- Email: [email protected]
Pancreatic Islet Derived Stem Cells Can Express Co-stimulatory Molecules of Antigen-Presenting Cells
Pancreatic Islet Derived Stem Cells Can Express Co-stimulatory Molecules of Antigen-Presenting Cells E. Karaoz, A. Okçu, O. Saglam, Z. Seda Genc, S. Ayhan, and M. Kasap ABSTRACT Background. Antigen-presenting cells (APCs) are crucial intermediates in the generation of both innate and specific immune responses. It has long been understood that some APCs are resident in islets in situ as well as after isolation. Our aim was to investigate the presence of molecules involved in antigen presentation in rat pancreatic islet-derived stem cells (PI-SCs). Methods. We used immunocytochemistry and reverse transcription polymenzation chain reaction to study immunophenotypic characteristics; pluripotent-related gene expressions; transcripts coding for antigen-presenting surface proteins CD40, CD80, CD86; and major histocompatibility complex class II in addition to genes with known antiapoptotic functions including mitogen-activated protein kinase-activated protein kinase 2 (MAPKAPK2), tumor necrosis factor alpha-induced protein 3 (TNFAIP3) interacting protein 1 (TNIP1) and BCL3 of the PI-SCs. Results. Rat PI-SCs were negative for CD45 as demonstrated by flow cytometry and for CD31, CD34, and CD71 as demonstrated by immunocytochemistry. Therefore, there was no evidence of hematopoietic precursors in the cultures. OCT4, SOX2, and REX1 were expressed by rat PI-SCs. We determined the expression of genes for antigen-presenting surface proteins CD40 and CD80, and genes with known antiapoptotic functions including MAPKAPK2, TNIP1 and BCL3, besides the surface protein, CD80, by flow cytometry. Conclusion. Expression of these genes by rat PI-SCs implied that they could be involved in the regulation of immunity in islets, highlighting the influence of protective role-playing antiapoptotic mechanisms on pancreatic islet cells. This study offers the potential to understand the molecular mechanisms of a devastating disease, type-1 diabetes mellitus. ECENT STUDIES have suggested that mesenchymal stem cells (MSCs) possessed the dual ability to suppress and/or activate immune responses depending on the stimulus. Ex vivo-expanded MSCs isolated from various species, including humans, have been shown to suppress a broad range of immune cells, including Tcells,1–3 natural killer (NK), cells3 and B elements.4 MSCs have also been demonstrated to display profound inhibitory effects on the regeneration and function of both CD34⫹-derived and monocyte-derived dentritic cells, indicating that they are able to modulate immune responses at multiple levels.5 However, at least three independent groups have shown that interferon-␥-stimulated MSCs act as antigen-presenting cells (APCs) for immune responses.6 – 8 This information agrees with the knowledge of the presence of APCs within islets. They are believed to be responsible for the develop-
R
ment of type 1 diabetes via presentation of -cell-derived peptides to immune cells.9 –11 Therefore, we investigated the presence of transcripts coding for antigen-presenting surface proteins CD40, CD80, CD86, and major histocompatibility complex (MHC) class II products in addition to
From the Center for Stem Cell and Gene Therapies Research and Practice, Institute of Health Sciences, Department of Stem Cell, Kocaeli University, Kocaeli, Turkey. This study was supported by grants [107S276] of the Scientific and Research Council of Turkey (TUBITAK) and [2009/01] Turkish Diabetes Foundation. Address reprint requests to Erdal Karaoz, PhD, Center for Stem Cell and Gene Therapies, Research and Practice, Institue of Health Sciences, Department of Stem Cell Kocaeli University, 41380, Turkey. E-mail: [email protected]
© 2010 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
0041-1345/–see front matter doi:10.1016/j.transproceed.2010.07.093
Transplantation Proceedings, 42, 3663–3670 (2010)
3663
3664
KARAOZ, OKCU, SAGLAM ET AL
genes with known antiapoptotic functions including mitogenactivated protein kinase-activated protein kinase factor (MAPKAPK2), tumor necrosis factor (TNF), TNF alphainduced protein 3 interacting protein 1 (TNIP1) and BCL3.
MATERIALS AND METHODS Animals Wistar rats (8 weeks old) obtained from our Experimental Animal Center were handled in accord with our institutional guidelines and national animal welfare. They were housed under standard conditions for a week prior to use.
Isolation of Islets Isolated islets were cultured as described previously12 with viability assessed with fluorescein diacetate (Sigma-Aldich, St Louis, Mo, USA) and propidium iodide (Sigma- Aldich) staining as reported by Dellê et al.13 No nonislet tissue remained as demonstrated by 100% staining.
Culture of Rat Pancreatic Islet-Derived Stem Cells The rat pancreatic islet-derived stem cells (rPI-SCs) were isolated from the fresh islets cultivated for 13 to 15 days in vitro as described in Karaoz et al12 according to their surface adhesion.
Flow Cytometry The flow cytometry analyses were performed according to the method described previously.12,14 Immunophenotyping of rPI-SCs was performed with antibodies against the following rat antigens: CD29 (integrin 1 chain; Ha2/5; fluorescein isothiocyanate [FITC]), CD45, CD90 (Thy-1/Thy-1.1-FITC), CD80 and CD86 as well as their isotype controls (IgG2aK; FITC, IgG1K phycoerythrin, IgG1K FITC; BD Biosciences, San Diego, Calif, USA).
Immunohistochemistry Immunofluoresence and immunocytochemistry analyses were performed according to a previous report,12,14 using primary antibodies indicated in Table 1. Cells counterstained with hematoxylin (Santa Cruz Biotechnology, Santa Cruz, Calif, USA) were examined under a light/fluorescence microscope (Leica DMI 4000B, Wetzlar, Germany).
Reverse-Transcription Polymerase Chain Reaction Total RNA isolated from 3 ⫻ 106 stem cells derived from rat pancreatic islets at passage 4 (P4) using the High Pure RNA Isolation Kit (Roche, Mannheim. Germany) was reverse-transcribed into cDNA using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) according to the kit manuals. For second-strand synthesis, polymerase chain reaction (PCR) was performed with a PCR enzyme mix (Fermentas, Vilnius, Lithuania). The primer sequences and annealing temperatures for each pair are listed in Table 2. PCR products were analyzed by gel electrophoresis on 2% agarose.
Table 1. Immunocytochemical Properties of Rat Pancreatic Islet-Derived Stem Cells (rPI-SCs) Antibody/marker
Dilution
Source
rPI-SCs (Passage 3) Detection
CD 31/PECAM-1 (M-20) CD34 (C-18) CD45 (H-230) CD71 (K-20) CD105/Endoglin (M-20) c-Fos (4) Collagen II Ab-2 (2B1.5) Collagen Ia1 (D-13) -Tubulin (KMX-1) -Tubulin Nestin (Rat-401) Vimentin (C-20) Desmin (H-76) Desmin Ab1 (D33) Fibronectin (EP5) ␣-smooth muscle actin Ab-1 Actin (C-2) Glut2 (H-7) Insulin (H-86) Glucagon (N-17) Somatostatin (D-20) Somatostatin Ab-1 C-Peptide PDX-1 Cytokeratin 19 Cytokeratin 18 PCNA Ki67 BrdU
1:100 1:150 1:150 1:150 1:100 1:50 Prediluted 1:50 1:50 Prediluted 1:50 1:100 1:50 Prediluted 1:100 1:800 1:50 1:50 1:50 1:50 1:50 Prediluted 1:100 1:50 1:50 1:50 1:300 1:200 1:500
Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Thermo Scientific Santa Cruz Biotechnology Chemicon International Thermo Scientific Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Thermo Scientific Santa Cruz Biotechnology Thermo Scientific Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Thermo Scientific Cell Signaling Technology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Thermo Scientific Abcam Thermo Scientific
⫺ ⫺ ⫺ ⫺ ⫹ ⫹ ⫹ ⫺/⫹ ⫹
⫹, positive marker expression; ⫺, lack of marker expression; ⫺/⫹, weak marker expression.
⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫹ ⫹ ⫹
PANCREATIC ISLET-DERIVED STEM CELLS
3665
Table 2. Expression of Markers of Different Lineages by Rat Pancreatic Islet-Derived Stem Cells (rPI-SCs) Assessed by Reverse Transcription Polymerase Chain Reaction Gene Name
Gen Bank
GAPDH
NM_017008
Rex1
NM_001012114
Sox2
NM_001109181
Oct4
EU419996
ACTA2
NM_031004
ACTb
NM_031144
Desmin
NM_022531
Nestin
NM_012987
c-Fos
X06769
Vimentin
NM_031140
Mapkapk2
NM_178102
MHC II
NM_001101017
CD40
NM_134360
CD80
NM_012926
CD86
NM_020081
IL6R
NM_017020
Tnip1
NM_001108826
Bcl3
NM_001109422
Ncf1
NM_053734
Cx3cr1
NM_133534
Primer Sequences (forward; reverse)
T Annealing (°C)
Exp. in rPI-SCs
CACCCTGTTGCTGTAGCCATATTC GACATCAAGAAGGTGGTGAAGCAG CACAAGCATGGATGATGATGA TGATGGCTTTGAGCTATCCAC ATGATGGAGACGGAGCTGAA GCTTGCTGATCTCCGAGTTG GCCGTGAAGTTGGAGAAGGT TCACACGGTTCTCAATGCTAGTC GTGTGAAGAGGAAGACAGCACA TCGTCCCAGTTGGTGATGAT ACCCGCGAGTACAACCTTCT CTTCTGACCCATACCCACCA GACGCAGTGAACCAGGAGTT TTGGTGAGGACCTCCACTTG GTGGCTCACATGGAAAGCTC CCACAGCCAGCTGGAACTTA GGAGTGGTGAAGACCATGTCA CAACGCAGACTTCTCGTCTTC CTCCAACCGGAGCTATGTGA CTCCTGCAATTCCACCTTCTC GTTCCCTCAGTTCCACGTCA CCATGACAATCAGCAAGCAC GCTCGTGACCAGACACATCTAC TCCAGTCCCCGTTCCTAATA GCCGGGAAACCGACTAGTTA CATCTGCACGACTCCAAAGC CTAACAACTACTCCTTTAGCCTCCT TTGAAGTCTAGTTGGCTACTAATGG TGTCGTCAAGACATGTGTAACCT GCGCCCAAATAGTGTTCGTA TGAGTCCTGGGACCCAAGTT TGCACCACATGCTTTACTCC ACAAGGGATAAAGATGTTAGGAGAG AGTTTCCAATGGTGGTGGTG AGGCCGGAGGCTCTTTACTA GGCTGAGAATTCGGTAGACG GACACCTTCATTCGCCACAT GTGAGGGATGACTCTGTTTTCTG GTCCAAGAGCATCACTGACATC GTAATCACCCAAACATTCGTTG
57
⫹
53
⫹
53
⫹
52
⫹
61
⫹*
54
⫹*
53
⫹*
54
⫹*
59
⫹*
54
⫹*
54
⫹
54
⫺
54
⫹
55
⫹
53
⫺
57
⫹
59
⫹
54
⫹
53
⫹
51
⫹
GAPDH, glyceraldehyde 3-phosphate dehydrogenase; Rex1, RNA exonuclease 1; Sox2, SRY (sex-determining region Y)-box 2; OCT4, POU class 5 homeobox 1; ACTA2, smooth muscle alpha-actin; ACTb, actin beta; Mapkapk2, mitogen-activated protein kinase-activated protein kinase 2; Tnip1, TNFAIP3 interacting protein 1; Bcl3, B-cell CLL/lymphoma 3; Ncf1, neutrophil cytosolic factor 1; Cx3cr1, chemokine (C-X3-C motif) receptor 1. *Cross-confirmed at the protein level by immunolocalization analysis.
RESULTS Light Microscopy of Cultured Islets
Examination of cultured islets under inverted microscopy showed regular structures with no disintegrated islets (Fig 1A-a,b). Cell Cultures of rPI-SCs
Fibroblast-like cells were observed to be growing away from the islets after 2 days of incubation (Fig 1A-a,b,c,d). At around 3 to 4 days of incubation these cells proliferated, reaching 80% confluency after 9 to 11 days of incubation during their initial passages (Fig 1B-a). In later passages,
most cells exhibited large, flattened, or fibroblast-like morphology (Fig 1B).
Flow Cytometric Identification of rPI-SCs
rPI-SCs expressed CD29 and CD90 but not CD45 (Fig 1C). The expression of surface antigens in rPI-SCs agreed with previous reports regarding murine15–17 and human18 –22 pancreatis islet-derived stem cells. They indicated that these elements had the characteristics of stem cells as reported previously.15–18,20,21,23 rPI-SCs expressed CD80 strongly (39.89%) and CD86 weakly (11.51%).
3666
KARAOZ, OKCU, SAGLAM ET AL
Fig 1. Morphology of rat pancreatic islet-derived stem cells (rPI-SCs): rPI-SCs in culture. (A-a) Free-floating rat islets (arrows). (A-b) Rat islets stained with DTZ for specificity (arrows). Fibroblast-like cells (arrows) is observed growing out and away from islet after (I) 2 days (A-c), 5 days (A-d), and 9 days (B-a). After the next passages, most of these stem cells exhibited large, flattened, or fibroblast-like morphology (B-b: P1-day 4; B-c: P8-day 2; B-d: P15-day 1). (C) Representative flow cytometric analysis of cell-surface markers in rPI-SCs at the P5. (Original magnifications: A-d, B-a ⫽ ⫻40; A-c ⫽ ⫻100; A-b, B-b to B-d, ⫽ ⫻200.)
Immunocytochemical Identification of rPI-SCs
The immunocytochemical staining results are shown in Figs 2 and 3. A typical immunoreactivity profile for rPI-SCs at P3 is described in Table 1. Vimentin, one of the most commonly used cytoplasmic marker to define MSCs, was expressed throughout all passages (Fig 2C). Under standard culture conditions with unchanged morphological characteristics; these cells expressed other MSC markers such as CD105/endoglin (Fig 3F) and fibronectin (Fig 2B). rPI-SCs did not express the surface markers of CD31 (endothelial) (Fig 3E), CD34, CD45 (hematopoietic markers), or CD71 (transferin receptor). Nestin expression by islet-derived progenitor or stem cells was used as a marker to define these elements as stem cells (Fig 3A).18,23–28 Cytokeratins (CK) 18 and 19 (Fig 2E) were not expressed by rPI-SCs. Their absence may be critical to show that the pancreatic
islet-derived stem cells do not result from epithelial-tomesenchymal transition.27,28 Gene Expression Profiles of rPI-SCs
Table 2 summarizes the results of the reverse transcription PCR analysis of rPI-SCs. The expression of embryonic stem cell marker genes (REX1, OCT4, SOX2) indicated a selfrenewal capacity. Moreover, SCs were investigated for the presence of antigen-presentating, immunmodulating or suppressing molecules. rPI-SCs was not detected to express the counterligand of CD28 CD86 but did show CD80 (Fig 4). Interestingly, besides CD80, rPI-SCs showed the expression of another costimulatory protein CD40 that is represented on APCs. MAPKAPK2 is related to the kinases that mediate a wide range of biological functions in response to mitogenic and stressful stimuli. TNIP1, the A20-binding inhibi-
PANCREATIC ISLET-DERIVED STEM CELLS
3667
Fig 2. Representative panels of immunofluorescence detection of some markers on rat pancreatic islet-derived stem cells (rPI-SCs). Almost all the rPI-SCs expressed actin (A), fibronectin (B), vimentin (C), and ␣-SMA (F), in the cytoplasm. Stem cells were exhibiting large, flattened, or fibroblast-like morphology and stained negative for PDX-1 (D) and cytokeratin-19 (F). Nuclei were labeled with DAPI (blue). Scale bars ⫽ 50 m.
tor of nuclear factor-kappa B activation 1 (ABIN1), previously known as A20, is another antiapoptotic (stress) gone like MAPKAPK2, which are expressed by the rPI-SCs (Fig
4). In addition, rPI-SCs expressed BCL3, an antiapoptatic gene, and interleukin 6 receptor (IL6R), but failed to express MHC class II molecules (Fig 4). IllR, also known as
Fig 3. Immunophenotype of cultured rat pancreatic islet-derived stem cells (rPI-SCs). Representative staining patterns of third-passage cultures of rPI-SCs were shown for: Nestin (A), -tubulin (B), c-fos (C), ␣-SMA (D), and CD105 (F). The staining for CD31 was not observed (E). Nuclei were counterstained with haematoxylin. Control stains, negative for each protein, were not shown. Scale bars ⫽ 50 m.
3668
KARAOZ, OKCU, SAGLAM ET AL
Fig 4. Representative panel of reverse transcription polymerase chain reaction (PCR) analysis of rat pancreatic islet-derived stem cells. Internal controls: GAPDH and beta actin. Negative control: PCR mix without template.
CD126, is a type I cytokine receptor of interleukin 6 which is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. CX3CR1 is important for immune surveillance and the movement of mononuclear phagocytes in steady-state situation.29 Neutrophil cytosolic factor 1 (NCF1) is a component of the leukocyte NADPH oxidase complex that mediates formation of reactive oxygen intermediates, which play an important role in host defense and autoimmunity.19 CX3CR1 and NCF1 were expressed by rPI-SCs (Fig 4). DISCUSSION
Cultures of rPI-SCs did not contain the hematopoietic precursors, CD45 by flow cytometry or CD31, CD34, and CD71 by immunocytochemistry. In contrast, they expressed surface antigens of murine MSCs consistent with previous reports.15–20,23,24,27 We observed transcripts of OCT4, REX1, and SOX2, which are the master regulators of stem
cell renewal and differentiation genes, to be expressed by rPI-SCs. Without stimulation, rPI-SCs expressed CD80 and CD40, a finding in agreement with that of Klein et al who used total RNA isolated from human and nonhuman primate islets to show the expression of CD40.30 Our data, however, took this observation a step forward by addressing the source of CD40 mRNA, namely, stem cells in pancreatic islets. Despite the expression of CD80, we did not detect the CD86 transcript. Lei et al observed a similar phenomenon, such that murine-derived keratinocyte stem cells (KSCs) expressed CD80, but not CD86, indicating that KSCs could act as APCs.31 The flow cytometry data revealed a weak expression of the surface protein CD86, although its transcription was below the detectable level for cDNA. Constitutive expression of MHC class II molecules is confined to professional APCs of the immune system. In the present study, rPI-SCs did not express MHC class II, which indicated that these cells are nonprofessional APCs.
PANCREATIC ISLET-DERIVED STEM CELLS
CX3CR1 the human receptor for fractalkine,32 is expressed in monocytes as well as subsets of NK cells, dendritic cells, and brain microglial cells in a knockout mouse in which the CX3CR1 gene was replaced by a green fluorescent protein.33 The expression of CX3CR1 in dendritic cells strengthens our hypothesis that stem cells in pancreatic islets are the previously defined dendritic cells of pancreatic islets.10 –12 Genes with known antiapoptotic functions that are expressed under stress include MAPKAPK2, TNIP1, and BCL3. We examined the expression of these genes in stem cells. MAPKAPK2 is a direct substrate of p38 mitogenactivated protein kinase in response to cellular stress such as mechanical, heat shock, osmotic UV irradiation, bacterial lipopolysaccharide, several inflammatory cytokines, and growth factor stimulation.34 TNIP1 was originally described as an antiapoptotic TNF-␣-induced gene in endothelial cells.35 BCL3, in complex with p52, promotes transcription of genes encoding the cell cycle regulator cyclin D1 and the antiapoptotic BCL2 protein.36 The data presented herein showed the expression of all three genes in rPI-SCs. Expression of these genes by rPI-SCs implied a role of rPI-SCs in the regulation of immunity and tissue homeostasis in islets, highlighting antiapoptotic mechanisms that may show protective roles on pancreatic islet cells. Only some cells, mainly hepatocytes and several leukocytes, express IL6R. Surprisingly, stem cells of this study, the receptor for interleukin-6, an inflammatory cytokine with a well-documented role in inflammation and cancer. High levels of interleukin-6 and sIL6R have been reported in several chronic inflammatory and autoimmune diseases.37 Since type 1 diabetes is an autoimmune disease, we hypothesized that IL6R-positive rPI-SCs may have a pivotal role in the pathogenesis of type 1 diabetes. All of the data presented herein raise a major question do stem cells localized in pancreatic islets play a role in the pathogenesis of type 1 diabetes. rPI-SCs play roles in immune system homeostasis, besides regenerative functions. We strongly suggest that unstimulated stem cells in islets may behave as conditional (or facultative) APCs able to activate antigen-specific immune responses. In addition, previous studies have reported defective dentritic cells generation in vitro from bone marrow of NOD mice.38 They suggested that these anomalies potentially contribute to the dysfunctional regulation of tolerance in NOD mice. In light of these findings, we additionally suggest that type 1 diabetes may be a stem cell disease related to their possible role in antigen presentation. Strategies to correct -cell loss in type 1 diabetes should, therefore, target islet derived stem cells to prevent -cell destruction. We consequently suggest that in vivo and in vitro studies genomic-and postgenomiclevel should be performed with pancreatic islet stem cells. ACKNOWLEDGMENT This study was supported by grants (107S276) of the Scientific and Research Council of Turkey (TUBITAK) and Turkish Diabetes
3669 Foundation (2009/01). We thank Ayça Aksoy and Gülay Bayazit for their excellent technical assistance in this study.
REFERENCES 1. Aggarwal S, Pittenger MF: Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105:1815, 2005 2. Sudres M, Norol F, Trenado A, et al: Bone marrow mesenchymal stem cells suppress lymphocyte proliferation in vitro but fail to prevent graft-versus-host disease in mice. J Immunol 2006; 176:7761, 2006 3. Spaggiari GM, Capobianco A, Abdelrazik H, et al: Mesenchymal stem cells inhibit natural killer-cell proliferation, cytotoxicity, and cytokine production: role of indoleamine 2,3-dioxygenase and prostaglandin E2. Blood 111:1327, 2008 4. Comoli P, Ginevri F, Maccario R, et al: Human mesenchymal stem cells inhibit antibody production induced in vitro by allostimulation. Nephrol Dial Transplant 23:1196, 2008 5. Nauta AJ, Kruisselbrink AB, Lurvink E, et al: Mesenchymal stem cells inhibit generation and function of both CD34⫹-derived and monocyte-derived dentritic cells. J Immunol 177:2080, 2006 6. Stagg J, Pommey S, Eliopoulos N, et al: Interferon-gammastimulated marrow stromal cells: a new type of nonhematopoietic antigen-presenting cell. Blood 107:2570, 2006 7. Chan JL, Tang KC, Patel AP, et al: Antigen-presenting property of mesenchymal stem cells occurs during a narrow window at low levels of interferon-gamma. Blood 107:4817, 2006 8. Morandi F, Raffaghello L, Bianchi G: Immunogenicity of human mesenchymal stem cells in HLA-class I-restricted T-cell responses against viral or tumor-associated antigens. Stem Cells 26:1275, 2008 9. Lacy PE, Davie JM, Finke EH: Prolongation of islet allograft survival following in vitro culture (24 degrees C) and a single injection of ALS. Science 204:312, 1979 10. Adorini L: Interleukin 12 and autoimmune diabetes. Nat Genet 27:131, 2001 11. Calderon B, Suri A, Miller MJ, et al: Dendritic cells in islets of Langerhans constitutively present beta cell-derived peptides bound to their class II MHC molecules. Proc Natl Acad Sci USA 105:6121, 2008 12. Karaoz E, Ayhan S, Gacar G, et al: Isolation and characterization of stem cells from pancreatic islet: pluripotency, differentiation potential and ultrastructural characteristics. Cytotherapy 12:288 –302, 2010 13. Dellê H, Saito MH, Yoshimoto PM, et al: The use of iodixanol for the purification of rat pancreatic islets. Transplant Proc 39:467, 2007 14. Karaoz E, Aksoy A, Ayhan S, et al: Characterization of mesenchymal stem cells from rat bone marrow: ultrastructural properties, differentiation potential and immunophenotypic markers. Histochem Cell Biol 132:533, 2009 15. Atouf F, Park CH, Pechhold K, et al: No evidence for mouse pancreatic beta-cell epithelial-mesenchymal transition in vitro. Diabetes 56:699, 2007 16. Chase LG, Ulloa-Montoya F, Kidder BL, et al: Islet-derived fibroblast-like cells are not derived via epithelial-mesenchymal transition from Pdx-1 or insulin-positive cells. Diabetes 56:3, 2007 17. Suzuki A, Nakauchi H, Taniguchi H: Prospective isolation of multipotent pancreatic progenitors using flow-cytometric cell sorting. Diabetes 53:2143, 2004 18. Zhang L, Hong TP, Hu J, et al: Nestin-positive progenitor cells isolated from human fetal pancreas have phenotypic markers identical to mesenchymal stem cells. World J Gastroenterol 11: 2906, 2005 19. Davani B, Ikonomou L, Raaka BM, et al: Human isletderived precursor cells are mesenchymal stromal cells that differentiate and mature to hormone-expressing cells in vivo. Stem Cells 25:3215, 2007
3670 20. Gallo R, Gambelli F, Gava B, et al: Generation and expansion of multipotent mesenchymal progenitor cells from cultured human pancreatic islets. Cell Death Differ 14:1860, 2007 21. Sordi V, Malosio ML, Marchesi F, et al: Bone marrow mesenchymal stem cells express a restricted set of functionally active chemokine receptors capable of promoting migration to pancreatic islets. Blood 106:419, 2005 22. Xiao M, An L, Yang X, et al: Establishing a human pancreatic stem cell line and transplanting induced pancreatic islets to reverse experimental diabetes in rats. Sci China C Life Sci 51:779, 2008 23. Zulewski H, Abraham EJ, Gerlach MJ, et al: Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 50:521, 2001 24. Eberhardt M, Salmon P, von Mach MA, et al: Multipotential nestin and Isl-1 positive mesenchymal stem cells isolated from human pancreatic islets. Biochem Biophys Res Commun 345:1167, 2006 25. Abraham EJ, Kodama S, Lin JC, et al: Human pancreatic islet-derived progenitor cell engraftment in immunocompetent mice. Am J Pathol 164:817, 2004 26. Claiborn KC, Stoffers DA: Toward a cell-based cure for diabetes: advances in production and transplant of beta cells. Mt Sinai J Med 75:362, 2008 27. Gershengorn MC, Geras-Raaka E, Hardikar AA, et al: Are better islet cell precursors generated by epithelial-to-mesenchymal transition? Cell Cycle 4:380, 2005 28. Gershengorn MC, Hardikar AA, Wei C, et al: Epithelial-tomesenchymal transition generates proliferative human islet precursor cells. Science 306:2261, 2004
KARAOZ, OKCU, SAGLAM ET AL 29. Geissmann F, Jung S, Littman DR: Blood monocytes consist of two principal subsets with distinct migratory properties. Immunity 19:71, 2003 30. Klein D, Barbé-Tuana F, Pugliese A, et al: A functional CD40 receptor is expressed in pancreatic beta cells. Diabetologia 48:268, 2005 31. Lei L, Cheng J, Li Y, et al: CD80, but not CD86, express on cultured murine keratinocyte stem cells. Transplant Proc 37:289, 2005 32. Imai T, Hieshima K, Haskell C, et al: Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell 91:521, 1997 33. Jung S, Aliberti J, Graemmel P, et al: Analysis of fractalkine receptor CX(3)CR1 function by targeted deletion and green fluorescent protein reporter gene insertion. Mol Cell Biol 20:4106, 2000 34. Ono K, Han J: The p38 signal transduction pathway: activation and function. Cell Signal 12:1, 2000 35. Opipari AW Jr, Boguski MS, Dixit VM: The A20 cDNA induced by tumor necrosis factor alpha encodes a novel type of zinc finger protein. J Biol Chem 265:14705, 1990 36. Kashatus D, Cogswell P, Baldwin AS: Expression of the Bcl-3 proto-oncogene suppresses p53 activation. Genes Dev 20: 225, 2006 37. Rose-John S, Waetzig GH, Scheller J, et al: The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets 11:613, 2007 38. Nikolic T, Bunk M, Drexhage HA, et al: Bone marrow precursors of nonobese diabetic mice develop into defective macrophage-like dendritic cells in vitro. J Immunol 173:4342, 2004
R
ment of type 1 diabetes via presentation of -cell-derived peptides to immune cells.9 –11 Therefore, we investigated the presence of transcripts coding for antigen-presenting surface proteins CD40, CD80, CD86, and major histocompatibility complex (MHC) class II products in addition to
From the Center for Stem Cell and Gene Therapies Research and Practice, Institute of Health Sciences, Department of Stem Cell, Kocaeli University, Kocaeli, Turkey. This study was supported by grants [107S276] of the Scientific and Research Council of Turkey (TUBITAK) and [2009/01] Turkish Diabetes Foundation. Address reprint requests to Erdal Karaoz, PhD, Center for Stem Cell and Gene Therapies, Research and Practice, Institue of Health Sciences, Department of Stem Cell Kocaeli University, 41380, Turkey. E-mail: [email protected]
© 2010 by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710
0041-1345/–see front matter doi:10.1016/j.transproceed.2010.07.093
Transplantation Proceedings, 42, 3663–3670 (2010)
3663
3664
KARAOZ, OKCU, SAGLAM ET AL
genes with known antiapoptotic functions including mitogenactivated protein kinase-activated protein kinase factor (MAPKAPK2), tumor necrosis factor (TNF), TNF alphainduced protein 3 interacting protein 1 (TNIP1) and BCL3.
MATERIALS AND METHODS Animals Wistar rats (8 weeks old) obtained from our Experimental Animal Center were handled in accord with our institutional guidelines and national animal welfare. They were housed under standard conditions for a week prior to use.
Isolation of Islets Isolated islets were cultured as described previously12 with viability assessed with fluorescein diacetate (Sigma-Aldich, St Louis, Mo, USA) and propidium iodide (Sigma- Aldich) staining as reported by Dellê et al.13 No nonislet tissue remained as demonstrated by 100% staining.
Culture of Rat Pancreatic Islet-Derived Stem Cells The rat pancreatic islet-derived stem cells (rPI-SCs) were isolated from the fresh islets cultivated for 13 to 15 days in vitro as described in Karaoz et al12 according to their surface adhesion.
Flow Cytometry The flow cytometry analyses were performed according to the method described previously.12,14 Immunophenotyping of rPI-SCs was performed with antibodies against the following rat antigens: CD29 (integrin 1 chain; Ha2/5; fluorescein isothiocyanate [FITC]), CD45, CD90 (Thy-1/Thy-1.1-FITC), CD80 and CD86 as well as their isotype controls (IgG2aK; FITC, IgG1K phycoerythrin, IgG1K FITC; BD Biosciences, San Diego, Calif, USA).
Immunohistochemistry Immunofluoresence and immunocytochemistry analyses were performed according to a previous report,12,14 using primary antibodies indicated in Table 1. Cells counterstained with hematoxylin (Santa Cruz Biotechnology, Santa Cruz, Calif, USA) were examined under a light/fluorescence microscope (Leica DMI 4000B, Wetzlar, Germany).
Reverse-Transcription Polymerase Chain Reaction Total RNA isolated from 3 ⫻ 106 stem cells derived from rat pancreatic islets at passage 4 (P4) using the High Pure RNA Isolation Kit (Roche, Mannheim. Germany) was reverse-transcribed into cDNA using the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) according to the kit manuals. For second-strand synthesis, polymerase chain reaction (PCR) was performed with a PCR enzyme mix (Fermentas, Vilnius, Lithuania). The primer sequences and annealing temperatures for each pair are listed in Table 2. PCR products were analyzed by gel electrophoresis on 2% agarose.
Table 1. Immunocytochemical Properties of Rat Pancreatic Islet-Derived Stem Cells (rPI-SCs) Antibody/marker
Dilution
Source
rPI-SCs (Passage 3) Detection
CD 31/PECAM-1 (M-20) CD34 (C-18) CD45 (H-230) CD71 (K-20) CD105/Endoglin (M-20) c-Fos (4) Collagen II Ab-2 (2B1.5) Collagen Ia1 (D-13) -Tubulin (KMX-1) -Tubulin Nestin (Rat-401) Vimentin (C-20) Desmin (H-76) Desmin Ab1 (D33) Fibronectin (EP5) ␣-smooth muscle actin Ab-1 Actin (C-2) Glut2 (H-7) Insulin (H-86) Glucagon (N-17) Somatostatin (D-20) Somatostatin Ab-1 C-Peptide PDX-1 Cytokeratin 19 Cytokeratin 18 PCNA Ki67 BrdU
1:100 1:150 1:150 1:150 1:100 1:50 Prediluted 1:50 1:50 Prediluted 1:50 1:100 1:50 Prediluted 1:100 1:800 1:50 1:50 1:50 1:50 1:50 Prediluted 1:100 1:50 1:50 1:50 1:300 1:200 1:500
Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Thermo Scientific Santa Cruz Biotechnology Chemicon International Thermo Scientific Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Thermo Scientific Santa Cruz Biotechnology Thermo Scientific Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Thermo Scientific Cell Signaling Technology Santa Cruz Biotechnology Santa Cruz Biotechnology Santa Cruz Biotechnology Thermo Scientific Abcam Thermo Scientific
⫺ ⫺ ⫺ ⫺ ⫹ ⫹ ⫹ ⫺/⫹ ⫹
⫹, positive marker expression; ⫺, lack of marker expression; ⫺/⫹, weak marker expression.
⫹ ⫹ ⫹ ⫹ ⫹ ⫹ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫺ ⫹ ⫹ ⫹
PANCREATIC ISLET-DERIVED STEM CELLS
3665
Table 2. Expression of Markers of Different Lineages by Rat Pancreatic Islet-Derived Stem Cells (rPI-SCs) Assessed by Reverse Transcription Polymerase Chain Reaction Gene Name
Gen Bank
GAPDH
NM_017008
Rex1
NM_001012114
Sox2
NM_001109181
Oct4
EU419996
ACTA2
NM_031004
ACTb
NM_031144
Desmin
NM_022531
Nestin
NM_012987
c-Fos
X06769
Vimentin
NM_031140
Mapkapk2
NM_178102
MHC II
NM_001101017
CD40
NM_134360
CD80
NM_012926
CD86
NM_020081
IL6R
NM_017020
Tnip1
NM_001108826
Bcl3
NM_001109422
Ncf1
NM_053734
Cx3cr1
NM_133534
Primer Sequences (forward; reverse)
T Annealing (°C)
Exp. in rPI-SCs
CACCCTGTTGCTGTAGCCATATTC GACATCAAGAAGGTGGTGAAGCAG CACAAGCATGGATGATGATGA TGATGGCTTTGAGCTATCCAC ATGATGGAGACGGAGCTGAA GCTTGCTGATCTCCGAGTTG GCCGTGAAGTTGGAGAAGGT TCACACGGTTCTCAATGCTAGTC GTGTGAAGAGGAAGACAGCACA TCGTCCCAGTTGGTGATGAT ACCCGCGAGTACAACCTTCT CTTCTGACCCATACCCACCA GACGCAGTGAACCAGGAGTT TTGGTGAGGACCTCCACTTG GTGGCTCACATGGAAAGCTC CCACAGCCAGCTGGAACTTA GGAGTGGTGAAGACCATGTCA CAACGCAGACTTCTCGTCTTC CTCCAACCGGAGCTATGTGA CTCCTGCAATTCCACCTTCTC GTTCCCTCAGTTCCACGTCA CCATGACAATCAGCAAGCAC GCTCGTGACCAGACACATCTAC TCCAGTCCCCGTTCCTAATA GCCGGGAAACCGACTAGTTA CATCTGCACGACTCCAAAGC CTAACAACTACTCCTTTAGCCTCCT TTGAAGTCTAGTTGGCTACTAATGG TGTCGTCAAGACATGTGTAACCT GCGCCCAAATAGTGTTCGTA TGAGTCCTGGGACCCAAGTT TGCACCACATGCTTTACTCC ACAAGGGATAAAGATGTTAGGAGAG AGTTTCCAATGGTGGTGGTG AGGCCGGAGGCTCTTTACTA GGCTGAGAATTCGGTAGACG GACACCTTCATTCGCCACAT GTGAGGGATGACTCTGTTTTCTG GTCCAAGAGCATCACTGACATC GTAATCACCCAAACATTCGTTG
57
⫹
53
⫹
53
⫹
52
⫹
61
⫹*
54
⫹*
53
⫹*
54
⫹*
59
⫹*
54
⫹*
54
⫹
54
⫺
54
⫹
55
⫹
53
⫺
57
⫹
59
⫹
54
⫹
53
⫹
51
⫹
GAPDH, glyceraldehyde 3-phosphate dehydrogenase; Rex1, RNA exonuclease 1; Sox2, SRY (sex-determining region Y)-box 2; OCT4, POU class 5 homeobox 1; ACTA2, smooth muscle alpha-actin; ACTb, actin beta; Mapkapk2, mitogen-activated protein kinase-activated protein kinase 2; Tnip1, TNFAIP3 interacting protein 1; Bcl3, B-cell CLL/lymphoma 3; Ncf1, neutrophil cytosolic factor 1; Cx3cr1, chemokine (C-X3-C motif) receptor 1. *Cross-confirmed at the protein level by immunolocalization analysis.
RESULTS Light Microscopy of Cultured Islets
Examination of cultured islets under inverted microscopy showed regular structures with no disintegrated islets (Fig 1A-a,b). Cell Cultures of rPI-SCs
Fibroblast-like cells were observed to be growing away from the islets after 2 days of incubation (Fig 1A-a,b,c,d). At around 3 to 4 days of incubation these cells proliferated, reaching 80% confluency after 9 to 11 days of incubation during their initial passages (Fig 1B-a). In later passages,
most cells exhibited large, flattened, or fibroblast-like morphology (Fig 1B).
Flow Cytometric Identification of rPI-SCs
rPI-SCs expressed CD29 and CD90 but not CD45 (Fig 1C). The expression of surface antigens in rPI-SCs agreed with previous reports regarding murine15–17 and human18 –22 pancreatis islet-derived stem cells. They indicated that these elements had the characteristics of stem cells as reported previously.15–18,20,21,23 rPI-SCs expressed CD80 strongly (39.89%) and CD86 weakly (11.51%).
3666
KARAOZ, OKCU, SAGLAM ET AL
Fig 1. Morphology of rat pancreatic islet-derived stem cells (rPI-SCs): rPI-SCs in culture. (A-a) Free-floating rat islets (arrows). (A-b) Rat islets stained with DTZ for specificity (arrows). Fibroblast-like cells (arrows) is observed growing out and away from islet after (I) 2 days (A-c), 5 days (A-d), and 9 days (B-a). After the next passages, most of these stem cells exhibited large, flattened, or fibroblast-like morphology (B-b: P1-day 4; B-c: P8-day 2; B-d: P15-day 1). (C) Representative flow cytometric analysis of cell-surface markers in rPI-SCs at the P5. (Original magnifications: A-d, B-a ⫽ ⫻40; A-c ⫽ ⫻100; A-b, B-b to B-d, ⫽ ⫻200.)
Immunocytochemical Identification of rPI-SCs
The immunocytochemical staining results are shown in Figs 2 and 3. A typical immunoreactivity profile for rPI-SCs at P3 is described in Table 1. Vimentin, one of the most commonly used cytoplasmic marker to define MSCs, was expressed throughout all passages (Fig 2C). Under standard culture conditions with unchanged morphological characteristics; these cells expressed other MSC markers such as CD105/endoglin (Fig 3F) and fibronectin (Fig 2B). rPI-SCs did not express the surface markers of CD31 (endothelial) (Fig 3E), CD34, CD45 (hematopoietic markers), or CD71 (transferin receptor). Nestin expression by islet-derived progenitor or stem cells was used as a marker to define these elements as stem cells (Fig 3A).18,23–28 Cytokeratins (CK) 18 and 19 (Fig 2E) were not expressed by rPI-SCs. Their absence may be critical to show that the pancreatic
islet-derived stem cells do not result from epithelial-tomesenchymal transition.27,28 Gene Expression Profiles of rPI-SCs
Table 2 summarizes the results of the reverse transcription PCR analysis of rPI-SCs. The expression of embryonic stem cell marker genes (REX1, OCT4, SOX2) indicated a selfrenewal capacity. Moreover, SCs were investigated for the presence of antigen-presentating, immunmodulating or suppressing molecules. rPI-SCs was not detected to express the counterligand of CD28 CD86 but did show CD80 (Fig 4). Interestingly, besides CD80, rPI-SCs showed the expression of another costimulatory protein CD40 that is represented on APCs. MAPKAPK2 is related to the kinases that mediate a wide range of biological functions in response to mitogenic and stressful stimuli. TNIP1, the A20-binding inhibi-
PANCREATIC ISLET-DERIVED STEM CELLS
3667
Fig 2. Representative panels of immunofluorescence detection of some markers on rat pancreatic islet-derived stem cells (rPI-SCs). Almost all the rPI-SCs expressed actin (A), fibronectin (B), vimentin (C), and ␣-SMA (F), in the cytoplasm. Stem cells were exhibiting large, flattened, or fibroblast-like morphology and stained negative for PDX-1 (D) and cytokeratin-19 (F). Nuclei were labeled with DAPI (blue). Scale bars ⫽ 50 m.
tor of nuclear factor-kappa B activation 1 (ABIN1), previously known as A20, is another antiapoptotic (stress) gone like MAPKAPK2, which are expressed by the rPI-SCs (Fig
4). In addition, rPI-SCs expressed BCL3, an antiapoptatic gene, and interleukin 6 receptor (IL6R), but failed to express MHC class II molecules (Fig 4). IllR, also known as
Fig 3. Immunophenotype of cultured rat pancreatic islet-derived stem cells (rPI-SCs). Representative staining patterns of third-passage cultures of rPI-SCs were shown for: Nestin (A), -tubulin (B), c-fos (C), ␣-SMA (D), and CD105 (F). The staining for CD31 was not observed (E). Nuclei were counterstained with haematoxylin. Control stains, negative for each protein, were not shown. Scale bars ⫽ 50 m.
3668
KARAOZ, OKCU, SAGLAM ET AL
Fig 4. Representative panel of reverse transcription polymerase chain reaction (PCR) analysis of rat pancreatic islet-derived stem cells. Internal controls: GAPDH and beta actin. Negative control: PCR mix without template.
CD126, is a type I cytokine receptor of interleukin 6 which is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. CX3CR1 is important for immune surveillance and the movement of mononuclear phagocytes in steady-state situation.29 Neutrophil cytosolic factor 1 (NCF1) is a component of the leukocyte NADPH oxidase complex that mediates formation of reactive oxygen intermediates, which play an important role in host defense and autoimmunity.19 CX3CR1 and NCF1 were expressed by rPI-SCs (Fig 4). DISCUSSION
Cultures of rPI-SCs did not contain the hematopoietic precursors, CD45 by flow cytometry or CD31, CD34, and CD71 by immunocytochemistry. In contrast, they expressed surface antigens of murine MSCs consistent with previous reports.15–20,23,24,27 We observed transcripts of OCT4, REX1, and SOX2, which are the master regulators of stem
cell renewal and differentiation genes, to be expressed by rPI-SCs. Without stimulation, rPI-SCs expressed CD80 and CD40, a finding in agreement with that of Klein et al who used total RNA isolated from human and nonhuman primate islets to show the expression of CD40.30 Our data, however, took this observation a step forward by addressing the source of CD40 mRNA, namely, stem cells in pancreatic islets. Despite the expression of CD80, we did not detect the CD86 transcript. Lei et al observed a similar phenomenon, such that murine-derived keratinocyte stem cells (KSCs) expressed CD80, but not CD86, indicating that KSCs could act as APCs.31 The flow cytometry data revealed a weak expression of the surface protein CD86, although its transcription was below the detectable level for cDNA. Constitutive expression of MHC class II molecules is confined to professional APCs of the immune system. In the present study, rPI-SCs did not express MHC class II, which indicated that these cells are nonprofessional APCs.
PANCREATIC ISLET-DERIVED STEM CELLS
CX3CR1 the human receptor for fractalkine,32 is expressed in monocytes as well as subsets of NK cells, dendritic cells, and brain microglial cells in a knockout mouse in which the CX3CR1 gene was replaced by a green fluorescent protein.33 The expression of CX3CR1 in dendritic cells strengthens our hypothesis that stem cells in pancreatic islets are the previously defined dendritic cells of pancreatic islets.10 –12 Genes with known antiapoptotic functions that are expressed under stress include MAPKAPK2, TNIP1, and BCL3. We examined the expression of these genes in stem cells. MAPKAPK2 is a direct substrate of p38 mitogenactivated protein kinase in response to cellular stress such as mechanical, heat shock, osmotic UV irradiation, bacterial lipopolysaccharide, several inflammatory cytokines, and growth factor stimulation.34 TNIP1 was originally described as an antiapoptotic TNF-␣-induced gene in endothelial cells.35 BCL3, in complex with p52, promotes transcription of genes encoding the cell cycle regulator cyclin D1 and the antiapoptotic BCL2 protein.36 The data presented herein showed the expression of all three genes in rPI-SCs. Expression of these genes by rPI-SCs implied a role of rPI-SCs in the regulation of immunity and tissue homeostasis in islets, highlighting antiapoptotic mechanisms that may show protective roles on pancreatic islet cells. Only some cells, mainly hepatocytes and several leukocytes, express IL6R. Surprisingly, stem cells of this study, the receptor for interleukin-6, an inflammatory cytokine with a well-documented role in inflammation and cancer. High levels of interleukin-6 and sIL6R have been reported in several chronic inflammatory and autoimmune diseases.37 Since type 1 diabetes is an autoimmune disease, we hypothesized that IL6R-positive rPI-SCs may have a pivotal role in the pathogenesis of type 1 diabetes. All of the data presented herein raise a major question do stem cells localized in pancreatic islets play a role in the pathogenesis of type 1 diabetes. rPI-SCs play roles in immune system homeostasis, besides regenerative functions. We strongly suggest that unstimulated stem cells in islets may behave as conditional (or facultative) APCs able to activate antigen-specific immune responses. In addition, previous studies have reported defective dentritic cells generation in vitro from bone marrow of NOD mice.38 They suggested that these anomalies potentially contribute to the dysfunctional regulation of tolerance in NOD mice. In light of these findings, we additionally suggest that type 1 diabetes may be a stem cell disease related to their possible role in antigen presentation. Strategies to correct -cell loss in type 1 diabetes should, therefore, target islet derived stem cells to prevent -cell destruction. We consequently suggest that in vivo and in vitro studies genomic-and postgenomiclevel should be performed with pancreatic islet stem cells. ACKNOWLEDGMENT This study was supported by grants (107S276) of the Scientific and Research Council of Turkey (TUBITAK) and Turkish Diabetes
3669 Foundation (2009/01). We thank Ayça Aksoy and Gülay Bayazit for their excellent technical assistance in this study.
REFERENCES 1. Aggarwal S, Pittenger MF: Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105:1815, 2005 2. Sudres M, Norol F, Trenado A, et al: Bone marrow mesenchymal stem cells suppress lymphocyte proliferation in vitro but fail to prevent graft-versus-host disease in mice. J Immunol 2006; 176:7761, 2006 3. Spaggiari GM, Capobianco A, Abdelrazik H, et al: Mesenchymal stem cells inhibit natural killer-cell proliferation, cytotoxicity, and cytokine production: role of indoleamine 2,3-dioxygenase and prostaglandin E2. Blood 111:1327, 2008 4. Comoli P, Ginevri F, Maccario R, et al: Human mesenchymal stem cells inhibit antibody production induced in vitro by allostimulation. Nephrol Dial Transplant 23:1196, 2008 5. Nauta AJ, Kruisselbrink AB, Lurvink E, et al: Mesenchymal stem cells inhibit generation and function of both CD34⫹-derived and monocyte-derived dentritic cells. J Immunol 177:2080, 2006 6. Stagg J, Pommey S, Eliopoulos N, et al: Interferon-gammastimulated marrow stromal cells: a new type of nonhematopoietic antigen-presenting cell. Blood 107:2570, 2006 7. Chan JL, Tang KC, Patel AP, et al: Antigen-presenting property of mesenchymal stem cells occurs during a narrow window at low levels of interferon-gamma. Blood 107:4817, 2006 8. Morandi F, Raffaghello L, Bianchi G: Immunogenicity of human mesenchymal stem cells in HLA-class I-restricted T-cell responses against viral or tumor-associated antigens. Stem Cells 26:1275, 2008 9. Lacy PE, Davie JM, Finke EH: Prolongation of islet allograft survival following in vitro culture (24 degrees C) and a single injection of ALS. Science 204:312, 1979 10. Adorini L: Interleukin 12 and autoimmune diabetes. Nat Genet 27:131, 2001 11. Calderon B, Suri A, Miller MJ, et al: Dendritic cells in islets of Langerhans constitutively present beta cell-derived peptides bound to their class II MHC molecules. Proc Natl Acad Sci USA 105:6121, 2008 12. Karaoz E, Ayhan S, Gacar G, et al: Isolation and characterization of stem cells from pancreatic islet: pluripotency, differentiation potential and ultrastructural characteristics. Cytotherapy 12:288 –302, 2010 13. Dellê H, Saito MH, Yoshimoto PM, et al: The use of iodixanol for the purification of rat pancreatic islets. Transplant Proc 39:467, 2007 14. Karaoz E, Aksoy A, Ayhan S, et al: Characterization of mesenchymal stem cells from rat bone marrow: ultrastructural properties, differentiation potential and immunophenotypic markers. Histochem Cell Biol 132:533, 2009 15. Atouf F, Park CH, Pechhold K, et al: No evidence for mouse pancreatic beta-cell epithelial-mesenchymal transition in vitro. Diabetes 56:699, 2007 16. Chase LG, Ulloa-Montoya F, Kidder BL, et al: Islet-derived fibroblast-like cells are not derived via epithelial-mesenchymal transition from Pdx-1 or insulin-positive cells. Diabetes 56:3, 2007 17. Suzuki A, Nakauchi H, Taniguchi H: Prospective isolation of multipotent pancreatic progenitors using flow-cytometric cell sorting. Diabetes 53:2143, 2004 18. Zhang L, Hong TP, Hu J, et al: Nestin-positive progenitor cells isolated from human fetal pancreas have phenotypic markers identical to mesenchymal stem cells. World J Gastroenterol 11: 2906, 2005 19. Davani B, Ikonomou L, Raaka BM, et al: Human isletderived precursor cells are mesenchymal stromal cells that differentiate and mature to hormone-expressing cells in vivo. Stem Cells 25:3215, 2007
3670 20. Gallo R, Gambelli F, Gava B, et al: Generation and expansion of multipotent mesenchymal progenitor cells from cultured human pancreatic islets. Cell Death Differ 14:1860, 2007 21. Sordi V, Malosio ML, Marchesi F, et al: Bone marrow mesenchymal stem cells express a restricted set of functionally active chemokine receptors capable of promoting migration to pancreatic islets. Blood 106:419, 2005 22. Xiao M, An L, Yang X, et al: Establishing a human pancreatic stem cell line and transplanting induced pancreatic islets to reverse experimental diabetes in rats. Sci China C Life Sci 51:779, 2008 23. Zulewski H, Abraham EJ, Gerlach MJ, et al: Multipotential nestin-positive stem cells isolated from adult pancreatic islets differentiate ex vivo into pancreatic endocrine, exocrine, and hepatic phenotypes. Diabetes 50:521, 2001 24. Eberhardt M, Salmon P, von Mach MA, et al: Multipotential nestin and Isl-1 positive mesenchymal stem cells isolated from human pancreatic islets. Biochem Biophys Res Commun 345:1167, 2006 25. Abraham EJ, Kodama S, Lin JC, et al: Human pancreatic islet-derived progenitor cell engraftment in immunocompetent mice. Am J Pathol 164:817, 2004 26. Claiborn KC, Stoffers DA: Toward a cell-based cure for diabetes: advances in production and transplant of beta cells. Mt Sinai J Med 75:362, 2008 27. Gershengorn MC, Geras-Raaka E, Hardikar AA, et al: Are better islet cell precursors generated by epithelial-to-mesenchymal transition? Cell Cycle 4:380, 2005 28. Gershengorn MC, Hardikar AA, Wei C, et al: Epithelial-tomesenchymal transition generates proliferative human islet precursor cells. Science 306:2261, 2004
KARAOZ, OKCU, SAGLAM ET AL 29. Geissmann F, Jung S, Littman DR: Blood monocytes consist of two principal subsets with distinct migratory properties. Immunity 19:71, 2003 30. Klein D, Barbé-Tuana F, Pugliese A, et al: A functional CD40 receptor is expressed in pancreatic beta cells. Diabetologia 48:268, 2005 31. Lei L, Cheng J, Li Y, et al: CD80, but not CD86, express on cultured murine keratinocyte stem cells. Transplant Proc 37:289, 2005 32. Imai T, Hieshima K, Haskell C, et al: Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell 91:521, 1997 33. Jung S, Aliberti J, Graemmel P, et al: Analysis of fractalkine receptor CX(3)CR1 function by targeted deletion and green fluorescent protein reporter gene insertion. Mol Cell Biol 20:4106, 2000 34. Ono K, Han J: The p38 signal transduction pathway: activation and function. Cell Signal 12:1, 2000 35. Opipari AW Jr, Boguski MS, Dixit VM: The A20 cDNA induced by tumor necrosis factor alpha encodes a novel type of zinc finger protein. J Biol Chem 265:14705, 1990 36. Kashatus D, Cogswell P, Baldwin AS: Expression of the Bcl-3 proto-oncogene suppresses p53 activation. Genes Dev 20: 225, 2006 37. Rose-John S, Waetzig GH, Scheller J, et al: The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets 11:613, 2007 38. Nikolic T, Bunk M, Drexhage HA, et al: Bone marrow precursors of nonobese diabetic mice develop into defective macrophage-like dendritic cells in vitro. J Immunol 173:4342, 2004