D., 1999. Microtubule disassembly by ATPdependent oligomerization of the AAA enzyme Katanin. Science. 286, 782-785. https://doi.org/10.1126/science.286.5440.782. 4. Yu, W., Qiang, L., Solowska, J.M., Karabay, A., Korulu, S., Baas, P.W., 2008. The microtubule-severing proteins Spastin and Katanin participate differently in the formation of axonal branches. Mol. Biol. Cell. 19:1485-98. https://doi.org/10.1091/mbc.E07-090878. 5. McNally, F.J., Okawa, K., Iwamatsu, A., Vale, R.D., 1996. Katanin, the microtubule severing ATPase, is concentrated at centrosomes. J. Cell Sci. 109, 561-567. 6. Rodionov, V.I., Borisy, G.G., 1997. Microtubule treadmilling in vivo. Science. 275, 215218. https://doi.org/10.1126/science.275.5297.215. 7. Keating, T.J., Peloquin, J.G., Rodionov, V.I., Momcilovic, D., 1997. Microtubule release from the centrosome. Proc. Natl. Acad. Sci. USA. 94, 5078-5083. https://doi.org/10.1073/pnas.94.10.5078. 8. Roll-Mecak, A., McNally, F.J., 2010. Microtubule-severing enzymes. Curr. Opin. Cell Biol. 22, 96-103. https://doi.org/10.1016/j.ceb.2009.11.001. 9. Yu, W., Solowska, J.M., Qiang, L., Karabay, A., Baird, D., Baas, P.W., 2005. Regulation of microtubule severing by Katanin subunits during neuronal development. J. Neurosci. 25, 5573-83. https://doi.org/10.1523/JNEUROSCI.0834-05.2005. 10. Karabay, A., Yu, W., Solowska, J.M., Baird, D.H., Baas, P.W., 2004. Axonal growth is sensitive to the levels of Katanin, a protein that severs microtubules. J. Neurosci. 24, 577888. https://doi.org/10.1523/JNEUROSCI.1382-04.2004. 11. Vogelstein, B., Lane, D., Levine, A.J., 2000. Surfing the p53 network. Nature. 408, 30710. https://doi.org/10.1038/35042675. 12. Vousden, K.H., Lu, X., 2002. Live or let die: the cell's response to p53. Nat. Rev. Cancer. 2, 594-604. https://doi.org/10.1038/nrc864. 13. Hudson, C.D., Morris, P.J., Latchman, D.S., Budhram-Mahadeo, V.S., 2005. Brn-3a transcription factor blocks p53-mediated activation of proapoptotic target genes Noxa and Bax in vitro and in vivo to determine cell fate. J. Biol. Chem. 280, 11851-8. https://doi.org/10.1074/jbc.M408679200. 14. Riley, T., Sontag, E., Chen, P., Levine, A., 2008. Transcriptional control of human p53regulated genes. Nat. Rev. Mol. Cell Biol. 9, 402-12. https://doi.org/10.1038/nrm2395. 15. el-Deiry, W.S., Kern, S.E., Pietenpol, J.A., Kinzler, K.W., Vogelstein, B., 1992. Definition of a consensus binding site for p53. Nat. Genet. 1, 45-9. https://doi.org/10.1038/ng049245.
16. Funk, W.D., Pak, D.T., Karas, R.H., Wright, W.E., Shay, J.W., 1992. A transcriptionally active DNA-binding site for human p53 protein complexes. Mol. Cell Biol. 12, 2866-71. https://doi.org/10.1128/MCB.12.6.2866. 17. Chène, P., 2001. Targeting p53 in cancer. Curr. Med. Chem. Anticancer Agents. 1, 15161. https://doi.org/10.2174/1568011013354741. 18. Inga, A., Storici, F., Darden, T.A., Resnick, M.A., 2002. Differential transactivation by the p53 transcription factor is highly dependent on p53 level and promoter target sequence. Mol. Cell Biol. 22, 8612-25. https://doi.org/10.1128/MCB.22.24.8612-8625.2002. 19. Jordan, J.J., Menendez, D., Inga, A., Noureddine, M., Bell, D.A., Resnick, M.A., 2008. Noncanonical DNA motifs as transactivation targets by wild type and mutant p53. PLoS Genet. 4, e1000104. https://doi.org/10.1371/journal.pgen.1000104. 20. Osada, M., Park, H.L., Nagakawa, Y., Yamashita, K., Fomenkov, A., Kim, M.S., Wu, G., Nomoto, S., Trink, B., Sidransky, D., 2005. Differential recognition of response elements determines target gene specificity for p53 and p63. Mol. Cell Biol. 25, 6077-89. https://doi.org/10.1128/MCB.25.14.6077-6089.2005. 21. Eom, H.S., Park, H.R., Jo, S.K., Kim, Y.S., Moon, C., Jung, U., 2015. Ionizing radiation induces neuronal differentiation of Neuro-2a cells via PI3-kinase and p53-dependent pathways. Int. J. Radiat. Biol. 91, 585-95. https://doi.org/10.3109/09553002.2015.1029595. 22. Di Giovanni, S., Rathore, K., 2012. p53-Dependent pathways in neurite outgrowth and axonal regeneration. Cell Tissue Res. 349, 87-95. https://doi.org/10.1007/s00441-0111292-5. 23. Korulu, S., Yildiz-Unal, A., Yuksel, M., Karabay, A., 2013. Protein kinase C activation causes neurite retraction via cyclinD1 and p60-Katanin increase in rat hippocampal neurons. Eur. J. Neurosci. 37, 1610-9. https://doi.org/10.1111/ejn.12185. 24. Kelle, D., Kırımtay, K., Selçuk, E., Karabay, A., 2019. Elk1 affects Katanin and Spastin proteins via differential transcriptional and post-transcriptional regulations. PLoS One. 14, e0212518. https://doi.org/10.1371/journal.pone.0212518. 25. Gjoerup, O., Zaveri, D., Roberts, T.M., 2001. Induction of p53 independent apoptosis by simian virus 40 small t antigen. J Virol. 75, 9142-55. https://doi.org/10.1128/JVI.75.19.9142-9155.2001. 26. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C (T) method. Nat. Protoc. 3, 1101-1108. https://doi.org/10.1038/nprot.2008.73. 27. Borgatti, P., Mazzoni, M., Carini, C., Neri, L.M., Marchisio, M., Bertolaso, L., Previati, M., Zauli, G., Capitani, S., 1996. Changes of nuclear protein kinase C activity and isotype composition in PC12 cell proliferation and differentiation. Exp. Cell Res. 224, 72-8. https://doi.org/10.1006/excr.1996.0112. 28. Bargonetti, J., Manfredi, J.J., 2002. Multiple roles of the tumor suppressor p53. Curr. Opin. Oncol. 14, 86-91. 29. Ye, S., Shen, J., Choy, E., Yang, C., Mankin, H., Hornicek, F., Duan, Z., 2016. p53 overexpression increases chemosensitivity in multidrug-resistant osteosarcoma cell lines. Cancer Chemother. Pharmacol. 77, 349-56. https://doi.org/10.1007/s00280-015-2944-z. 30. Kubbutat, M.H., Jones, S.N., Vousden, K.H., 1997. Regulation of p53 stability by Mdm 2. Nature. 387, 299-303. https://doi.org/10.1038/387299a0.
31. Sudo, H., Baas, P.W., 2011. Strategies for diminishing Katanin-based loss of microtubules in tauopathic neurodegenerative diseases. Hum. Mol. Genet. 20, 763-78. https://doi.org/10.1093/hmg/ddq521. 32. Galmarini, C.M., Kamath, K., Vanier-Viornery, A., Hervieu, V., Peiller, E., Falette, N., Puisieux, A., Ann Jordan, M., Dumontet, C., 2003. Drug resistance associated with loss of p53 involves extensive alterations in microtubule composition and dynamics. Br. J. Cancer. 88, 1793-9. https://doi.org/10.1038/sj.bjc.6600960. 33. Wu, X., Shen, Y., 2018. PMN inhibits colorectal cancer cells through inducing mitotic arrest and p53-dependent apoptosis via the inhibition of tubulin polymerization. Biochem. Biophys. Res. Commun. 499, 927-933. https://doi.org/10.1016/j.bbrc.2018.04.021.
Abbreviations: AAA, ATPases Associated with various cellular Activities; RE, Response element; PKC-, Protein kinase C-alpha; EMSA, Electrophoretic mobility shift assay; Mut, Mutated; MAPs, microtubule-associated proteins.
p53 Regulates Katanin-p60 Promoter Highlights p53 binds to the promoter of KATNA1 gene. p53 upregulates katanin-p60 expression. Cellular stress promotes KATNA1 expression upon p53 induction. p53 knockdown reduces KATNA1 expression. p53 upregulated katanin-p60 causes distruption of microtubules. p53 and katanin-p60 proteins are maintained in balanced levels within cells. FIGURE LEGEND
Figure 1: KATNA1 fragments containing putative regulatory elements and p53 binding site. The binding site of p53 is located in the region from -117 to -95 in KATNA1 promoter. Underlined CAAG repeats are the core elements for p53 binding. Indicated promoter, 5’ UTR, and promoter + 5’ UTR deletion constructs were used in the luciferase reporter assay.
Figure 2. Luciferase reporter assay results for functional analysis of KATNA1 regulatory regions in HCT 116 WT and HCT 116 p53 (-/-) cells. (A) The graph represents activities of KATNA1 regulatory regions in HCT 116 WT cells (n=3). (B) The graph represents activities of KATNA1 regulatory regions in HCT 116 p53 (-/-) cells (n=3). (C) The graph represents activity of each KATNA1 regulatory region comparing HCT 116 WT and HCT 116 p53 (-/-) cells.
Figure 2. Luciferase reporter assay results for functional analysis of KATNA1 regulatory regions in HCT 116 cells (n=3). The luminometric measurements indicating activities of The graphs represent activities of KATNA1 regulatory regions are shown by comparing HCT 116 WT and HCT 116 p53 (-/-) cells.
Figure 3. qRT-PCR results indicating endogenous KATNA1 mRNA level in HCT 116 WT and HCT 116 p53 (-/-) cells (n=5). The level of endogenous KATNA1 mRNA was compared between in HCT 116 WT and HCT 116 p53 (-/-) cells.
Figure 4. EMSA results for in vitro confirmation of p53 binding. The reactions including either WT-oligo (lane 1) or Mut-oligo (lane 3) without total cell lysate were used as negative controls. Shift band is detectable in WT-oligo and cell lysate included reaction as indicated by an arrow (lane 2). Mut-oligo and cell lysate included reaction is indicated in lane 4. Competition reaction, which was comprised of unlabeled WT-oligo within excess amount and labeled Mut oligo, is displayed in lane 5.
Figure 5. ChIP results for in vivo confirmation of p53 binding. H3 (positive control, lane 2), IgG (negative control, lane 3), beads only (negative control, lane 4), and p53 precipitated reaction (lane 5) and also 2% input DNA (lane 1) had been amplified using specific primers targeting p53 binding site included fragment.
Figure 6. Western blot results of for checkingconfirming p53 overexpression control in HCT 116 WT and HCT 116 p53 (-/-) cells (n=2). (A) FLAG-tag antibody was used to identify p53 overexpression. β-Actin was used as the loading control. “Control” represents untransfected and “p53” represents untransfected and p53 overexpressing cell for both HCT 116 WT and HCT 116 p53 (-/-), respectively. (B) The band density analysis of p53 overexpression level for HCT 116 WT and HCT 116 p53 (-/-) cells is
shown.Lane 1 represents control (untransfected) HCT 116 WT cells, while lane 2 indicates p53 overexpressinged HCT 116 WT cells. Control HCT 116 p53 (-/-) cells and p53 overexpressinged HCT 116 p53 (-/-) cells are shown in lane 3 and 4, respectively. (B) The graph represents overexpression level of p53 in HCT 116 p53 (-/-) cells and HCT 116 WT cells.
Figure 7. qRT-PCR results indicating KATNA1 mRNA level in p53 overexpressed HCT 116 cells under untransfected and p53 transfected conditions WT and HCT 116 p53 (-/-) cells (n=4). The differences of KATNA1 mRNA level between untransfected (control) and p53 overexpressing (p53) cells are shown for both HCT 116 WT and HCT 116 p53 (-/-) cells. The ACTB and GAPDH were used as internal control. The values were normalized to untransfected control cells. The graph represents fold change of KATNA1 mRNA levels in p53 overexpressed cells compared to control cells.
Figure 8. Western blot results of Katanin-p60 level in HCT 116 WT and HCT 116 p53 (-/-) cells (n=2). under untransfected (cControl indicates) untransfected and p53 indicates overexpression by transfectedion (p53) conditions (n=2).Western blot results of Katanin-p60 level in p53 overexpressed HCT 116 WT and HCT 116 p53 (-/-) cells (n=2). (A) Western blot images represent Katanin-p60 and β -actin protein levels in HCT 116 WT and HCT 116 p53 (-/-) cells comparatively to controls. (B) The graph displays fold change Densitometric analysis of Katanin-p60 level in for HCT 116 WT and HCT 116 p53 (-/-) cells was obtained by normalizing Katanin-p60 level to β -actin level. The fold change in Katanin-p60 level over the control was plotted.
Figure 9. ICC results of p53 overexpressing HCT 116 p53 (-/-) cells. Overexpression of p53 increases Katanin-p60 protein level and results in shortened microtubules and disruption of cell morphology. Images were taken using 63X objective at zoom 3.
Figure 910:. Western blot results of p53 levels in CoCl2 treated HCT 116 WT and HCT 116 p53 (-/-) cells (n=2). (A) Western blot images represent p53 and Vinculin protein levels in both HCT 116 WT and HCT 116 p53 (-/-) cells treated with different CoCl2 concentrations (100, 200 and 400 M). p53 antibody was used to identify p53 level and Vinculin was used as a loading control. (B) The The graph displays fold changes of p53 protein level upon increasing concentrations of CoCl2 in HCT 116 WT cells were obtained by normalizing to Vinculin level and then compared to untreated control cells.
Figure 11. Western blot results of Katanin-p60 level in CoCl2 treated HCT 116 WT cells (n=3) and HCT 116 p53 (-/-) cells (n=2). Western blot images represent Katanin-p60 and Vinculin protein levels in cells treated with different CoCl2 concentrations. Vinculin was used as a loading control. The graph displays fold change ofThe fold changes in Katanin-p60 level upon increasing concentrations of CoCl2 in (A) HCT 116 WT cells and (B) HCT 116 p53 (-/-) cells were shown by comparinged to untreated control cells.
Figure 12. TP53 mRNA and p53 protein levels upon p53 knockdown in HCT 116 WT cells (n=2). (A) qRT-PCR result indicates TP53 mRNA level in p53 shRNA transfected cells compared to control cells. (B) Western blot result represents p53 and GAPDH protein levels in control and p53 shRNA transfected cells. GAPDH was used as a loading control.
Figure 13. qRT-PCR results indicating KATNA1 mRNA levels upon p53 knockdown in HCT 116 cells (n=2). (A) KATNA1 mRNA level in p53 shRNA transfected (A) HCT 116 WT and (B) HCT 116 p53 (/-) cells compared to control cells. (B) KATNA1 mRNA level in p53 shRNA transfected HCT 116 p53 (-/-) cells compared to control cells.
Figure 12. qRT-PCR results indicating TP53 and KATNA1 mRNA levels upon p53 knockdown (n=2). (A) The graph represents the fold change of TP53 mRNA in p53 shRNA transfected HCT 116 WT cells compared to control cells. (B) The graph represents the fold change of KATNA1 mRNA in p53 shRNA transfected HCT 116 WT cells compared to control cells. (C) The graph represents the fold change of KATNA1 mRNA in p53 shRNA transfected HCT 116 p53 (-/-) cells compared to control cells.
Figure 13. Western blot results of p53 protein level in HCT 116 WT cells upon p53 knockdown (n=2). (A) Western blot images represent p53 and GAPDH protein levels in control (lane 1) and p53 shRNA transfected cells (lane 2). GAPDH was used as a loading control. (B) The graph displays fold change of p53 protein in p53 shRNA transfected HCT 116 WT cells compared to control cells.
Figure 14. Western blot results of Katanin-p60 protein level in HCT 116 WT cells upon p53 knockdown (n=2). (A) Western blot images represent Katanin-p60 and GAPDH protein levels in control (lane 1) and p53 knockdown cells (lane 2). GAPDH was used as a loading control. (B) The graph displays fold change of Katanin-p60 protein in p53 shRNA transfected HCT 116 WT cells compared to control cells.
Figure 15. Western blot results of Katanin-p60 protein level in HCT 116 p53 (-/-) cells upon p53 knockdown (n=2). (A) Western blot images represent Katanin-p60 and GAPDH protein levels in control (lane 1) and p53 shRNA transfected cells (lane 2). GAPDH was used as a loading control. (B) The graph displays fold change of Katanin-p60 protein in p53 shRNA transfected HCT 116 p53 (-/-) cells compared to control cells.
Figure 14. Western blot results of Katanin-p60 protein levels in HCT 116 WT and HCT 116 p53 (-/-) cells upon p53 knockdown (n=2). Western blot images represent Katanin-p60 and GAPDH protein levels in control and p53 knockdown cells. The The graph displays fold change of Katanin-p60 protein in p53 shRNA transfected (A) HCT 116 WT cells and (B) HCT 116 p53 (-/-) cells was demonstrated by comparinged to control cells. GAPDH was used as a loading control.
Table 1: Sequence of qRT-PCR primers used for investigation of KATNA1 and TP53 expression Probe No
Primer
Primer sequence
Katanin-p60-L
5'-GCGGACATTACCAACGTGT-3'
Katanin-p60-R
5'-CATGTGCATTTCTTCTTTGGAA-3'
p53-L
5’ AGGCCTTGGAACTCAAGGAT 3’
p53-R
5’ CCCTTTTTGGACTTCAGGTG 3’
UPL 6
UPL 12
S0378-1119(19)30900-X https://doi.org/10.1016/j.gene.2019.144241 GENE 144241
To appear in:
Gene Gene
Received Date: Revised Date: Accepted Date:
10 April 2019 25 October 2019 28 October 2019
Please cite this article as: K. Kırımtay, E. Selçuk, D. Kelle, B. Erman, A. Karabay, p53 Regulates Katanin-p60 Promoter in HCT 116 Cells, Gene Gene (2019), doi: https://doi.org/10.1016/j.gene.2019.144241
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Elsevier B.V. All rights reserved.
p53 Regulates Katanin-p60 Promoter in HCT 116 Cells Koray Kırımtay1#, Ece Selçuk1,2#, Dolunay Kelle1, Batu Erman3, Arzu Karabay1* 1Department
of Molecular Biology and Genetics, Istanbul Technical University, Istanbul, Turkey
2Department of Molecular Biology and Genetics, Istanbul Medeniyet University, Istanbul, Turkey 3 Department
of Molecular Biology and Genetics, Sabancı University, Istanbul, Turkey
# Equal contribution *Corresponding author E-mail: [email protected] (AK) Phone: 90 212 285 7257
p53 Regulates Katanin-p60 Promoter in HCT 116 Cells Koray Kırımtay1#, Ece Selçuk1,2#, Dolunay Kelle1, Batu Erman3, Arzu Karabay1* 1Department
of Molecular Biology and Genetics, Istanbul Technical University, Istanbul, Turkey
2Department of Molecular Biology and Genetics, Istanbul Medeniyet University, Istanbul, Turkey 3 Department
of Molecular Biology and Genetics, Sabancı University, Istanbul, Turkey # Equal contribution *Corresponding author E-mail: [email protected] (AK) Phone: 90 212 285 7257
Abstract Tumor suppressor protein p53, which functions in the cell cycle, apoptosis and neuronal differentiation via transcriptional regulations of target genes or interactions with several proteins, has been associated with neurite outgrowth through microtubule re-organization. We previously demonstrated in neurons that upon p53 induction, the level of microtubule severing protein Katanin-p60 increases, indicating that p53 might be a transcriptional regulator of the KATNA1 gene encoding Katanin-p60. In this context, we firstly elucidated the activity of KATNA1 regulatory regions and endogenous KATNA1 mRNA levels in the presence or absence of p53 using
HCT 116 WT and HCT 116 p53 (-/-) cells. Next, we demonstrated the binding of p53 to the KATNA1 promoter and then investigated the role of p53 on KATNA1 gene expression by ascertaining KATNA1 mRNA and Katanin-p60 protein levels upon p53 overexpression and activation in both cells. Moreover, we showed changes in microtubule network upon increased Katanin-p60 level due to p53 overexpression. Also, the changes in KATNA1 mRNA and Kataninp60 protein levels upon p53 knockdown were investigated. Our results indicate that p53 is an activator of KATNA1 gene expression and we show that both p53 and Katanin-p60 expression have strict regulations and are maintained in balanced levels as they are vital proteins to orchestrate either survival and apoptosis or differentiation. Keywords: p53, Katanin, microtubule, transcriptional regulation, gene expression Abbreviations: AAA, ATPases Associated with various cellular Activities; RE, Response element; PKC-, Protein kinase C-alpha; EMSA, Electrophoretic mobility shift assay; Mut, Mutated; MAPs, microtubule-associated proteins.
1. Introduction Katanin, which is a well-characterized microtubule severing protein, is a heterodimer consisting of p60 and p80 subunits encoded by the KATNA1 and KATNB1 genes respectively. Katanin-p60 is an ATPase that conducts severing reaction while Katanin-p80 localizes Katanin-p60 to the centrosome and regulates its microtubule severing activity [1, 2]. Katanin-p60 has an N-terminal microtubule binding domain and a C-terminal AAA (ATPases Associated with various cellular Activities) domain [1, 3]. Katanin-p60 has essential roles in various cellular activities including cell division, intracellular motility, cytoskeletal regulation as well as neuronal branching [2, 4]. Microtubule severing plays a role in regulating poleward flux of tubulin in the metaphase spindle during cell division and releasing of centrosome-nucleated microtubules [5, 6, 7]. In nonproliferative cells like neurons, there are also non-centrosomal microtubules formed by microtubule severing and this severing mechanism is crucial for neuronal branching and axonal growth [2-8]. The levels of Katanin-p60 are regulated in different stages of neuronal development. In early embryonic stage, Katanin-p60 level is high to form neuronal network [9]; when the axons reach to target cells, their growing stops, and Katanin-p60 level decreases [10].
p53 protein is a tumor suppressor protein that functions as a transcription factor regulating gene expressions by either activating or repressing target genes having roles in cell cycle, apoptosis, angiogenesis, and neuronal differentiation [11-14]. For the regulation of these genes, p53 binds to a consensus response element (RE) on DNA identified as RRRCWWGYYY (R: Purine; C: Cytosine; W: Adenine or Thymine; G: Guanine; Y: Pyrimidine) [15, 16]. For p53 activation, it has to recognize two REs interrupted by a 0-13 bp spacer and bind as tetramers [17]. The CWWG motif is crucial for high binding affinity of p53 to the DNA. Neighboring bases of the motif and spacer length have also found to be important in the transcriptional activity of p53 as well [18-20]. The long spacer length between REs has been specifically associated with transcriptional repression by p53 [14]. In neuroblastoma cells, p53 has a role in differentiation by affecting process lengths and increasing expression of neuronal markers [21, 22]. Besides, we previously reported that the activation of Protein Kinase C-alpha (PKC-), which is an up-regulator of cell cycle protein cyclinD1, results in alteration of neuronal morphology by increasing neuronal processes and the levels of Kataninp60 and p53 proteins [23]. Since both p53 and Katanin-p60 have similar functions on neuronal differentiation and upon PKC activation, their protein levels are simultaneously upregulated causing an increase in neuronal process numbers; we hypothesized that p53 might be a transcriptional regulator of the KATNA1 gene. Therefore, we examined mRNA and protein levels of KATNA1 gene expression in HCT 116 WT and HCT 116 p53 (-/-) double knockout human colorectal carcinoma cells. Our data show that p53 upregulates KATNA1 in both transcript and protein levels; and both p53 and Katanin-p60 gene expressions are tightly regulated.
2. Materials and Methods 2.1.
Constructs
The fragments containing putative regulatory elements of either “promoter” (-442 to +1), or “5’ UTR” (+1 to +336) or “promoter + 5’ UTR” (-442 to +336) of KATNA1 gene, which were previously cloned into a pGL3-basic vector [24], were used to conduct luciferase reporter assays. pcDNA3 flag p53 was a gift from Thomas Roberts (Addgene plasmid # 10838) [25]. pMKO.1 puro p53 shRNA 1 (Addgene plasmid # 10671) was used for transient knockdown of p53.
2.2.
Cell Culture
HCT 116 WT and HCT 116 p53 (-/-) (p53 double knock-out) colorectal carcinoma, cells were kind gifts from Dr. Matthias Dobblestein of the Georg-August-Universität Göttingen. HCT 116 WT and HCT 116 p53 (-/-) cells were maintained in medium containing DMEM (4,5 g/L glucose), 10% FBS and 1% Penicillin/Streptomycin solution at a final concentration of 100 U/mL and 100 µg/ml, respectively. The cells were cultivated in a 5% CO2 incubator at 37°C.
2.3.
Luciferase Assay
HCT 116 WT and HCT 116 p53 (-/-) cells were seeded at 4x104 cells/well onto 24-well dishes. Both cell types were transfected using TransfastTM Transfection Reagent (Promega, E2431) at 1:2.5 ratio of total DNA to Transfast reagent. Total of 1630 ng DNA (1600 ng pGL3 vectors and 30 ng pRL-TK Renilla control vector (Promega, E2241)) and transfection reagent were mixed in serum-free DMEM and incubated for 15 min at room temperature. After 15 min, growth medium of the cells was removed and the mixture was added onto the cells and incubated for 1 h in a 5% CO2 incubator at 37°C. Then, fresh growth medium was added and cells were cultivated for an additional 24 h. Dual-Luciferase Reporter Assay System (Promega, E1910) and Fluoroskan Ascent FL Luminometer (Thermo Electron Co., Hudson, USA) were used to measure Firefly and Renilla activities. 24 h post-transfection, growth medium was removed and the cells were lysed with 60 µL 1X Passive Lysis Buffer incubating on an orbital shaker at 40 rpm and room temperature for 15 min. The cell lysate was collected and mixed with Luciferase Assay Reagent II (LAR II) for the induction of luminescent signal in a luminometric plate. After measurement of firefly activity, Stop&Glo Buffer containing Stop&Glo Reagent was immediately added into the same well to quench the reaction and measure Renilla activity. Luminometer device had been adjusted to delay 2 sec pre-measurement and to shake the plate followed by a 10 sec period at 600 PTM for the measurement of each sample. The promoter activity was analyzed by normalizing firefly to Renilla luciferase activity. All experiments were performed as triplicates and were repeated 3 times on separate days for both HCT 116 WT and HCT 116 p53 (-/-) cells to obtain statistically meaningful data. In order to determine fold activity, Firefly luciferase in each pGL3 vector was normalized to Renilla luciferase; then, pGL3 vectors containing regulatory regions were normalized to empty pGL3-basic vector.
2.4.
Electrophoretic Mobility Shift Assay (EMSA)
The binding sites of p53 on KATNA1 were searched by using TFBIND tool (http://tfbind.hgc.jp) and a binding site was detected on the promoter with 85% possibility, which is located from -116 to
-94.
The
oligonucleotide
probes
containing
binding
site
(p53_WT-probe:
5'-
GAGGGAAAGTGAGCAAGCACCTGAACAAGGTACAGAGGCGCG -3'; p53_Mut-probe: 5'-GAGGGAAAGTGAGTGGACACCTGAATGGAGTACAGAGGCGCG-3') were designed and labeled separately by using Biotin 3’ End DNA Labeling Kit (Thermo Scientific, Pierce). Labeled forward and reverse oligonucleotides were then annealed at a ratio of 1:1 in 10 mM Tris, 1 mM EDTA by heating to 95°C for 5 min, slow cooling by 2°C/min to their annealing temperature, annealing for 30 min and cooling to 4°C by 2°C/min. For binding reactions, LightShift™ Chemiluminescent EMSA Kit (Thermo Scientific, 20148) was used. Whole extracts of p53 overexpressing cell lysate (2 µg per sample) were incubated with 20 fmol biotinylated oligonucleotides in binding buffer (pH 7.5), including 10 mM Tris, 50 mM KCl, 1 mM dithiothreitol (DTT), 1 mg Poly (dI·dC), 5% glycerol, 1 mM EDTA, 0.3% bovine serum albumin (BSA) and 1X Protease Inhibitor Cocktail for 20 min at room temperature. 1000-fold molar excess of unlabeled WT competitor oligonucleotide was also used in binding of competition reaction. Complexes and free DNAs were resolved on a 5–8% non-denaturating polyacrylamide gel in 0.5X TBE by electrophoresis for 1 h at 120V at 4°C. The gel was then transferred to Biodyne A Nylon Membranes (Thermo Scientific, Pierce) by using Trans-Blot SD (Bio-Rad) at 20V for 30 min at 4°C. Crosslink transfer of DNA to membrane was achieved by incubating the membrane with 254 nm UV bulbs for 12 min in order to detect biotin-labeled DNA in which Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific, Pierce 89880) was used. The membrane was exposed to X-ray film for 2 min and then was analyzed by using Kodak Medical X-ray Processor according to the manufacturer’s instruction.
2.5.
Chromatin immunoprecipitation assay (ChIP)
ChIP assay was performed by using SimpleChIP® Enzymatic Chromatin IP Kit (Magnetic Beads) (Cell Signaling Technology). Formaldehyde (37%) was added to 3x107 of HCT 116 WT cells at the final concentration of 1% in order to crosslink proteins to DNA. Micrococcal nuclease (5 µl per sample) was used for chromatin digestion followed by sonication in order to break the nuclear membrane. Sonicator was programmed to perform 3 sets of 20 sec pulses at 30 W and 30 sec rest periods on ice. For immunoprecipitation reactions, each 10 µg digested chromatin was incubated
with 10 µl positive control Histone H3, 1 µl negative control Normal Rabbit IgG, 2.5 µl (1:200 dilution) p53 antibody (Cell Signaling Technology) overnight at 4°C. 30 µl ChIP-Grade Protein G Magnetic Beads was mixed with IP reactions and incubated for 2 h at 4°C. Protein G Magnetic Beads were washed three times in order to remove unbounded proteins and DNA fragments. Crosslinked protein/DNA complexes were eluted and DNA fragments were purified by using SimpleChIP® Enzymatic Chromatin IP Kit. iProof™ High-Fidelity PCR Kit (Bio-Rad) was used for PCR amplification. PCR products which had been amplified by specific primers (forward 5’CGAATTGCTTGATCCTGGACATTC -3′; reverse 5- CAGCGGAGACCAGGGATAGTA -3′) were analyzed on agarose gel and the gel was visualized using ChemiDoc™ Imaging System (BioRad).
2.6.
Hypoxia treatment
Before hypoxia treatment, 6x105 of HCT 116 WT and HCT 116 p53 (-/-) cells were incubated for 24 h. To induce p53 activation, 25 mM stock solution of CoCl2 was prepared and cells were treated with serial CoCl2 concentrations (100, 200 and 400 M) diluted in culture medium. Untreated cells were used as control. After 24 h of CoCl2 treatment, whole cell extracts were isolated using 1% NP40 solution including 150 mM NaCl, and 50 mM Tris-HCl (pH 8.0).
2.7.
Transient transfection and protein isolation
For p53 overexpression, 6x105 of HCT 116 WT and HCT 116 p53 (-/-) cells were transfected with 5 µg of either p53 or mock vector by using TransfastTM Transfection Reagent (Promega, E2431). At 24 h post-transfection, whole cell extract was isolated using Mammalian Cell Extraction Kit (BioVision). For p53 knockdown, 6x105 of HCT 116 WT and HCT 116 p53 (-/-) cells were transfected with 5 µg of either p53 shRNA or mock vector by using TransfastTM Transfection Reagent (Promega, E2431). At 24 h post-transfection, whole cell extract was isolated using 1% NP40 solution including 150 mM NaCl, and 50 mM Tris-HCl (pH 8.0).
2.8.
Total RNA extraction, cDNA Synthesis and Quantitative Real Time PCR
MN NucleoSpin RNA Kit (Macherey-Nagel) was used for total RNA isolation from either transiently transfected cells to analyze the changes in KATNA1 and TP53 mRNA levels or untransfected cells to investigate endogenous KATNA1 mRNA level. 1 µg total RNA was reverse
transcribed by using Oligo dT primers and ProtoScript® II First Strand cDNA Synthesis Kit (New England BioLabs). Human Katanin-p60 and p53 probe and primers (Table 1) were purchased from Universal Probe Library (Roche Applied Science) and Alpha DNA, respectively. ACTB (Roche Universal Probe Library Human ACTB Gene Assay) or GAPDH (Roche Universal Probe Library Human GAPD Gene Assay) gene was used as housekeeping controls for relative expression analysis. Quantitative Real Time – PCR (qRT-PCR) reactions were performed with Light Cycler® 480 Probes Master qRT-PCR Kit using a Roche Light Cycler 480 device according to the following program: pre-incubation at 95°C for 10 min for 1 cycle, amplification at 95°C for 10 sec, 60°C for 30 sec, 72°C for 1 sec for 45 cycles, and cooling at 40°C for 30 sec for 1 cycle. ΔΔCT method was used to analyze qRT-PCR data. In order to calculate the expression rate based on fold change (relative quantification), following equation is used; 2- ΔΔCT= [(CT control) treated sample
2.9.
gene of interest
- CT
internal
- (CT gene of interest - CT internal control) control sample)] [26].
Western Blot
Total protein extract was loaded into polyacrylamide gel (30 µg protein/lane) and run by SDSPAGE system. Then, the proteins were transferred onto the nitrocellulose membrane by TransBlot Turbo Transfer System (Bio-Rad). The membrane was blocked in 5% skim milk powder dissolved in TBS-T (Tris-buffered saline and 0,1% Tween-20) for 1 h at room temperature by shaking. After the blocking, the membrane was incubated overnight at 4°C with primary antibodies (rabbit monoclonal anti-Katanin-p60 antibody (1:500, Abcam), rabbit polyclonal anti-FLAG antibody (1:500), and rabbit monoclonal anti-p53 antibody, rabbit monoclonal anti-ß-actin antibody, mouse monoclonal anti-GAPDH antibody and rabbit monoclonal anti-vinculin antibody (all in 1:1000) (Cell Signaling Technology)) were prepared in blocking solution. Following day, the membrane was washed 6 times for 5 min with TBS-T to eliminate unbound primary antibodies and then incubated with HRP conjugated secondary antibody (anti-rabbit (1:3000, Cell Signaling Technology)) for 1 h at room temperature and washed 6 times for 5 min. Finally, the membrane was visualized by using VisualizerTM Western Blot Detection Kit (EMD Millipore) and ChemiDocTM MP System (Bio-Rad). In order to determine the relative intensity of protein bands on the Western blot membrane, Adobe Photoshop CS5 Software was used. The intensity value of each protein band in the membrane was calculated by measuring the selected band area and pixel values. Obtained values were normalized to the values of ß-actin, GAPDH or vinculin which were used as loading control.
2.10. Immunocytochemistry HCT 116 p53 (-/-) cells seeded as 4x104 cells/well on 8-chamber slides (SPL Life Science, Korea) were transfected with 0.2 µg p53 expression vector using TransFastTM Transfection Reagent. After 24 h of transfection, cells were fixed with 4% paraformaldehyde for 15 min at room temperature. Then, cells were washed with 1X PBS (phosphate-buffered saline) 3 times for 5 min and blocked with blocking buffer (3% (w/v) Bovine serum albumin in PBS, 0.1% Triton X-100) for 1 h at the room temperature. Cells were treated with primary antibodies (rabbit monoclonal anti-p53 antibody 1:500 Cell Signaling Technology; mouse polyclonal anti-p60 katanin antibody 1:200 Abcam; chicken polyclonal anti--tubulin antibody 1:500 Abcam) overnight at 4°C. Next day, cells were washed with 1X PBS 3 times for 5 min to remove unbound primary antibodies, and then incubated with secondary antibodies (anti-rabbit Alexa Fluor® 488 Conjugate and anti-mouse Alexa Fluor® 594 Conjugate (Cell Signaling Technology) and anti-chicken Alexa Fluor® 647 Conjugate (Invitrogen Life Technologies) all in 1:500 dilution) prepared in blocking buffer for 1 h at room temperature. After incubation, cells were washed with 1X PBS 3 times for 5 min. ProLong™ Diamond Antifade Mounting Medium (Thermo Fisher Scientific, USA) was added onto slides and coverslips were placed onto samples. The imaging was performed by Leica TCS SP2 SE Confocal Microscope (Germany).
2.11. Statistical analysis Statistical analyses were performed using GraphPad Prism 7 Software. The results of luciferase reporter assay and qRT-PCR experiments investigating endogenous KATNA1 mRNA level, were analyzed using two-tailed unpaired student’s test. Further experiments were analyzed using onetailed unpaired student’s test. Error bars in the graphs were generated using ± SEM values. p<0.05 was considered as significant for all statistical analysis.
3. Results 3.1.
KATNA1 expression differs based on p53
In order to investigate if p53 may act as a transcriptional regulator of KATNA1, we first performed luciferase reporter assay in HCT 116 WT and HCT 116 p53 (-/-) cells to elucidate the regulation of KATNA1 transcription depending on presence or absence of p53. Luciferase reporter assay was
carried out with the constructs containing putative regulatory elements of “Promoter”, “5’ UTR” and “Promoter+5’ UTR” (Figure 1). The results indicated that the “5’ UTR” was the critical region for KATNA1 regulation in both HCT 116 WT and HCT 116 p53 (-/-) cells (Figure 2), correlating with our previous results with SH-SY5Y cells [24] and its activity was similar in both cells. However, only “Promoter” and “Promoter+5’ UTR” showed lower activity in HCT 116 p53 (-/-) cells compared to HCT 116 WT cells. The difference between 5’ UTR and Promoter + 5’ UTR activity was not significant in HCT 116 WT cells, whereas it was significant in HCT 116 p53 (-/) cells (Figure 2). Since luciferase reporter assay indicated that KATNA1 gene regulatory sequencemediated reporter gene expression increased in the presence of p53, we performed qRT-PCR in order to elucidate endogenous KATNA1 transcript levels in HCT 116 WT and HCT 116 p53 (-/-) cells. The results showed that the endogenous mRNA level of KATNA1 decreased in the absence of p53 protein in HCT 116 p53 (-/-) cells (Figure 3).
3.2.
Confirmation of p53 binding through ChIP assay and EMSA
We searched for the presence of p53 consensus sequence on the regulatory regions of KATNA1 gene using TFBIND tool, and determined a putative binding site of p53 between -116 to -94 nucleotides located on the promoter. In order to investigate the physical binding ability of p53 to this site on KATNA1, we performed EMSA and ChIP assays using total cell extract of HCT 116 WT cells. EMSA results revealed the presence of a shifted band indicating the complex formation of p53 and WT KATNA1 oligo (Figure 4, lane 2). No complex formation was detected in the reaction which contained mutated oligo (Mut-oligo) and the cell extract (lane 4). Binding specificity was supported by control reactions including either WT or Mut-oligo without cell extract (lane 1 and 3), and competition reaction (lane 5) in which unlabeled WT-oligo had excess amount than labeled WT-oligo, thereby no complex formation was observed. ChIP-PCR results showed the amplification of p53 binding site including DNA fragment in input and p53 precipitated reactions (Figure 5). H3 precipitation was used as a positive control, and amplified fragment was also detected in this reaction, while IgG and beads only were used as negative controls (), which did not allow amplification of p53, since it was not able to be precipitated in these reactions.
3.3.
p53 is a positive regulator of KATNA1 gene expression
We examined the role of p53 on KATNA1 gene expression by qRT-PCR and Western blot in order to detect Katanin-p60 mRNA and protein levels in p53 overexpressing cells. Both HCT 116 WT and HCT 116 p53 (-/-) cells were used for these experiments and separately transfected with p53 construct. Since HCT 116 p53 (-/-) cells do not have endogenous p53 expression, the results for these cells would directly indicate the effect of exogenously expressed p53. Overexpression levels of p53 in both cells were determined by normalization of p53 to their loading controls seen in Figure 6A. Also, the overexpression level in HCT 116 WT cells was accepted as a baseline in order to determine the fold change of p53 overexpression; thus, data were normalized to the overexpressed level of p53 in HCT 116 WT cells. Results showed that p53 overexpression was 8.35 fold increased in HCT 116 p53 (-/-) cells compared to HCT 116 WT cells (Figure 6B). Relative quantification analysis of qRT-PCR data revealed that KATNA1 mRNA level significantly increased in p53 overexpressing HCT 116 p53 (-/-) cells whereas the increase was not significant in p53 overexpressing HCT 116 WT cells (Figure 7). According to Western blot analysis, Katanin-p60 protein level increased 1.79 and 2.20 folds in p53 overexpressing HCT 116 WT and p53 overexpressing HCT 116 p53 (-/-) cells, respectively (Figure 8). Thus, these results have demonstrated that p53 has an activator role in KATNA1 gene expression.
3.4.
Increased Katanin-p60 protein level via p53 overexpression dysregulates microtubule network
We wanted to see if the increase in Katanin-p60 level due to p53 overexpression would cause any change in microtubule organization. We demonstrated an elevation in Katanin-p60 protein level in p53 overexpressing cells compared to untransfected cells by immunocytochemistry (Figure 9). Moreover, we observed diminution in microtubule length based on the severing activity of Katanin-p60, and disruption of microtubule network resulting in alteration of cell morphology in p53 overexpressing cells (Figure 9).
3.5.
Hypoxia causing p53 activation results in Katanin-p60 induction
To activate p53 through cellular stress, HCT 116 WT cells were treated with serial concentrations of CoCl2 to induce hypoxia. Untreated cells were used as control. HCT 116 p53 (-/-) cells were also treated with the same concentrations of CoCl2 in order to be used as a negative control. Results showed that p53 was gradually induced by the increasing CoCl2 concentrations in HCT 116 WT
cells and p53 expression was not detected in HCT 116 p53 (-/-) cells (Figure 10A and B). Kataninp60 protein level in HCT 116 WT cells was then detected by Western blot (Figure 11A). It was revealed that Katanin-p60 level was not changed in 100 and 200 M CoCl2 treated cells, and significantly increased in 400 M CoCl2 treated cells. CoCl2 treatment reduced Katanin-p60 expression in HCT 116 p53 (-/-) cells (Figure 11B).
3.6.
p53 knockdown leads to Katanin-p60 repression
In addition to activation and overexpression, p53 knockdown was performed to determine the change in Katanin-p60 level due to p53 inhibition. HCT 116 WT and HCT 116 p53 (-/-) cells used as control were transfected with p53 shRNA construct. In HCT 116 WT cells, the percentage of reduction in TP53 mRNA p53 protein were detected as 18% and 36%, respectively (Figure 12A and B). Upon p53 knockdown, KATNA1 mRNA level was reduced by 16% in HCT 116 WT cells (Figure 13A); however, it was not changed in HCT 116 p53 (-/-) cells (Figure 13B). Accordingly, Katanin-p60 protein was also decreased by 20% in HCT 116 WT cells (Figure 14A), but not changed in HCT 116 p53 (-/-) cells (Figure 14B).
Discussion We present here KATNA1 as a new transcriptional target of p53. Since both Katanin-p60 and p53 proteins are important for determining the cell fate, their regulation is highly critical for understanding the mechanism of either survival or differentiation. Here we show that p53 promotes Katanin-p60 expression and both proteins are tightly regulated in cells. In our previous study, we identified that up-regulation of PKC- shuttles it into the nucleus, causing shortened neuronal processes and increased process numbers in neurons by increasing p53 and Katanin-p60 expressions in hippocampal neurons [23]. Borgatti et al. [27] also showed that nuclear PKCs play a pivotal role in the induction and persistence of the differentiation of PC12 cells into neuronal phenotype. Based on these findings and the importance of p53 in neuronal differentiation, we considered that p53 might also be a transcriptional regulator of Katanin-p60. In order to determine whether the activity of KATNA1 regulatory regions differs depending on p53 existence, we first performed luciferase reporter assay in both HCT 116 WT and HCT 116 p53 (/-) cells which have been widely used cell lines to ascertain p53 effect. Consistent with our results
in SH-SY5Y cells [24], 5’ UTR had the highest regulatory activity in both HCT 116 cells, and also fold activation of 5’ UTR was almost the same in both HCT 116 cells. Fold activation of Promoter and Promoter + 5’ UTR, however, varied by the cell line (Figure 2) suggesting that p53 might have a role in KATNA1 transcription due to putative binding site on the promoter region located between -116 and -94 nucleotides (Figure 1). We investigated the endogenous KATNA1 transcript levels in both HCT 116 WT and HCT 116 p53 (-/-) cells and found out that KATNA1 mRNA level decreased by ~15% in the absence of p53 (Figure 3). Thus, we speculated that p53 might positively regulate KATNA1 gene expression. In order to ascertain if p53 directly affects KATNA1 expression, we first confirmed the binding of p53 to the bioinformatically identified site (Figure 1) on the KATNA1 promoter (Figure 4 and 5). Confirmation of the p53 binding validated our data in which endogenous mRNA level of KATNA1 and activities of Promoter and Promoter+5’UTR constructs showed significant increase due to the binding of p53 to the promoter region in HCT 116 WT cells. To reveal the regulatory effect of p53 on KATNA1 gene expression, p53 was overexpressed in both HCT 116 WT and HCT 116 p53 (-/-) cells. The overexpression level of p53 was lower in HCT 116 WT cells than HCT 116 p53 (-/-) cells (Figure 6). It has been known that p53 is a crucial transcription factor to operate cellular processes such as apoptosis, growth arrest, DNA repair [28], and its aberrant overexpression leads to cell death [29]; thus, its expression is maintained at a quite balanced level in cells [30]. We, therefore, argue that since WT cells have endogenous p53 protein, exogenous p53 could not be overexpressed in HCT 116 WT cells as much as in HCT 116 p53 (/-) cells (Figure 6) as the cells tend to maintain a certain level of p53 to keep the balance between cell survival and apoptosis. Upon p53 overexpression Katanin-p60 mRNA and protein levels increased (Figure 7,8 and 9) indicating that p53 promotes KATNA1 expression. However, the increase was not equal in HCT 116 WT and HCT 116 p53 (-/-) cells since endogenous Katanin-p60 mRNA and protein levels are already high in HCT 116 WT cells compared to HCT 116 p53 (-/-) cells. Thus, the increase in KATNA1 mRNA in HCT 116 p53 (-/-) cells was higher than the increase in HCT 116 WT cells (Figure 7). The reason why Katanin-p60 protein level was significantly increased in both cell types (Figure 8), might be related to the availability of KATNA1 mRNA for a longer period due to posttranscriptional regulatory mechanism.
Katanin-p60, like p53, is another key protein affecting cell survival depending on its expression level of which excessive amounts often result in cell death due to disrupting microtubule network [10, 31]. We previously reported that even about 20% increase in Katanin-p60 level is sufficient to regulate microtubule reorganization for the transition from interphase to mitosis [10]. Moreover, here we also showed that two fold increase in Katanin-p60 level due to p53 caused significant changes in microtubule organization resulting in dramatic alterations of cell morphology (Figure 9). In order to analyze Katanin-p60 level through p53 activation apart from p53 overexpression we treated HCT 116 WT and HCT 116 p53 (-/-) cells with CoCl2 to mimic hypoxia in which condition p53 is known to be activated (Figure 10). Upon CoCl2 treatment, Katanin-p60 level was increased in HCT 116 WT cells, (Figure 11A); while it was reduced in HCT 116 p53 (-/-) cells (Figure 11B). The decrease in p53 depleted cells suggests that Katanin-p60 may be downregulated by another transcription factor or pathway under hypoxia conditions, and that needs further investigation. In spite of other possible downregulatory factors present in both cells, increase in Katanin-p60 level due to existence of p53 indicates that p53 is a major positive regulatory factor on Katanin-p60 expression. We also analyzed Katanin-p60 mRNA and protein levels upon knockdown of p53 with shRNA in HCT 116 WT and HCT 116 p53 (-/-) cells. Inhibition of p53 was confirmed both in transcriptional and translational levels (Figure 12A and B) and repression of p53 caused decreases in both KATNA1 mRNA (Figure 13A) and Katanin-p60 protein (Figure 14A) levels in HCT 116 WT cells. On the other hand, treatment of HCT 116 p53 (-/-) cells with p53 shRNA did not affect KATNA1 mRNA (Figure 13B) and Katanin-p60 protein (Figure 14B) levels. The study by Galmarini et al. [32] indicated an increased ratio of polymerized tubulin to soluble tubulin in mutant p53 containing cells compared to wild-type p53 containing cells. Our results contribute to understanding the reason for this differential ratio of polymerized tubulin to soluble tubulin based on the function of p53 since p53 increases the level of Katanin-p60 allowing it to severe microtubules and depolymerize them; whereas in the presence of mutant p53, Katanin-p60 would not be increased, and thereby leading to inhibit microtubule severing and hence microtubules would remain intact, in the polymerized form of tubulin. In addition to this, another study performed with HCT 116 WT cells demonstrated that treatment of anti-cancer agent PMN results in upregulation of p53 and p53-mediated apoptosis, and disruption of microtubule
organization [33], allowing us to speculate that upregulation of p53 via PMN treatment may also result in an increase in the expression of Katanin-p60 which would lead to disruption of microtubule organization. Consequently, we conclude that p53 binds to response element located on KATNA1 promoter region and has an activator role on KATNA1 gene expression. Furthermore, this study has a great impact on emphasizing the tight regulation of p53 and Katanin-p60 from gene to protein level since they both achieve crucial roles in the cell.
Acknowledgement This study was funded by TUBİTAK [Project ID: 113Z462] to AK.
References 1. Hartman, J.J., Mahr, J., McNally, K., Okawa, K., Iwamatsu, A., Thomas, S., Cheesman, S., Heuser, J., Vale, R.D., McNally, F.J., 1998. Katanin, a microtubule-severing protein, is a novel AAA ATPase that targets to the centrosome using a WD40-containing subunit. Cell. 93, 277-87. https://doi.org/10.1016/S0092-8674(00)81578-0. 2. Quarmby, L., 2000. Cellular Samurai: Katanin and the severing of microtubules. J. Cell Sci. 113, 2821-7. 3. Hartman, J.J., Vale, R.D., 1999. Microtubule disassembly by ATPdependent oligomerization of the AAA enzyme Katanin. Science. 286, 782-785. https://doi.org/10.1126/science.286.5440.782. 4. Yu, W., Qiang, L., Solowska, J.M., Karabay, A., Korulu, S., Baas, P.W., 2008. The microtubule-severing proteins Spastin and Katanin participate differently in the formation of axonal branches. Mol. Biol. Cell. 19:1485-98. https://doi.org/10.1091/mbc.E07-090878. 5. McNally, F.J., Okawa, K., Iwamatsu, A., Vale, R.D., 1996. Katanin, the microtubule severing ATPase, is concentrated at centrosomes. J. Cell Sci. 109, 561-567. 6. Rodionov, V.I., Borisy, G.G., 1997. Microtubule treadmilling in vivo. Science. 275, 215218. https://doi.org/10.1126/science.275.5297.215. 7. Keating, T.J., Peloquin, J.G., Rodionov, V.I., Momcilovic, D., 1997. Microtubule release from the centrosome. Proc. Natl. Acad. Sci. USA. 94, 5078-5083. https://doi.org/10.1073/pnas.94.10.5078. 8. Roll-Mecak, A., McNally, F.J., 2010. Microtubule-severing enzymes. Curr. Opin. Cell Biol. 22, 96-103. https://doi.org/10.1016/j.ceb.2009.11.001. 9. Yu, W., Solowska, J.M., Qiang, L., Karabay, A., Baird, D., Baas, P.W., 2005. Regulation of microtubule severing by Katanin subunits during neuronal development. J. Neurosci. 25, 5573-83. https://doi.org/10.1523/JNEUROSCI.0834-05.2005. 10. Karabay, A., Yu, W., Solowska, J.M., Baird, D.H., Baas, P.W., 2004. Axonal growth is sensitive to the levels of Katanin, a protein that severs microtubules. J. Neurosci. 24, 577888. https://doi.org/10.1523/JNEUROSCI.1382-04.2004. 11. Vogelstein, B., Lane, D., Levine, A.J., 2000. Surfing the p53 network. Nature. 408, 30710. https://doi.org/10.1038/35042675. 12. Vousden, K.H., Lu, X., 2002. Live or let die: the cell's response to p53. Nat. Rev. Cancer. 2, 594-604. https://doi.org/10.1038/nrc864. 13. Hudson, C.D., Morris, P.J., Latchman, D.S., Budhram-Mahadeo, V.S., 2005. Brn-3a transcription factor blocks p53-mediated activation of proapoptotic target genes Noxa and Bax in vitro and in vivo to determine cell fate. J. Biol. Chem. 280, 11851-8. https://doi.org/10.1074/jbc.M408679200. 14. Riley, T., Sontag, E., Chen, P., Levine, A., 2008. Transcriptional control of human p53regulated genes. Nat. Rev. Mol. Cell Biol. 9, 402-12. https://doi.org/10.1038/nrm2395. 15. el-Deiry, W.S., Kern, S.E., Pietenpol, J.A., Kinzler, K.W., Vogelstein, B., 1992. Definition of a consensus binding site for p53. Nat. Genet. 1, 45-9. https://doi.org/10.1038/ng049245.
16. Funk, W.D., Pak, D.T., Karas, R.H., Wright, W.E., Shay, J.W., 1992. A transcriptionally active DNA-binding site for human p53 protein complexes. Mol. Cell Biol. 12, 2866-71. https://doi.org/10.1128/MCB.12.6.2866. 17. Chène, P., 2001. Targeting p53 in cancer. Curr. Med. Chem. Anticancer Agents. 1, 15161. https://doi.org/10.2174/1568011013354741. 18. Inga, A., Storici, F., Darden, T.A., Resnick, M.A., 2002. Differential transactivation by the p53 transcription factor is highly dependent on p53 level and promoter target sequence. Mol. Cell Biol. 22, 8612-25. https://doi.org/10.1128/MCB.22.24.8612-8625.2002. 19. Jordan, J.J., Menendez, D., Inga, A., Noureddine, M., Bell, D.A., Resnick, M.A., 2008. Noncanonical DNA motifs as transactivation targets by wild type and mutant p53. PLoS Genet. 4, e1000104. https://doi.org/10.1371/journal.pgen.1000104. 20. Osada, M., Park, H.L., Nagakawa, Y., Yamashita, K., Fomenkov, A., Kim, M.S., Wu, G., Nomoto, S., Trink, B., Sidransky, D., 2005. Differential recognition of response elements determines target gene specificity for p53 and p63. Mol. Cell Biol. 25, 6077-89. https://doi.org/10.1128/MCB.25.14.6077-6089.2005. 21. Eom, H.S., Park, H.R., Jo, S.K., Kim, Y.S., Moon, C., Jung, U., 2015. Ionizing radiation induces neuronal differentiation of Neuro-2a cells via PI3-kinase and p53-dependent pathways. Int. J. Radiat. Biol. 91, 585-95. https://doi.org/10.3109/09553002.2015.1029595. 22. Di Giovanni, S., Rathore, K., 2012. p53-Dependent pathways in neurite outgrowth and axonal regeneration. Cell Tissue Res. 349, 87-95. https://doi.org/10.1007/s00441-0111292-5. 23. Korulu, S., Yildiz-Unal, A., Yuksel, M., Karabay, A., 2013. Protein kinase C activation causes neurite retraction via cyclinD1 and p60-Katanin increase in rat hippocampal neurons. Eur. J. Neurosci. 37, 1610-9. https://doi.org/10.1111/ejn.12185. 24. Kelle, D., Kırımtay, K., Selçuk, E., Karabay, A., 2019. Elk1 affects Katanin and Spastin proteins via differential transcriptional and post-transcriptional regulations. PLoS One. 14, e0212518. https://doi.org/10.1371/journal.pone.0212518. 25. Gjoerup, O., Zaveri, D., Roberts, T.M., 2001. Induction of p53 independent apoptosis by simian virus 40 small t antigen. J Virol. 75, 9142-55. https://doi.org/10.1128/JVI.75.19.9142-9155.2001. 26. Schmittgen, T.D., Livak, K.J., 2008. Analyzing real-time PCR data by the comparative C (T) method. Nat. Protoc. 3, 1101-1108. https://doi.org/10.1038/nprot.2008.73. 27. Borgatti, P., Mazzoni, M., Carini, C., Neri, L.M., Marchisio, M., Bertolaso, L., Previati, M., Zauli, G., Capitani, S., 1996. Changes of nuclear protein kinase C activity and isotype composition in PC12 cell proliferation and differentiation. Exp. Cell Res. 224, 72-8. https://doi.org/10.1006/excr.1996.0112. 28. Bargonetti, J., Manfredi, J.J., 2002. Multiple roles of the tumor suppressor p53. Curr. Opin. Oncol. 14, 86-91. 29. Ye, S., Shen, J., Choy, E., Yang, C., Mankin, H., Hornicek, F., Duan, Z., 2016. p53 overexpression increases chemosensitivity in multidrug-resistant osteosarcoma cell lines. Cancer Chemother. Pharmacol. 77, 349-56. https://doi.org/10.1007/s00280-015-2944-z. 30. Kubbutat, M.H., Jones, S.N., Vousden, K.H., 1997. Regulation of p53 stability by Mdm 2. Nature. 387, 299-303. https://doi.org/10.1038/387299a0.
31. Sudo, H., Baas, P.W., 2011. Strategies for diminishing Katanin-based loss of microtubules in tauopathic neurodegenerative diseases. Hum. Mol. Genet. 20, 763-78. https://doi.org/10.1093/hmg/ddq521. 32. Galmarini, C.M., Kamath, K., Vanier-Viornery, A., Hervieu, V., Peiller, E., Falette, N., Puisieux, A., Ann Jordan, M., Dumontet, C., 2003. Drug resistance associated with loss of p53 involves extensive alterations in microtubule composition and dynamics. Br. J. Cancer. 88, 1793-9. https://doi.org/10.1038/sj.bjc.6600960. 33. Wu, X., Shen, Y., 2018. PMN inhibits colorectal cancer cells through inducing mitotic arrest and p53-dependent apoptosis via the inhibition of tubulin polymerization. Biochem. Biophys. Res. Commun. 499, 927-933. https://doi.org/10.1016/j.bbrc.2018.04.021.
Abbreviations: AAA, ATPases Associated with various cellular Activities; RE, Response element; PKC-, Protein kinase C-alpha; EMSA, Electrophoretic mobility shift assay; Mut, Mutated; MAPs, microtubule-associated proteins.
p53 Regulates Katanin-p60 Promoter Highlights p53 binds to the promoter of KATNA1 gene. p53 upregulates katanin-p60 expression. Cellular stress promotes KATNA1 expression upon p53 induction. p53 knockdown reduces KATNA1 expression. p53 upregulated katanin-p60 causes distruption of microtubules. p53 and katanin-p60 proteins are maintained in balanced levels within cells. FIGURE LEGEND
Figure 1: KATNA1 fragments containing putative regulatory elements and p53 binding site. The binding site of p53 is located in the region from -117 to -95 in KATNA1 promoter. Underlined CAAG repeats are the core elements for p53 binding. Indicated promoter, 5’ UTR, and promoter + 5’ UTR deletion constructs were used in the luciferase reporter assay.
Figure 2. Luciferase reporter assay results for functional analysis of KATNA1 regulatory regions in HCT 116 WT and HCT 116 p53 (-/-) cells. (A) The graph represents activities of KATNA1 regulatory regions in HCT 116 WT cells (n=3). (B) The graph represents activities of KATNA1 regulatory regions in HCT 116 p53 (-/-) cells (n=3). (C) The graph represents activity of each KATNA1 regulatory region comparing HCT 116 WT and HCT 116 p53 (-/-) cells.
Figure 2. Luciferase reporter assay results for functional analysis of KATNA1 regulatory regions in HCT 116 cells (n=3). The luminometric measurements indicating activities of The graphs represent activities of KATNA1 regulatory regions are shown by comparing HCT 116 WT and HCT 116 p53 (-/-) cells.
Figure 3. qRT-PCR results indicating endogenous KATNA1 mRNA level in HCT 116 WT and HCT 116 p53 (-/-) cells (n=5). The level of endogenous KATNA1 mRNA was compared between in HCT 116 WT and HCT 116 p53 (-/-) cells.
Figure 4. EMSA results for in vitro confirmation of p53 binding. The reactions including either WT-oligo (lane 1) or Mut-oligo (lane 3) without total cell lysate were used as negative controls. Shift band is detectable in WT-oligo and cell lysate included reaction as indicated by an arrow (lane 2). Mut-oligo and cell lysate included reaction is indicated in lane 4. Competition reaction, which was comprised of unlabeled WT-oligo within excess amount and labeled Mut oligo, is displayed in lane 5.
Figure 5. ChIP results for in vivo confirmation of p53 binding. H3 (positive control, lane 2), IgG (negative control, lane 3), beads only (negative control, lane 4), and p53 precipitated reaction (lane 5) and also 2% input DNA (lane 1) had been amplified using specific primers targeting p53 binding site included fragment.
Figure 6. Western blot results of for checkingconfirming p53 overexpression control in HCT 116 WT and HCT 116 p53 (-/-) cells (n=2). (A) FLAG-tag antibody was used to identify p53 overexpression. β-Actin was used as the loading control. “Control” represents untransfected and “p53” represents untransfected and p53 overexpressing cell for both HCT 116 WT and HCT 116 p53 (-/-), respectively. (B) The band density analysis of p53 overexpression level for HCT 116 WT and HCT 116 p53 (-/-) cells is
shown.Lane 1 represents control (untransfected) HCT 116 WT cells, while lane 2 indicates p53 overexpressinged HCT 116 WT cells. Control HCT 116 p53 (-/-) cells and p53 overexpressinged HCT 116 p53 (-/-) cells are shown in lane 3 and 4, respectively. (B) The graph represents overexpression level of p53 in HCT 116 p53 (-/-) cells and HCT 116 WT cells.
Figure 7. qRT-PCR results indicating KATNA1 mRNA level in p53 overexpressed HCT 116 cells under untransfected and p53 transfected conditions WT and HCT 116 p53 (-/-) cells (n=4). The differences of KATNA1 mRNA level between untransfected (control) and p53 overexpressing (p53) cells are shown for both HCT 116 WT and HCT 116 p53 (-/-) cells. The ACTB and GAPDH were used as internal control. The values were normalized to untransfected control cells. The graph represents fold change of KATNA1 mRNA levels in p53 overexpressed cells compared to control cells.
Figure 8. Western blot results of Katanin-p60 level in HCT 116 WT and HCT 116 p53 (-/-) cells (n=2). under untransfected (cControl indicates) untransfected and p53 indicates overexpression by transfectedion (p53) conditions (n=2).Western blot results of Katanin-p60 level in p53 overexpressed HCT 116 WT and HCT 116 p53 (-/-) cells (n=2). (A) Western blot images represent Katanin-p60 and β -actin protein levels in HCT 116 WT and HCT 116 p53 (-/-) cells comparatively to controls. (B) The graph displays fold change Densitometric analysis of Katanin-p60 level in for HCT 116 WT and HCT 116 p53 (-/-) cells was obtained by normalizing Katanin-p60 level to β -actin level. The fold change in Katanin-p60 level over the control was plotted.
Figure 9. ICC results of p53 overexpressing HCT 116 p53 (-/-) cells. Overexpression of p53 increases Katanin-p60 protein level and results in shortened microtubules and disruption of cell morphology. Images were taken using 63X objective at zoom 3.
Figure 910:. Western blot results of p53 levels in CoCl2 treated HCT 116 WT and HCT 116 p53 (-/-) cells (n=2). (A) Western blot images represent p53 and Vinculin protein levels in both HCT 116 WT and HCT 116 p53 (-/-) cells treated with different CoCl2 concentrations (100, 200 and 400 M). p53 antibody was used to identify p53 level and Vinculin was used as a loading control. (B) The The graph displays fold changes of p53 protein level upon increasing concentrations of CoCl2 in HCT 116 WT cells were obtained by normalizing to Vinculin level and then compared to untreated control cells.
Figure 11. Western blot results of Katanin-p60 level in CoCl2 treated HCT 116 WT cells (n=3) and HCT 116 p53 (-/-) cells (n=2). Western blot images represent Katanin-p60 and Vinculin protein levels in cells treated with different CoCl2 concentrations. Vinculin was used as a loading control. The graph displays fold change ofThe fold changes in Katanin-p60 level upon increasing concentrations of CoCl2 in (A) HCT 116 WT cells and (B) HCT 116 p53 (-/-) cells were shown by comparinged to untreated control cells.
Figure 12. TP53 mRNA and p53 protein levels upon p53 knockdown in HCT 116 WT cells (n=2). (A) qRT-PCR result indicates TP53 mRNA level in p53 shRNA transfected cells compared to control cells. (B) Western blot result represents p53 and GAPDH protein levels in control and p53 shRNA transfected cells. GAPDH was used as a loading control.
Figure 13. qRT-PCR results indicating KATNA1 mRNA levels upon p53 knockdown in HCT 116 cells (n=2). (A) KATNA1 mRNA level in p53 shRNA transfected (A) HCT 116 WT and (B) HCT 116 p53 (/-) cells compared to control cells. (B) KATNA1 mRNA level in p53 shRNA transfected HCT 116 p53 (-/-) cells compared to control cells.
Figure 12. qRT-PCR results indicating TP53 and KATNA1 mRNA levels upon p53 knockdown (n=2). (A) The graph represents the fold change of TP53 mRNA in p53 shRNA transfected HCT 116 WT cells compared to control cells. (B) The graph represents the fold change of KATNA1 mRNA in p53 shRNA transfected HCT 116 WT cells compared to control cells. (C) The graph represents the fold change of KATNA1 mRNA in p53 shRNA transfected HCT 116 p53 (-/-) cells compared to control cells.
Figure 13. Western blot results of p53 protein level in HCT 116 WT cells upon p53 knockdown (n=2). (A) Western blot images represent p53 and GAPDH protein levels in control (lane 1) and p53 shRNA transfected cells (lane 2). GAPDH was used as a loading control. (B) The graph displays fold change of p53 protein in p53 shRNA transfected HCT 116 WT cells compared to control cells.
Figure 14. Western blot results of Katanin-p60 protein level in HCT 116 WT cells upon p53 knockdown (n=2). (A) Western blot images represent Katanin-p60 and GAPDH protein levels in control (lane 1) and p53 knockdown cells (lane 2). GAPDH was used as a loading control. (B) The graph displays fold change of Katanin-p60 protein in p53 shRNA transfected HCT 116 WT cells compared to control cells.
Figure 15. Western blot results of Katanin-p60 protein level in HCT 116 p53 (-/-) cells upon p53 knockdown (n=2). (A) Western blot images represent Katanin-p60 and GAPDH protein levels in control (lane 1) and p53 shRNA transfected cells (lane 2). GAPDH was used as a loading control. (B) The graph displays fold change of Katanin-p60 protein in p53 shRNA transfected HCT 116 p53 (-/-) cells compared to control cells.
Figure 14. Western blot results of Katanin-p60 protein levels in HCT 116 WT and HCT 116 p53 (-/-) cells upon p53 knockdown (n=2). Western blot images represent Katanin-p60 and GAPDH protein levels in control and p53 knockdown cells. The The graph displays fold change of Katanin-p60 protein in p53 shRNA transfected (A) HCT 116 WT cells and (B) HCT 116 p53 (-/-) cells was demonstrated by comparinged to control cells. GAPDH was used as a loading control.
Table 1: Sequence of qRT-PCR primers used for investigation of KATNA1 and TP53 expression Probe No
Primer
Primer sequence
Katanin-p60-L
5'-GCGGACATTACCAACGTGT-3'
Katanin-p60-R
5'-CATGTGCATTTCTTCTTTGGAA-3'
p53-L
5’ AGGCCTTGGAACTCAAGGAT 3’
p53-R
5’ CCCTTTTTGGACTTCAGGTG 3’
UPL 6
UPL 12